Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D.
|
|
- Buck Glenn
- 5 years ago
- Views:
Transcription
1 Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D. Professor of Pathology Director, Molecular Pathology Dartmouth Medical School Dartmouth Hitchcock Medical Center Norris Cotton Cancer Center Lebanon, NH
2 CANADA DHMC, Lebanon, NH * * California Boston, MA Texas Florida
3
4
5
6
7 Current Patient Management Is Based on Diagnosis 1.4M New Cancers (US) H&E for Morphology Further Diagnostic Work-up Imaging (CT, MRI, PET) Immuno (IHC), molecular, Proteomic Therapeutic management
8 Hallmarks of Human Cancer Self-sufficiency in growth signals Evading apoptosis Insensitivity to antigrowth signals Sustained angiogenesis Tissue invasion and metastasis Limitless replicative potential
9 Gene Mutations Cause Cancer = New Biomarkers Single gene = Single mutation = Cancer
10 Nothing Else Looks Like This!
11 Susan G. Komen Race for the Cure - Indianapolis
12 Traditional Processing of Tissues
13 Traditional Technologies for Pathology Workup ImmunoHistoChemistry (IHC) Fluorescence in situ Hybridization (FISH) Inexpensive Subjective scoring Semi-quantitative Protein target may be affected by tissue processing Fluorescent labeled DNA probes hybridize to target Hybridized DNA probes fluoresce, giving off brightly lit signals that are easily viewed and analyzed
14 Current Clinical Mutation Analysis Data KRAS Gly13Asp BRAF V600E EGFR Exon 21 Electropherogram
15 Signal Vic (fluorescence) Evolving Molecular Technologies Cycle neg. control SNP Genotyping Assay Fam (fluorescence) Real Time PCR: 1. All specimen types 2. Increased sensitivity and specificity 3. Quantification possible 4. TAT = 2-3 hours
16 qbiomarker Somatic Mutation PCR Array: Human EGFR Pathway qbiomarker Somatic Mutation PCR Array Data Symbol CSMIC ID nt change AA change Known EGFR Known KRAS Known BRAF Mutation Mutation Mutation BRAF 476 c.1799t>a p.v600e EGFR c.2572c>a p.l858m KRAS 532 c.38g>a p.g13d - + -
17 Genomic Approaches to Clinical ncology Tumor classification Prognostic markers Predictive indicators of drug response New therapeutics Monitoring disease Susceptibility to cancer
18 Cystic Fibrosis Single gene disorder (CFTR ) 27 exons, 23 kb F508 >1,800 mutations Clinical heterogeneity Screening program 2001 Treatment of symptoms VX-770 small molecule drug G551D specific (4%) VX F508 specific (90%)
19 Therapies in Human Cancer Challenges: Limited efficacy Emergence of resistance Unexpected toxicities
20 Personalized Medicine
21 Personalized Medicine Current Practice Personalized Medicine ne size fits all Trial and Error Trial and error The right treatment for the right person at the right time
22 Personalized for the Individual Patient ptimal drug response Reduced adverse effects Systemic response
23 Irinotecan Toxicity CAMPTSAR (irinotecan) first line therapy in metastatic colorectal cancer 20-35% of patients experience ADRs
24 Irinotecan Metabolism N N N CH 3 N H H 3 C CES H N CH 3 N H H 3 C UGT1A1 H H H H N CH 3 N H H 3 C Irinotecan SN-38 SN-38G CPT-11, 7-ethyl-10[4-(1-(piperidion)-1-piperidino]carbonylcamptothecin, Camptosar
25 UGT1A1 Dinucleotide Polymorphism Uridine diphosphate glucuronosyl- transferase 1A1 TATAA box UGT1A1 coding region GGTGTATCGATTGGTTTTTGCCATATATATATATATAAGTAGGAGAGGGCGAACC GGTGTATCGATTGGTTTTTGCCATATATATATATATATAAGTAGGAGAGGGCGAACC (TA) 6 TAA (TA) 7 TAA Normal UGT1A1*28, lower enzyme activity
