Supporting Information

Transcription

1 Supporting Information Discovery of linear low-cationic peptides to target methicillin-resistant Staphylococcus aureus in vivo Yuan Liu, Meirong Song, Shuangyang Ding,, Kui Zhu*,,, Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Veterinary Medicine, China Agricultural University, No.2 Yuanmingyuan West Road, Haidian, Beijing, China National Center for Veterinary Drug Safety Evaluation, College of Veterinary Medicine, China Agricultural University, No.2 Yuanmingyuan West Road, Haidian, Beijing, China Beijing Key Laboratory of Detection Technology for Animal-Derived Food Safety and Beijing Laboratory for Food Quality and Safety, No.2 Yuanmingyuan West Road, Haidian, Beijing, China Correspondence author: (K.Z.). This file includes: Supplemental Figures (1-11) Supplemental Tables (1-8) S1

2 Content list Figures Figure S S3 Figure S S4 Figure S S5 Figure S S6 Figure S S7 Figure S S8 Figure S S9 Figure S S10 Figure S S11 Figure S S12-S13 Figure S S14 Tables Table S S15-S16 Table S S17 Table S S18 Table S S19 Table S S20 Table S S21-S22 Table S S23 Table S S24 S2

3 Figures Figure S1 Antibacterial activity of L-alanine substitutions of bacaucin-1 against S. aureus ATCC S3

4 Figure S2 Bacaucin-1a is thermostable under physiological ph. Residual antibacterial activity of bacaucin-1a after treating at different temperatures ranging from 20 C to 121 C for 1 h (A) and at different ph ranging from 2.0 to 12.0 at 37 C for 1 h (B). S. aureus ATCC was used as the test strain. S4

5 Figure S3 Safety evaluation of bacaucin-1a on red blood cells and Vero mammalian cell line. (A) Hemolytic activity of bacaucin-1a to the red blood cells of sheep. (B) Cell viability of Vero cell treated with bacaucin-1a based on WST-1 tests. S5

6 Figure S4 Bacaucin-1a and ampicillin/rifampicin act in synergy. (A) Scheme of antibacterial mechanism of antibiotics from five classes. (B to F) Interaction of bacaucin-1a ( 0.5 MIC) and ampicillin (B), ciprofloxacin (C), colistin (D), rifampicin (E) and tetracycline (F) against MRSA 1518 (B to E), T144 (F) based on chequerboard broth microdilution tests. The MICs of bacaucin-1a for these strains were 2 µg/ml. S6

7 Figure S5 Synergy of bacaucin-1a and rifampicin is species-specific. Chequerboard broth microdilution assays between bacaucin-1a ( 0.5 MIC) and rifampicin against RIF-resistant strains, including MRSA 6R (A), PTB23 (B), G16 (C), G19 (D), E. faecalis JH2-2 (E) and E. coli EC600 (F). S7

8 Figure S6 There is no intermolecular or intramolecular interaction in bacaucin-1a. (A) Dynamic light scattering of bacaucin-1a at 20 C for 26 h. (B) 1 H NMR spectrum and (C) 13 C NMR spectrum (600 MHz) of bacaucin-1a in DMSO-d 6. S8

9 Figure S7 Screening bacaucin-1a resistant mutants by continuous passage culture method. (A) Scheme of resistance development experiment treated by sub-inhibitory bacaucin-1a. (B) Dynamic curve of bacaucin-1a resistant mutants. (C) Percentage of four SNPs in 30 resistant mutants. S9

10 Figure S8 Total protein expression of S. aureus ATCC and bacaucin-1a resistantmutant (32-fold MIC) by SDS-PAGE analysis. S10

11 Figure S9 Morphological changes of S. aureus ATCC and resistant mutant (32-fold MIC) treated with bacaucin-1a visualized by SEM. S11

