Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
|
|
- Stella Thomas
- 6 years ago
- Views:
Transcription
1 Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription factors genes organized in 4 clusters Four clusters called HOXA to HOXD Specify positional identity of cells
2 Hox genes Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
3 Hox genes
4 Hox genes show colinearity Colinearity - order of genes is same as the head-to-tail expression pattern!!! Temporal and spatial expression pattern is correlated to location in cluster! Mallo, M and Alonso, CR (2013). The regulation of Hox gene expression during animal development. Development 140:
5 Hox genes show colinearity This expression is maintained epigenetically. Mallo, M and Alonso, CR (2013). The regulation of Hox gene expression during animal development. Development 140:
6 This relationship is evolutionarily conserved vertebrates had 2 rounds of genome duplication
7 This relationship is evolutionarily conserved Lemons, D and McGinnis, W (2006). Genomic evolution of Hox gene clusters. Science 313:
8 This head to toe expression pattern is produced by regulation at many levels during gene expression. Expression is molded by transcription factors involved in earlier steps of development a memory system that uses Polycomb (PcG) and Trithorax (TrxG) group proteins regulation of one Hox gene by another micrornas lncrnas
9 Epigenetic regulation Transcriptional activation produced by transcription factors in early embryo are remembered through the action of Polycomb (PcG) and Trithorax (TrxG) group transcription factors.
10 Epigenetic regulation Trithorax group (TrxG) H3K4 HMTase produces H3K4me3 which maintains open chromatin Polycomb group (PcG) - two complexes belong here PRC1 and PRC2 PRC2 - H3K27 HMTase maintains closed chromatin PRC1 binds H3K27me3 and ubiquitylates H2A at K119 Montavon, T and Duboule, D (2013). Chromatin organization and global regulation of Hox gene clusters. Philos Trans R Soc
11 Representation of different aspects of Hox gene regulation associated with chromatin/nuclear characteristics. Mallo M, and Alonso C R Development 2013;140:
12 Vertebrates Embryonic Stem cells (a) (i) K27 K27 K27 K27 K27 K27 K27 K27 K27 K27 As the embryo develops H3K27me3 is removed and H3K4me3 appears. (ii) (iii) K27 demethylation, K4 methylation K27 K27 K27 K27 K4 K4 K4 K4 K4 K4 K27 demethylation, K4 methylation K4 K4 K4 K4 K4 K4 K4 K4 K4 K4 Montavon, T and Duboule, D (2013). Chromatin organization and global regulation of Hox gene clusters. Philos Trans R Soc Lond B Biol Sci 368:
13 Vertebrates Embryonic Stem cells (a) (i) Repression promotes movement and movement promotes repression (b) silent (i) K27 K27 K27 K27 K27 K27 K27 K27 K27 K27 anterior As the embryo develops H3K27me3 is removed and H3K4me3 appears. (ii) (iii) K27 demethylation, K4 methylation K27 K27 K27 K27 K4 K4 K4 K4 K4 K4 K27 demethylation, K4 methylation K4 K4 K4 K4 K4 K4 K4 K4 K4 K4 (ii) (iii) posterior Montavon, T and Duboule, D (2013). Chromatin organization and global regulation of Hox gene clusters. Philos Trans R Soc Lond B Biol Sci 368: ollinearity during trunk extension and chromatin dynamics at Hox clusters. Expression of Hox gene along the anterior-to-posterior (AP) em active
14 HOTAIR Frances R Goodman. Congenital abnormalities of body patterning: embryology revisited/ The Lancet, Volume 362, Issue 9384, Pages , 23 August 2003 Temporal lncrna transcribed from between HOXC11 and HOXC12 Blocks expression in posterior Hox D cluster recruits PRC2 and the LSD histone demethylation