26 Irinotecan Metabolism N N N CH 3 N H H 3 C CES H N CH 3 N H H 3 C UGT1A1 H H H H N CH 3 N H H 3 C Irinotecan SN-38 SN-38G UGT1A1 activity, risk for toxicity
27 Glioblastoma multiforme
28 MGMT Gene Promoter Methylation 6 -Methylguanine-DNA-methyltransferase repairs the 6- methylguanine caused by Temozolomide MGMT is strongly induced by TMZ and other alkylating agents MGMT expression is suppressed by CpG methylation within its own promoter
29
30 Methylation-Specific PCR (MSP) of the MGMT Promoter U M U M U M U M U M U M U M U M U M Patient Samples Control Samples U = Unmethylated MGMT-specific PCR M = Methylated MGMT-specific PCR
31 Personalized Medicine Includes Predicting Response to Targeted Therapies
32 Pharmacogenomics: Targeted Therapy Most targeted therapies are directed against genes or gene products found only in tumor cells acquired or somatic genetic variants
33 Targeted Therapy Tamoxifen Z N
34 HER History 1960s 1970s 1980s 1990s 2000s EGF identified verexpression of HER1/EGFR reported in cancer cells Monoclonals identified Small molecule TK inhibitors identified HER1/HER2 overexpression correlates with poor prognosis First HERtargeted MAb, trastuzumab (Herceptin ) approved for HER2+ MBC Gefitinib (Iressa ) approved as monotherapy for patients with locally advanced or metastatic NSCLC HER-targeted therapies being explored in wide range of human cancers
35 Transmembrane structure of HER2 monomer Extracellular domain (632 amino acids) Ligand-binding site Plasma membrane Cytoplasm Intracellular domain (580 amino acids) Tyrosine kinase activity
36 Increased HER2 production Normal Amplification/verexpression HER-2/neu receptor protein HER-2/neu mrna Cytoplasm Cytoplasmic membrane HER-2/neu DNA Nucleus
37 Targeted Therapy Anti-monoclonal Antibody and Anti-TKI Therapy Are Directed Lapatinib (Tykerb) Trastuzumab (Herceptin)
38 Detecting HER-2 Protein expression by IHC HER-2 Genes Gene amplification by FISH HER-2 Protein
39 KRAS & EGFR Testing: predicting response to targeted therapy in Colon and Lung Cancers
40 Prognostic vs Predictive Markers Prognostic marker- indicator of survival independent of therapy; indicator of tumor aggressiveness Predictive marker- indicator of response to therapy, such as PFS or S; (or in some cases prediction of severe toxicity)
41 EGFR and KRAS EGFR- epidermal growth factor receptor, ErbB1 Cell-surface receptor tyrosine kinase Activating mutations confer susceptibility to small molecule TKI s Resistance mutations also occur KRAS- Kirsten rat sarcoma virus (human homolog) GTP binding protein; signal transduction downstream of cell surface receptor Activating mutations (reduced GTPase activity) negate the requirement for upstream receptor activation
42 EGFR and Targeted Therapies, Panitumumab
43 EGFR EGFR activating mutations confer susceptibility to small molecule TKI s in NSCLC. Two common mutations account for >80% of EGFR mutant alleles. In frame del exon 19 and point mutation exon 21 (L858R) Receptor L-domain Furin-like domain Receptor L-domain Transmembrane region E18 Substitutions 6% Kinase domain E19 E20 In-frame deletions Duplications/insertions Substitutions 42% 6% E21 Substitutions (L858R) 46% Lassus H, et al. J Mol Med. 2006;84: Lacroix L, et al. Int J Cancer. 2006;118: Stadlmann S, et al. Mod Path. 2006;19: Schilder RJ, et al. Clin Cancer Res. 2005;11:
44
45
46 KRAS Activating Mutations Found in 30-50% of CRCa s Associated with smoking in NSCLC ccur most often in codons 12 and 13 Missense mutations (change of amino acid) 7 common mutations, account for at least 95% of all identified A few mutations in other locations have been reported ex: codon 61