12 S12

13 Figure S10 Membrane dysfunctions of S. aureus ATCC triggered by bacaucin-1a. (A) Bacaucin-1a is active against S. aureus. Fluorescence micrographs of S. aureus cells treated with PBS (vehicle), bacaucin-1a (2 μg/ml) and vancomycin (1 μg/ml). Viable cells were stained in green by SYTO9, whereas dead cells were in red by propidium iodide (Scale bar: 50 μm). Dynamic curves of increased membrane permeability of S. aureus in the presence of bacaucin-1a measured by propidium iodide in 2 h (B) and the relative fluorescence intensity (C) at the time point of 2 h. (D) Decreased concentration of intracellular Ca 2+ treated by bacaucin-1a for 1 h, measured by fluorescent probe Fluo-3AM. (E) Dissipated membrane potential by bacaucin-1a, probed with DiSC 3 (5) dyes. (F) Increased cellular total ROS by bacaucin-1a, probed with 2,7 - dichlorofluor-escein diacetate (DCFH-DA). Rosup was used as the positive control of ROS production. N.S., not significant, **P < 0.01, ***P < 0.001, determined by non-parametric oneway ANOVA. S13

14 Figure S11 Histopathological changes of different organs in control, infected and treated (20 mg/kg) groups in the mouse peritonitis model. The represented histopathological features in infected group were marked by one-way arrow. Scale bar, 100 µm. S14

15 Tables Table S1 Chemical information of bacaucin-1a derivatives. Derivatives Sequence Formula Molecular Purity pi # Hydrophobicity* (N C) weight (%) 1 ELLSRVD C 35 H 62 N 10 O ALLSRVD C 33 H 60 N 10 O LLLSRVD C 38 H 67 N 7 O FLLSRVD C 38 H 67 N 7 O CLLSRVD C 33 H 60 N 10 O 11 S (CLLSRVD) 2 C 66 H 118 N 20 O 22 S EALSRVD C 32 H 56 N 10 O EVLSRVD C 34 H 60 N 10 O EILSRVD C 35 H 62 N 10 O ESLSRVD C 32 H 56 N 10 O ELASRVD C 32 H 56 N 10 O ELVSRVD C 34 H 60 N 10 O ELISRVD C 35 H 62 N 10 O ELSSRVD C 32 H 56 N 10 O ELLARVD C 35 H 62 N 10 O ELLCRVD C 35 H 62 N 10 O 12 S ELLYRVD C 41 H 66 N 10 O ELLSAVD C 32 H 55 N 7 O ELLSKVD C 35 H 62 N 8 O ELLS-Orn-VD C 34 H 60 N 8 O ELLS-Cit-VD C 35 H 61 N 8 O ELLSRAD C 33 H 58 N 10 O ELLSRLD C 36 H 64 N 10 O ELLSRTD C 34 H 60 N 10 O ELLSRVA C 34 H 62 N 10 O ELLSRVE C 36 H 64 N 10 O ELLSRVN C 35 H 63 N 11 O ALLSRVA C 32 H 60 N 10 O ALLSRVK C 35 H 67 N 11 O ALLSRAD C 31 H 56 N 10 O ALLSRLD C 34 H 62 N 10 O ALLSRFD C 37 H 60 N 10 O ALLSAVD C 33 H 60 N 10 O 11 S ALLSKVD C 33 H 60 N 8 O S15

16 35 ALLS-Orn-VD C 38 H 67 N 7 O ALLS-Cit-VD C 33 H 59 N 8 O ALLARVD C 33 H 60 N 10 O ALLTRVD C 34 H 62 N 10 O ALLCRVD C 33 H 60 N 10 O 10 S ALLYRVD C 39 H 64 N 10 O # The pi values of derivatives were determined by ExPASy ( * Hydrophobicity was calculated by the percent of acetonitrile in water, 0.1% (vol/vol) trifluoroacetic acid (TFA) at HPLC elution. The higher percent acetonitrile, the higher the hydrophobicity. S16

17 Table S2 Bacteria strains used in this study. Strains Source/Reference Gram-positive bacteria Bacillus amyloliquefaciens ATCC B. cereus ATCC B. licheniformis ATCC B. subtilis ATCC 6051 Enterococcus faecalis VRE A4 E. faecalis 1F-1 E. faecalis 2F-7 (optra) Enterococcus faecium 5F-10 E. faecium 4W-9 (optra + cfr) Staphylococcus aureus ATCC S. aureus CVCC 2258 MRSA T144 MRSA 115 MRSA W7 MRSA 417 (cfr) MRSA 1518 (cfr) MRSA1530 (cfr) S. aureus 215 (LZD R + cfr) S. aureus 6R/PTB23/G16/G19 (RIF R ) S. epidermidis BTG88A S. xylosus JB01528D-3 S. sciuri 79C-1 S. haemolyticus RY412C-2 S. chromogenes GX1B S. lentus JB07107A-2 Streptococcus suis TZ 36-1 Gram-negative bacteria Escherichia coli ATCC Salmonella enterica ATCC Pseudomonas aeruginosa PAO1 ATCC Proteus mirabilis ATCC ATCC, American Type Culture Collection; CVCC, China Institute of Veterinary Culture Collection; LZD, linezolid; RIF, rifampicin. S17