15 !"#$"%& Fatica, A and Bozzoni, I (2013). Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet #""&'%0"/#*.1'2./(!3, 0@345A6B#C 54DBEFB#) "#$%&'()*#* #$""-'%.4'/0$123.2'".5'*'"$ #&""()!!+= 8.:N5*1(43(8.:N5* :;5*. 8.:1G5*.,<<= +&,-. /%01 78,-1 "#$%&'()*#*!""!"#$%0"/#*.1'2./(!3, "#$%&'()*#* 0@345A6B#C 54DBEFB#) "#$%&' -3A#K$3B26B4#A>(3*)L>A643 "#$%&'!$""()!*+, /%01 :+,='M$4%7H-M %7H-(!&""+$0,7*89:2;".5'+$0,7*89:< 8.:1G5*. 8.:;5*. I0-; HIJ1!%"" O /%01!"#$(234546*3 8.:1G5*.!" ADVANCE ONLINE PUBLICATION!"""#$%&'()#*+,-()./)"0-1)$)&/* Macmillan Publishers Limited. All rights reserved
16 ! Fatica, A and Bozzoni, I (2013). Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet!$""()!*+, /%01 :+,='M$4%7H-M %7H-( 8.:1G5*. 8.:;5*.!%""456
17 !"#$"%& Fatica, A and Bozzoni, I (2013). Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet #""&'%0"/#*.1'2./(!3, 0@345A6B#C 54DBEFB#) "#$%&'()*#* #$""-'%.4'/0$123.2'".5'*'"$ #&""()!!+= 8.:N5*1(43(8.:N5* :;5*. 8.:1G5*.,<<= +&,-. /%01 78,-1 "#$%&'()*#*!""!"#$%0"/#*.1'2./(!3, "#$%&'()*#* 0@345A6B#C 54DBEFB#) "#$%&' -3A#K$3B26B4#A>(3*)L>A643 "#$%&'!$""()!*+, /%01 :+,='M$4%7H-M %7H-(!&""+$0,7*89:2;".5'+$0,7*89:< 8.:1G5*. 8.:;5*. I0-; HIJ1!%"" O /%01!"#$(234546*3 8.:1G5*.!" ADVANCE ONLINE PUBLICATION!"""#$%&'()#*+,-()./)"0-1)$)&/* Macmillan Publishers Limited. All rights reserved
18 "#$%&'()*#* #$""-'%.4'/0$123.2'".5'*'"$ :N5*1(43(8.:N5*. Fatica, A and Bozzoni, I (2013). Long non-coding RNAs: #&""()!!+= new players in cell differentiation and development. Nat Rev Genet 8.:1G5*. +&,-. /%01 78,-1!$""()!*+, /%01 :+,='M$4%7H-M %7H-(!""!"#$%0"/#*.1'2./(!3, 8.:1G5*. 8.:;5*.
Histones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationRepressive Transcription
Repressive Transcription The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Guenther, M. G., and R. A.
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationSegmentation. Serial Homology. Hox genes
Segmentation Hox genes Serial Homology William Bateson 1861-1926 Homeosis: a variation in which something has been changed into the likeness of something else Calvin Bridges at Columbia bithorax 1923 1
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationI) Development: tissue differentiation and timing II) Whole Chromosome Regulation
Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during
More informationLecture 8. Eukaryotic gene regulation: post translational modifications of histones
Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationSTEM CELL GENETICS AND GENOMICS
STEM CELL GENETICS AND GENOMICS Concise Review: Roles of Polycomb Group Proteins in Development and Disease: A Stem Cell Perspective VINAGOLU K. RAJASEKHAR, a MARTIN BEGEMANN b a Memorial Sloan-Kettering
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationChromatin Modifications by Methylation and Ubiquitination: Implications in the Regulation of Gene Expression
Annu. Rev. Biochem. 2006. 75:243 69 First published online as a Review in Advance on February 22, 2006 The Annual Review of Biochemistry is online at biochem.annualreviews.org doi: 10.1146/ annurev.biochem.75.103004.142422
More informationThe genetics of heterochromatin. in metazoa. mutations by means of X-ray irradiation" "for the discovery of the production of
The genetics of heterochromatin in metazoa 1 Hermann Joseph Muller 1946 Nobel Prize in Medicine: "for the discovery of the production of mutations by means of X-ray irradiation" 3 4 The true meaning of
More informationThe controversial role of the Polycomb group proteins in transcription and cancer: how much do we not understand Polycomb proteins?