47 KRAS Mutations Lievre et al., J Clin ncol 2008 (Jan);26:374 Cetuximab monoclonal Ab to EGFR KRAS mutations associated with resistance to Cetuximab Amado et al., J Clin ncol 2008 (Mar);26:1 Panitumamab monoclonal Ab to EGFR Response associated with wild type KRAS
48 KRAS mutation testing DNA extracted from archival FFPE tumor sample (typically primary tumor) riginal kit (DxS, European) used allele-specific PCR Detection limit: 1% mutation in wild-type background Detects 7 mutations in codons 12 and 13 Gly12Asp Gly12Cys Gly12Ala Gly12Arg Gly12Val Gly13Asp Gly12Ser
49 Allelic Discrimination for KRAS Mutations GLY12ARG, 34G>C GLY12ASP, 35G>A GLY12CYS, 34G>T GLY12ALA, 35G>C
50 KRAS Mutation Detected in FFPE Tumor Codon 12 Gly Codon 13 Gly G>A mutation (Gly12Asp)
51 Correlating Molecular Findings with Pathology Adenomatous polyp with villous architecture Pre-existing adenomatous polyp with villous architecture Invasive adenocarcinoma with ulceration Chen H. et al. Correlation of polypoid colorectal adenocarcinoma with pre-existing adenomatous polyps and KRAS mutation. Cancer Genet, Apr 204: , 2011
52 Correlating Molecular Findings with Pathology
53 Resected Specimen Diagnosis? Prognosis? Predictive and therapeutic?
54 A Changing Paradigm? Patient #1 Poorly differentiated Aggressive Pos for therapeutic targets Patient #2 Well-Moderately differentiated Less aggressive Neg for therapeutic targets
55 Conclusions Targeted therapies offer a better way to destroy cancer cells beyond the typical chemotherapy Knowledge of tumor cell biology will lead to more treatments against various pathway constituents ur field is changing rapidly and so will our roles
56 What if..
57 DHMC Molecular Pathology Laboratory and Translational Research Program Samantha Allen Claudine Bartels, Ph.D. Heather Bentley Betty Dokus Susan Gallagher Carol Hart Arnold Hawk Joel Lefferts, Ph.D. Rebecca Meara Elizabeth Reader Mary Schwab Laura Tafe, M.D. Brian Ward Brendan Wood Eric York
Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D.
Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D. Professor of Pathology Director, Molecular Pathology Dartmouth Medical School Dartmouth Hitchcock Medical Center
More informationCancer Pharmacogenomics
Cancer Pharmacogenomics Gregory J. Tsongalis, Ph.D. Director, Molecular Pathology Dartmouth Medical School Dartmouth Hitchcock Medical Center Norris Cotton Cancer Center Lebanon, NH Laboratory Analysis
More information7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview
Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon
More informationHER2 status assessment in breast cancer. Marc van de Vijver Academic Medical Centre (AMC), Amsterdam
HER2 status assessment in breast cancer Marc van de Vijver Academic Medical Centre (AMC), Amsterdam 13e Bossche Mamma Congres 17 th June 2015 Modern cancer therapies are based on sophisticated molecular
More informationCorporate Medical Policy
Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationEGFR: fundamenteel en klinisch
EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationMEDICAL POLICY. SUBJECT: GENOTYPING - RAS MUTATION ANALYSIS IN METASTATIC COLORECTAL CANCER (KRAS/NRAS) POLICY NUMBER: CATEGORY: Laboratory
MEDICAL POLICY Clinical criteria used to make utilization review decisions are based on credible scientific evidence published in peer reviewed medical literature generally recognized by the medical community.
More informationPersonalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationGENETIC TESTING FOR TARGETED THERAPY FOR NON-SMALL CELL LUNG CANCER (NSCLC)
CANCER (NSCLC) Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs are
More informationCase Study. Overview. Deleterious MLH1 mutation detected on sequencing 10/16/2014
The Role of Next Generation Sequencing for Hereditary Cancer Syndromes: A Focus on Endometrial Cancer Laura J. Tafe, MD Assistant Professor of Pathology Assistant Director, Molecular Pathology Dartmouth-Hitchcock
More informationK-Ras mutational status and response to EGFR inhibitors for treatment of advanced CRC. Monica Bertagnolli, MD. CRA Continuing Education, November 2008
K-Ras mutational status and response to EGFR inhibitors for treatment of advanced CRC Monica Bertagnolli, MD CRA Continuing Education, November 2008 The Ras Oncogene Kirsten and Harvey: 1964 Identification
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationDescription of Procedure or Service. Policy. Benefits Application
Corporate Medical Policy KRAS, NRAS, BRAF Mutation Analysis and Related File Name: Origination: Last CAP Review: Next CAP Review: Last Review: kras_nras_braf_mutation_analysis_and_related_treatment_in_metastatic_colorectal_cancer
More informationDr C K Kwan. Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK
HA Convention 2013 Dr C K Kwan MBChB, FRCR, FHKCR, FHKAM, MPM, CPI, MAppMgt(Hlth) Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK To personalize cancer
More informationPersonalized Genetics
Personalized Genetics Understanding Your Genetic Test Results Tracey Evans, MD September 29, 2017 Genetics 101 Punnett Square Genetic Pedigree 2 Genetics 101 Punnett Square Genetic Pedigree 3 It s not
More informationMETASTATIC COLORECTAL CANCER: TUMOR MUTATIONAL ANALYSIS AND ITS IMPACT ON CHEMOTHERAPY SUMA SATTI, MD
METASTATIC COLORECTAL CANCER: TUMOR MUTATIONAL ANALYSIS AND ITS IMPACT ON CHEMOTHERAPY SUMA SATTI, MD INTRODUCTION Second leading cause of cancer related death in the United States. 136,830 cases in 2014
More informationDisclosures Genomic testing in lung cancer
Disclosures Genomic testing in lung cancer No disclosures Objectives Understand how FISH and NGS provide complementary data for the evaluation of lung cancer Recognize the challenges of performing testing
More informationCurrent and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
More informationRelated Policies None
Medical Policy MP 2.04.53 BCBSA Ref. Policy: 2.04.53 Last Review: 07/25/2018 Effective Date: 07/25/2018 Section: Medicine Related Policies None DISCLAIMER Our medical policies are designed for informational
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationDETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER
665 J App Pharm 03(04): 655-669; October, 2012 Andreas et al., 2012 Short Communication DETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER E.Andreas 1,2,3, Ali Mujahid 1,3, Attia Youssef 1,
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationIs there a role for EGFR Tyrosine Kinase Inhibitors in recurrent glioblastoma?
Is there a role for EGFR Tyrosine Kinase Inhibitors in recurrent glioblastoma? Juan M Sepúlveda Sánchez Neurooncology Unit Hospital Universitario 12 de Octubre. Madrid Topics 1.-EGFR pathway as a potential
More informationKRAS: ONE ACTOR, MANY POTENTIAL ROLES IN DIAGNOSIS
UNIVERSITÀ DEGLI STUDI DI PALERMO Scuola di Specializzazione in Biochimica Clinica Direttore Prof. Marcello Ciaccio KRAS: ONE ACTOR, MANY POTENTIAL ROLES IN DIAGNOSIS Loredana Bruno KRAS gene Proto-oncogene
More informationDrug-targeted therapies and Predictive Prognosis: Changing Role for the Pathologist
Drug-targeted therapies and Predictive Prognosis: Changing Role for the Pathologist Moderator: S. Terence Dunn, Ph.D. Associate Professor, Pathology Director, Molecular Pathology Laboratory University
More informationnumber Done by Corrected by Doctor Maha Shomaf
number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationSavolitinib clinical trials June 2016 update
Savolitinib clinical trials June 2016 update List of abbreviations BID Twice Daily MET Aberation of c-met/hgf CRC Colorectal Cancer MTD Maximum Tolerated Dose DoR Duration of Response NSCLC Non-Small Cell
More informationCurrent Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors)
Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors) Kael Mikesell, DO McKay-Dee Hospital May 14, 2015 Outline Update to DNA Testing
More informationCorrelation of polypoid colorectal adenocarcinoma with pre-existing adenomatous polyps and KRAS mutation