18 Table S3 Effect of the conformation of amino acid side-chains in bacaucin-1a on the antibacterial activity against S. aureus. Bacaucin-1a and its analogs MIC (µg/ml) L-Ala-L-Leu-L-Leu-L-Ser-L-Arg-L-Val-L-Asp 2 D-Ala-D-Leu-D-Leu-D-Ser-D-Arg-D-Val-D-Asp 32 D-Ala-L-Leu-D-Leu-L-Ser-D-Arg-L-Val-D-Asp 64 L-Ala-D-Leu-L-Leu-D-Ser-L-Arg-D-Val-L-Asp 16 D-Ala-L-Leu-L-Leu-L-Ser-L-Arg-L-Val-L-Asp 8 D-Ala-D-Leu-L-Leu-L-Ser-L-Arg-L-Val-L-Asp 16 S18

19 Table S4 Effect of proteinase and serum on the antibacterial activity of bacaucin-1a against S. aureus ATCC (MIC, µg/ml). Treatments Targeting sites Bacaucin-1 Bacaucin-1a PBS Proteinase K Ser 8 2 Trypsin Arg, Lys 16 4 Pepsin Tyr, Phe, Trp 4 2 Papain Arg, Lys, Gly % fetal bovine serum S19

20 Table S5 Antibacterial spectrum of bacaucin-1a (MIC, µg/ml). Organism Bacaucin-1 Bacaucin-1a Gram-positive Bacillus amyloliquefaciens 64 8 B. cereus 64 2 B. licheniformis B. subtilis Enterococcus faecalis >128 >128 E. faecalis (VRE) >128 >128 E. faecalis (optra) >128 >128 Enterococcus faecium >128 >128 E. faecium (optra + cfr) >128 >128 Staphylococcus aureus 4 2 MRSA 4 2 MRSA (cfr) 2 2 S. aureus (LZD R + cfr) 4 2 S. epidermidis 16 S. xylosus 64 S. sciuri 64 S. haemolyticus 16 S. chromogenes 16 S. lentus 64 Streptococcus suis 8 Gram-negative Escherichia coli >128 >128 Salmonella enterica >128 >128 Pseudomonas aeruginosa PAO1 >128 >128 Proteus mirabilis >128 >128, not determined. S20

21 Table S6 Antibacterial activity of bacaucin-1a against 100 clinical MRSA isolates. Clinical MRSA isolates MIC (µg/ml) S21 Clinical MRSA isolates (Continued) Human origin (52) Animal origin (48) Zhejiang province Ningxia province T T T T T T T T T T Shandong province AB AB AB L L L P P CD CD J2 2 Sichuan province EF EF Henan province 3 4 M M SB SB SB B B B17 2 6R 4 B B19 2 MIC (µg/ml) (Continued)

22 8 4 B Shanghai province m m m m-52 2 Henan province 2m m m m m m-64 4 Guangdong province 2m m m m74 (1) S22

23 Table S7 List of SNPs in bacaucin-1a resistant mutants. Mutant Mapping Position Reference Alteration Amino acid Product change _contig_1 46 A G Lys Glu Hypothetical protein _contig_ T C Leu Pro GMP synthase _contig_ G A Ala Thr Hypothetical protein _contig_ C T Gln ---- RNA polymerase sigma factor SigB ----, Termination codon. S23

24 Table S8 Primers used in this study. Primer Sequence (5-3 ) Product (bp) hypo1-f GACCACCGGTCGATAGTGTA 169 hypo1-r GGTGTCGTTATTGTCTTCTCACC GMPS-F ACGTCGCATTTATGGTGTGC 486 GMPS-R TGCGCAAGGAAGTCTACACC hypo3-f CGCTGACTTGCATTGTCTGT 539 hypo3-r ATTCTAGTCAACCTTGCCGGG sigb-f GGCGAAAGAGTCGAAATCAGC 697 sigb-r ACCGATACGCTCACCTGTCT S24