REVIEW ARTICLE The controversial role of the Polycomb group proteins in transcription and cancer: how much do we not understand Polycomb proteins? Andrea Scelfo, Andrea Piunti and Diego Pasini Department
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationPhD THESIS Epigenetic mechanisms involved in stem cell differentiation
Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationLong noncoding RNAs in DNA methylation: new players stepping into the old game
DOI 10.1186/s13578-016-0109-3 Cell & Bioscience REVIEW Long noncoding RNAs in DNA methylation: new players stepping into the old game Yu Zhao 1, Hao Sun 1,2* and Huating Wang 1,3* Open Access Abstract
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationA Genetic Program for Embryonic Development
Concept 18.4: A program of differential gene expression leads to the different cell types in a multicellular organism During embryonic development, a fertilized egg gives rise to many different cell types
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationDNA methylation and differentiation: HOX genes in muscle cells
Tsumagari et al. Epigenetics & Chromatin 2013, 6:25 RESEARCH Open Access DNA methylation and differentiation: HOX genes in muscle cells Koji Tsumagari 1, Carl Baribault 2, Jolyon Terragni 3, Sruti Chandra
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationEpigenetic Mechanisms
RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of
More informationFOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
More informationChromatin Structure & Gene activity part 2
Chromatin Structure & Gene activity part 2 Figure 13.30 Make sure that you understand it. It is good practice for identifying the purpose for various controls. Chromatin remodeling Acetylation helps to
More informationTITLE OF MODULE: Epigenetics in Development and Disease
TITLE OF MODULE: Epigenetics in Development and Disease MODULE NUMBER: BIO00013H ORGANISER: Dr. Louise Jones SUBJECT COMMITTEE: MBB VERSION: November 2011 TERM TAUGHT: Autumn 2012 PREREQUISITES: None ASSESSMENT:
More informationEMBO Workshop on. Upstream and Downstream of Hox genes
EMBO Workshop on Upstream and Downstream of Hox genes Centre for Cellular and Molecular Biology Hyderabad, India 500007 http://events.embo.org/14-hox/index.html December 13, 2014 (Saturday) 15:00 Registration
More informationHistones are post-translationally
Perspective Cell Cycle 10:3, 413-424; February 1, 2011; 2011 Landes Bioscience Perspective Selective targeting of histone methylation Abul BMMK Islam, 1 William F. Richter, 2 Nuria Lopez-Bigas 1 and Elizaveta
More informationEpigene.cs: What is it and how it effects our health? Overview. Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa
Epigene.cs: What is it and how it effects our health? Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa Overview Basic Background Epigene.cs in general Epigene.cs in cancer Epigene.cs
More informationHOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma
HOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma Keneng Chen, M.D., PhD, RCSF Luyan Shen, M.D., PhD 2015/4/28 Department of Thoracic Surgery I, Key Laboratory
More informationA balancing act: heterochromatin protein 1a and the Polycomb group coordinate their levels to silence chromatin in Drosophila
Cabrera et al. Epigenetics & Chromatin (2015) 8:17 DOI 10.1186/s13072-015-0010-z RESEARCH Open Access A balancing act: heterochromatin protein 1a and the Polycomb group coordinate their levels to silence