Cancer Genetics 204 (2011) 245e251 Correlation of polypoid colorectal adenocarcinoma with pre-existing adenomatous polyps and KRAS mutation Hui Chen, Joel A. Lefferts, Mary C. Schwab, Arief A. Suriawinata,
More informationMolecular Oncology, oncology parameters see each test
Molecular Oncology, oncology parameters see each test DPD deficiency Dihydropyrimidine dehydrogenase deficiency (DPD deficiency) is an autosomal recessive metabolic disorder in which there is absent or
More information2015 EUROPEAN CANCER CONGRESS
2015 EUROPEAN CANCER CONGRESS 25-29 September 2015 Vienna, Austria SUMMARY The European Cancer Congress (ECC 2015) combined the 40th European Society for Medical Oncology (ESMO) congress with the 18th
More informationCorporate Medical Policy
Corporate Medical Policy Proteomic Testing for Targeted Therapy in Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteomic_testing_for_targeted_therapy_in_non_small_cell_lung_cancer
More informationSUBJECT: GENOTYPING - EPIDERMAL GROWTH
MEDICAL POLICY SUBJECT: GENOTYPING - EPIDERMAL GROWTH Clinical criteria used to make utilization review decisions are based on credible scientific evidence published in peer reviewed medical literature
More informationMolecular markers in colorectal cancer. Wolfram Jochum
Molecular markers in colorectal cancer Wolfram Jochum Biomarkers in cancer Patient characteristics Tumor tissue Normal cells Serum Body fluids Predisposition Diagnostic marker Specific diagnosis Prognostic
More informationUnderstanding and Optimizing Treatment of Triple Negative Breast Cancer
Understanding and Optimizing Treatment of Triple Negative Breast Cancer Edith Peterson Mitchell, MD, FACP Clinical Professor of Medicine and Medical Oncology Program Leader, Gastrointestinal Oncology Department
More informationKRAS, NRAS, and BRAF Variant Analysis in Metastatic Colorectal Cancer
KRAS, NRAS, and BRAF Variant Analysis in Metastatic Colorectal Cancer Policy Number: 2.04.53 Last Review: 5/2018 Origination: 1/2011 Next Review: 5/2019 Policy Blue Cross and Blue Shield of Kansas City
More informationIndividualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy
Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:
More informationName of Policy: Panitumumab, Vectibix
Name of Policy: Panitumumab, Vectibix Policy #: 369 Latest Review Date: June 2014 Category: Pharmacology Policy Grade: B Background/Definitions: As a general rule, benefits are payable under Blue Cross
More informationRefining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis
5/17/13 Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis Johannes Kratz, MD Post-doctoral Fellow, Thoracic Oncology Laboratory
More informationBiomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007
Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007 Bruce E. Johnson, MD Dana-Farber Cancer Institute, Brigham and Women s Hospital, and Harvard
More informationIs it possible to cure patients with liver metastases? Taghizadeh Ali MD Oncologist, MUMS
Is it possible to cure patients with liver metastases? Taghizadeh Ali MD Oncologist, MUMS Survival Rates of by Stage of Adenocarcinoma of the Colon Liver Resection New Perspective Colorectal cancer liver
More informationNew Developments in the Treatment of Colorectal Cancer. Jonathan Loree, MD, MS, FRCPC Department of Medical Oncology BC Cancer Vancouver Centre
New Developments in the Treatment of Colorectal Cancer Jonathan Loree, MD, MS, FRCPC Department of Medical Oncology BC Cancer Vancouver Centre Personalized Medicine Currently already part of oncology:
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More information위장관종양의표적치료를위한 면역조직화학적및분자병리학적 진단기법 이혜승 분당서울대학교병원병리과
위장관종양의표적치료를위한 면역조직화학적및분자병리학적 진단기법 이혜승 분당서울대학교병원병리과 Contents HER2 testing in gastric cancer - Clinicopathologic significance of HER2 - Practical approach of HER2 testing Resistance to anti-egfr therapy
More informationGenetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department
Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types
More informationMET skipping mutation, EGFR
New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM
More informationMolecular biomarker profile of EGFR copy number, KRAS and BRAF mutations in colorectal carcinoma
ORIGINAL ARTICLE Molecular biomarker profile of EGFR copy number, KRAS and BRAF mutations in colorectal carcinoma Rong Rong, Jamie Tull, Shengle Zhang Department of Pathology, SUNY Upstate University,
More informationComprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast.