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationChromatin structure and epigenetic regulation of eukaryotic gene expression. Giacomo Cavalli
Chromatin structure and epigenetic regulation of eukaryotic gene expression Giacomo Cavalli 12.09.2016 10,000 nm DNA compaction in a human nucleus 11 nm 30nm 1bp (0.3nm) compact size DNA length compaction
More informationH2B Monoubiquitylation and H3 Methylation Levels
Pittard 1 H2B Monoubiquitylation and H3 Methylation Levels Throughout Drosophila Development By Holly Pittard Senior Honors Thesis Biology University of North Carolina at Chapel Hill April16, 2016 This
More informationreview Regulation of mammalian cell differentiation by long non-coding RNAs review
Regulation of mammalian cell differentiation by long non-coding RNAs Wenqian Hu 1, Juan R. Alvarez-Dominguez 1,2 & Harvey F. Lodish 1,2,3+ 1 Whitehead Institute for Biomedical Research, 2 Department of
More informationEpigenetics and Chromatin
Progress in Molecular and Subcellular Biology 38 Epigenetics and Chromatin Bearbeitet von Philippe Jeanteur 1. Auflage 2008. Taschenbuch. xiii, 266 S. Paperback ISBN 978 3 540 85236 0 Format (B x L): 15,5
More informationRegulatory Roles of Noncoding RNA in Development and Disease
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 940 Regulatory Roles of Noncoding RNA in Development and Disease GAURAV KUMAR PANDEY ACTA UNIVERSITATIS UPSALIENSIS
More informationOncology 520 Epigene0cs and Cancer. February 16, 2011
Oncology 520 Epigene0cs and Cancer February 16, 2011 Outline What is epigene0cs? What are examples of epigene0c processes? What is the epigenome and how is it decoded? Are epigene0c mechanisms important
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationPatterning the Embryo
Patterning the Embryo Anteroposterior axis Regional Identity in the Vertebrate Neural Tube Fig. 2.2 1 Brain and Segmental Ganglia in Drosophila Fig. 2.1 Genes that create positional and segment identity
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationPolarity and Segmentation. Chapter Two
Polarity and Segmentation Chapter Two Polarization Entire body plan is polarized One end is different than the other Head vs. Tail Anterior vs. Posterior Front vs. Back Ventral vs. Dorsal Majority of neural
More informationFunctional annotation of farm animal genomes: ChIP-seq.
Functional annotation of farm animal genomes: ChIP-seq Richard Crooijmans 2018, PAGXXVI Richard.Crooijmans@wur.nl Why FAANG is important Understanding the genotype to phenotype link This needs: - genomic
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationEpigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationTHE ROLE OF POLYCOMB GROUP PROTEIN EZH2 IN CANCER PROGRESSION. Qi Cao
THE ROLE OF POLYCOMB GROUP PROTEIN EZH2 IN CANCER PROGRESSION by Qi Cao A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Pathology) in The University
More informationTetrapod Limb Development
IBS 8102 Cell, Molecular and Developmental Biology Tetrapod Limb Development February 11, 2008 Tetrapod Limbs Merlin D. Tuttle Vicki Lockard and Paul Barry Father Alejandro Sanchez Anne Fischer Limb Patterning
More informationNUCLEAR ORGANIZATION OF MOUSE HOX CLUSTER PARALOGS DURING MOUSE EMBRYONIC STEM CELL DIFFERENTIATION TO NEURAL STEM CELL PRIYA PANICKER
NUCLEAR ORGANIZATION OF MOUSE HOX CLUSTER PARALOGS DURING MOUSE EMBRYONIC STEM CELL DIFFERENTIATION TO NEURAL STEM CELL By PRIYA PANICKER A Thesis submitted to The Graduate School of New Brunswick Rutgers,
More informationInt. J. Dev. Biol. CORRIGENDUM