Comprehensive Genomic Profiling, in record time Accurate. ly Proven. Fast. PCDx advantages Comprehensive genomic profiling, in record time PCDx Comprehensive Genomic Profiling (CGP) provides precise information
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
KRAS, NRAS, and BRAF Variant Analysis in Metastatic Colorectal Cancer Page 1 of 25 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Variant Analysis
More informationIntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
More informationMET as a novel treatment target- the story of the sleeping beauty. Balazs Halmos M.D. Montefiore Medical Center/Albert Einstein College of Medicine
MET as a novel treatment target- the story of the sleeping beauty Balazs Halmos M.D. Montefiore Medical Center/Albert Einstein College of Medicine MET as a novel treatment target MET as an oncogene MET
More informationMolecular Diagnostics Overview JAN A. NOWAK, PHD, MD PATHOLOGY AND LABORATORY MEDICINE MOLECULAR DIAGNOSTICS LABORATORY FEBRUARY 15, 2018
Molecular Diagnostics Overview JAN A. NOWAK, PHD, MD PATHOLOGY AND LABORATORY MEDICINE MOLECULAR DIAGNOSTICS LABORATORY FEBRUARY 15, 2018 Some Key Points Molecular Testing has applications in every section
More informationTissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~
16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of
More informationMolecular Testing Updates. Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine
Molecular Testing Updates Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine Keeping Up with Predictive Molecular Testing in Oncology: Technical
More informationStrandAdvantage Tissue-Specific Cancer Genomic Tests. Empowering Crucial First-Line Therapy Decisions for Your Patient
StrandAdvantage Tissue-Specific Cancer Genomic Tests Empowering Crucial First-Line Therapy Decisions for Your Patient Harness the power of precision medicine with StrandAdvantage Precision medicine in
More informationCorporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
More informationKRAS mutation profile differences between rectosigmoid localized adenocarcinomas and colon adenocarcinomas
Original Article KRAS mutation profile differences between rectosigmoid localized adenocarcinomas and colon adenocarcinomas Yasemin Baskin 1,2, Yusuf Kagan Dagdeviren 1, Gizem Calibasi 1, Aras Emre Canda
More informationBig data vs. the individual liver from a regulatory perspective
Big data vs. the individual liver from a regulatory perspective Robert Schuck, Pharm.D., Ph.D. Genomics and Targeted Therapy Office of Clinical Pharmacology Center for Drug Evaluation and Research Food
More informationOHTAC Recommendation. KRAS Testing for Anti-EGFR Therapy in Advanced Colorectal Cancer
OHTAC Recommendation KRAS Testing for Anti-EGFR Therapy in Advanced Colorectal Cancer Presented to the Ontario Health Technology Advisory Committee in August, 2010 December 2010 Issue Background In February
More informationSupplementary Online Content
Supplementary Online Content Kris MG, Johnson BE, Berry LD, et al. Using Multiplexed Assays of Oncogenic Drivers in Lung Cancers to Select Targeted Drugs. JAMA. doi:10.1001/jama.2014.3741 etable 1. Trials
More informationPanitumumab: The KRAS Story. Chrissie Fletcher, MSc. BSc. CStat. CSci. Director Biostatistics, Amgen Ltd
Panitumumab: The KRAS Story Chrissie Fletcher, MSc. BSc. CStat. CSci. Director Biostatistics, Amgen Ltd Clinical Background: panitumumab in mcrc Panitumumab is a fully human IgG2 monoclonal antibody directed
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationPolicy Specific Section: Medical Necessity and Investigational / Experimental. October 14, 1998 March 28, 2014
Medical Policy Genetic Testing for Colorectal Cancer Type: Medical Necessity and Investigational / Experimental Policy Specific Section: Laboratory/Pathology Original Policy Date: Effective Date: October
More informationCLINICAL MEDICAL POLICY
Policy Name: Policy Number: Responsible Department(s): CLINICAL MEDICAL POLICY Molecular Tumor Markers for Non-Small Cell Lung Cancer (NSCLC) MP-061-MD-DE Medical Management Provider Notice Date: 10/15/2018;