Int. J. Dev. Biol. [In Press] (Use DOI or consult the journal web for the definitive reference of this article) doi: 10.1387/ijdb.123515co CORRIGENDUM for article in the following pages: ANTONY J. DURSTON,
More informationEVO-DEVO: Evolution of animal design Lecture 4
Eddy De Robertis Page 1 Hox Genes EVO-DEVO: Evolution of animal design Lecture 4 Naturalists were interested in transformations of one region of the body into another, in order to explain the discontinuous
More informationTranscriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
More informationTetrapod Limb Development
Biology 4361 Developmental Biology Tetrapod Limb Development July 29, 2009 Tetrapod Limbs Merlin D. Tuttle Vicki Lockard and Paul Barry Father Alejandro Sanchez Anne Fischer Limb Development - Overview
More informationThe interplay of histone modifications writers that read
Review Histones and Chromatin Review series The interplay of histone modifications writers that read Tianyi Zhang, Sarah Cooper *, & Neil Brockdorff Abstract Histones are subject to a vast array of posttranslational
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationTARGETING EZH2 WITH TAZEMETOSTAT IN FOLLICULAR LYMPHOMA
TARGETING EZH2 WITH TAZEMETOSTAT IN FOLLICULAR LYMPHOMA VINCENT RIBRAG Chairman hematological multidisciplinary committee Ditep (chief molecular therapeutics in hematological early drug development) Bologna
More informationSex specific chromatin landscapes in an ultra compact chordate genome
DOI 10.1186/s13072-016-0110-4 Epigenetics & Chromatin RESEARCH Sex specific chromatin landscapes in an ultra compact chordate genome Pavla Navratilova 1, Gemma Barbara Danks 1, Abby Long 2, Stephen Butcher
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationGenomic Methods in Cancer Epigenetic Dysregulation
Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationRegistration Continental Breakfast. Histone Modifications and Cancer- Part 1
Miami Epigenetics & Cancer Symposium Sunday, November 27 Tuesday, November 29, 2016 Ritz-Carlton, Miami Beach Conference Room: Collins for the Office SPEAKERS PROGRAM Sunday, November 27, 2016 Speakers
More informationHox Genes: Embryonic Development
Thomas Lufkin, Mount Sinai School of Medicine, New York, USA Four clustered gene complexes of DNA-binding transcriptional regulators known as the Hox genes are the principal directors of embryonic development
More informationEpigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN
Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural
More informationPRC2 crystal clear. Matthieu Schapira
PRC2 crystal clear Matthieu Schapira Epigenetic mechanisms control the combination of genes that are switched on and off in any given cell. In turn, this combination, called the transcriptional program,
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationPromiscuous RNA binding by Polycomb Repressive Complex 2
Promiscuous RNA binding by Polycomb Repressive Complex 2 Chen Davidovich 1,2, Leon Zheng 3, Karen J. Goodrich 1,2, and Thomas R. Cech 1,2,4 1 Department of Chemistry & Biochemistry, Howard Hughes Medical
More informationLncRNAs: The Ideal Composer of the Melody for Life
RNA and Transcription 2016; 2(2): 11-15 http://www.sciencepublishinggroup.com/j/rnat doi: 10.11648/j.rnat.20160202.11 Review Article LncRNAs: The Ideal Composer of the Melody for Life Qingyu Cheng 1, Shengwei
More informationNIH Public Access Author Manuscript Neuron. Author manuscript; available in PMC 2011 March 9.