More informationDevelopments in Laboratory Genetics
Developments in Laboratory Genetics Rachel Butler rachel.butler@wales.nhs.uk The Impact of Genomics on Public Health Where are we now? Single gene disorders Core disorders Newborn screening (CF, MCAD)
More informationPage: 1 of 27. Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer
Last Review Status/Date: December 2014 Page: 1 of 27 Non-Small-Cell Lung Cancer Description Over half of patients with non-small-cell lung cancer (NSCLC) present with advanced and therefore incurable disease,
More informationPrognostic and predictive biomarkers for epidermal growth factor receptor-targeted therapy in colorectal cancer: Beyond KRAS mutations
Critical Reviews in Oncology/Hematology 85 (2013) 45 81 Prognostic and predictive biomarkers for epidermal growth factor receptor-targeted therapy in colorectal cancer: Beyond KRAS mutations Ana Custodio,
More informationColon Cancer and Hereditary Cancer Syndromes
Colon Cancer and Hereditary Cancer Syndromes Gisela Keller Institute of Pathology Technische Universität München gisela.keller@lrz.tum.de Colon Cancer and Hereditary Cancer Syndromes epidemiology models
More informationProgress towards an individualized approach to therapy: colorectal cancer
Progress towards an individualized approach to therapy: colorectal cancer Alan P. Venook, M.D. University of California, SF GIST: PET change after 4 weeks imatinib Multiple liver and upper abdominal 18
More informationMolecular biology of colorectal cancer
Molecular biology of colorectal cancer Phil Quirke Yorkshire Cancer Research Centenary Professor of Pathology University of Leeds, UK Rapid pace of molecular change Sequencing changes 2012 1,000 genomes
More informationBreast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment?
Breast Cancer Breast Cancer Excess Estrogen Exposure Nulliparity or late pregnancy + Early menarche + Late menopause + Cystic ovarian disease + External estrogens exposure + Breast Cancer Excess Estrogen
More informationTargeting the ERBB family in cancer: couples therapy
OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis
More informationPatient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017
Patient Leader Education Summit Precision Medicine: Today and Tomorrow March 31, 2017 Precision Medicine: Presentation Outline Agenda What is a Precision Medicine What is its clinical value Overview of
More informationLung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17
Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic
More informationIntegration of Genomics Into Clinical Pathways. Precision Medicine and Decision Support
Integration of Genomics Into Clinical Pathways Precision Medicine and Decision Support Faculty Andrew Hertler, MD, FACP Chief Medical Officer New Century Health Andrew Hertler, MD, FACP is employed by
More informationDr. Pravin D. Potdar. M.Sc, Ph.D, D.M.L.T.,DHE, DMS
Molecular Profiling of Cancer Cells Strategies for Developing Biomarkers for Targeted Therapies of Cancer Dr. Pravin D. Potdar. M.Sc, Ph.D, D.M.L.T.,DHE, DMS Head, Department of Molecular Medicine and
More informationLUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia
LUNG CANCER pathology & molecular biology Izidor Kern University Clinic Golnik, Slovenia 1 Pathology and epidemiology Small biopsy & cytology SCLC 14% NSCC NOS 4% 70% 60% 50% 63% 62% 61% 62% 59% 54% 51%
More informationClinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317
Clinical Policy: (Erbitux) Reference Number: PA.CP.PHAR.317 Effective Date: 01/18 Last Review Date: 11/17 Coding Implications Revision Log Description The intent of the criteria is to ensure that patients
More informationKRAS MUTATION ANALYSIS IN METASTATIC COLORECTAL CANCER
KRAS MUTATION ANALYSIS IN METASTATIC COLORECTAL CANCER Protocol: GEN004 Effective Date: September 1, 2017 Table of Contents Page COMMERCIAL AND MEDICAID COVERAGE RATIONALE... 1 MEDICARE COVERAGE RATIONALE...