NIH Public Access Author Manuscript Published in final edited form as: Neuron. 2010 September 9; 67(5): 781 796. doi:10.1016/j.neuron.2010.08.008. Global Control of Motor Neuron Topography Mediated by
More informationEpigenetic regulation of endogenous genes and developmental processes
Epigenetic regulation of endogenous genes and developmental processes Epigenetic programming in plants helps control developmental transitions Embryonic to vegetative transition Vegetative to reproductive
More informationTetrapod Limb Development
Biology 4361 Developmental Biology Tetrapod Limb Development July 29, 2009 Tetrapod Limbs Merlin D. Tuttle Vicki Lockard and Paul Barry Father Alejandro Sanchez Anne Fischer Limb Development - Overview
More informationOriginal Article HOTAIR is upregulated in acute myeloid leukemia and that indicates a poor prognosis
Int J Clin Exp Pathol 2015;8(6):7223-7228 www.ijcep.com /ISSN:1936-2625/IJCEP0008393 Original Article HOTAIR is upregulated in acute myeloid leukemia and that indicates a poor prognosis Shanfeng Hao, Zonghong
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationNoncoding RNA in Oncogenesis: A New Era of Identifying Key Players
Int. J. Mol. Sci. 2013, 14, 18319-18349; doi:10.3390/ijms140918319 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Noncoding RNA in Oncogenesis:
More informationVertebrate Limb Patterning
Vertebrate Limb Patterning What makes limb patterning an interesting/useful developmental system How limbs develop Key events in limb development positioning and specification initiation of outgrowth establishment
More informationBivalent-chromatin and epigenetics alterations in Glioma
Bivalent-chromatin and epigenetics alterations in Glioma Philippe ARNAUD GReD CNRS 6293 - Clermont Universités- INSERM U1103 Clermont-Ferrand, FRANCE Forum de la Recherche en Cancérologie Auvergne-Rhône
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationPrecision medicine: How to exploit the growing knowledge on the evolving genomes of cells to improve cancer prevention and therapy.
Precision medicine: How to exploit the growing knowledge on the evolving genomes of cells to improve cancer prevention and therapy Joe Costello, PhD Department of Neurological Surgery A more accurate and
More informationHypoxia increases genome wide bivalent epigenetic marking by specific gain of H3K27me3
DOI 1.1186/s1372-16-86- Epigenetics & Chromatin RESEARCH Open Access Hypoxia increases genome wide bivalent epigenetic marking by specific gain of H3K27me3 Peggy Prickaerts 1, Michiel E. Adriaens 2,3,
More informationMolecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras
Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module-9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 6 Epigenetics
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationCo-Regulation of Histone-Modifying Enzymes in Cancer
in Cancer Abul B. M. M. K. Islam 1,2, William F. Richter 1, Laura A. Jacobs 1, Nuria Lopez-Bigas 2, Elizaveta V. Benevolenskaya 1 * 1 Department of Biochemistry and Molecular Genetics, University of Illinois
More informationEpigenetics q&more 01.11
Laurie. Knight, istockphoto.com Epigenetics 6 Bookmarks About the reading of genes in the Book of Life Prof. Dr. Manfred Jung, Julia M. Wagner, Institute for Pharmaceutical Sciences, Albert-Ludwig-University
More informationTITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation
AD Award Number: W81XWH-12-1-0463 TITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation PRINCIPAL INVESTIGATOR: Jisheng Zhang CONTRACTING ORGANIZATION:
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationGenetics and Genomics in Medicine Chapter 6. Questions & Answers
Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the
More informationEpigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
More informationDedicated to my family
Dedicated to my family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Mohammad F*, Pandey RR*, Nagano T, Chakalova L, Mondal
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationAGCGGCTGGTGTATGAGG AGCTCGAGCTGCAGGACT AAAGGTGCACTGGTAGCC AGGGCACAAGTGCATGGC CCCGCTGTGCAGAAGTAG
Supplementary Table S1. Primer sequence information Gene Primer sequence 1 st round PCR 2 nd round PCR Accession# Dnmt3a TCAAGGAGATCATTGATG TGTTCCCACACATGAGCA AGCGGCTGGTGTATGAGG AGCAGATGGTGCAATAGGAC NM_007872.4
More informationSupplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji
More informationGene Regulation. Bacteria. Chapter 18: Regulation of Gene Expression
Chapter 18: Regulation of Gene Expression A Biology 2013 1 Gene Regulation rokaryotes and eukaryotes alter their gene expression in response to their changing environment In multicellular eukaryotes, gene
More informationDNA methylation: a potential clinical biomarker for the detection of human cancers
DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,
More information