More informationMolecular Diagnosis for Colorectal Cancer Patients
Molecular Diagnosis for Colorectal Cancer Patients Antonia R. Sepulveda MD, PhD, FCAP October, 20, 2010 www.cap.org Welcome to the PHC Webinar Series This talk on The Molecular Diagnosis for Colorectal
More informationRole of the pathologist in the diagnosis and mutational analysis of lung cancer Professor J R Gosney
Role of the pathologist in the diagnosis and mutational analysis of lung cancer Professor J R Gosney Consultant Thoracic Pathologist Royal Liverpool University Hospital Disclosure JRG is a paid advisor
More informationCell, Volume 141. Supplemental Information Cell Signaling by Receptor Tyrosine Kinases Mark A. Lemmon and Joseph Schlessinger
Cell, Volume 141 Supplemental Information Cell Signaling by Receptor Tyrosine Kinases Mark A. Lemmon and Joseph Schlessinger Figure S1. RTK Mutations in Diseases Locations of gain-of-function (green arrows)
More informationAntibody-Drug Conjugates in Glioblastoma Multiforme: Finding Ways Forward
Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including
More informationEXAMPLE. ratio (%) Contraindication for treatment with panitumumab or cetuximab
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999 Requested 17 May
More informationpatients in the era of
Communicating with cancer patients in the era of personalized medicine September 9 th, 2017 Gerald Prager, M.D. Comprehensive Cancer Center Vienna Medical University of Vienna, Austria Gerald Prager, M.D.
More informationPharmacogenomics Part 2 PGx of Cancer
Clinical and Genetic Epidemiology Winter School 15.02.2017 Pharmacogenomics Part 2 PGx of Cancer Ingolf Cascorbi, MD, PhD University Hospital Schleswig-Holstein, Campus Kiel Institute of Experimental and
More informationUtilization of Cell-Transfer Technique for Molecular Testing on Hematoxylin-Eosin Stained Sections
Utilization of Cell-Transfer Technique for Molecular Testing on Hematoxylin-Eosin Stained Sections A Viable Option for Small Biopsies That Lack Tumor Tissues in Paraffin Block Howard H. Wu, MD; Stephen
More informationEpidermal Growth Factor Receptor Mutations in Colorectal Cancer Patients
Original Article Journal of the Korean Society of J Korean Soc Coloproctol 2011;27(3):127-132 DOI: 10.3393/jksc.2011.27.3.127 pissn 2093-7822 eissn 2093-7830 Epidermal Growth Factor Receptor Mutations
More informationClinical Biomarker in Kidney Cancer. Maria Nirvana Formiga, M.D., Ph.D.
Clinical Biomarker in Kidney Cancer Maria Nirvana Formiga, M.D., Ph.D. Disclosures I am on the Speaker s Bureau with Pfizer and Bayer Clinical trials of BMS and Pfizer Kidney Cancer 70% new cases in developed
More informationDiagnostic Value of KRAS Mutation in Non-small Cell Lung Carcinoma
University of Rhode Island DigitalCommons@URI Senior Honors Projects Honors Program at the University of Rhode Island 2018 Diagnostic Value of KRAS Mutation in Non-small Cell Lung Carcinoma Julianna Mastroianni
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationAn Update on EGFR Inhibitors. Disclosure. Objectives 4/1/2011. Leigh M. Boehmer, Pharm.D., has no real or apparent conflicts of interest to report
An Update on EGFR Inhibitors Leigh M. Boehmer, Pharm.D., BCOP Clinical Pharmacist, Medical Oncology Barnes Jewish Hospital Saint Louis, Missouri Disclosure Leigh M. Boehmer, Pharm.D., has no real or apparent
More informationCANCER. Clinical Validation of Breast Cancer Predictive Markers
Clinical Validation of Breast Cancer Predictive Markers David Hicks, MD Loralee McMahon, MS, HTL(ASCP) CANCER The human body is composed of billions of highly regulated cells Cancer cells no longer respond
More informationNon Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק
Non Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק 26.06.09 Lecture outlines WHO histological classification Macro/Micro assessment Early diagnosis Minimal pathology Main subtypes SCC, AdCa, LCLC
More information