Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D.

Transcription

1 Molecular Diagnostics and Targeted Therapies in Solid Tumors Gregory J. Tsongalis, Ph.D. Professor of Pathology Director, Molecular Pathology Dartmouth Medical School Dartmouth Hitchcock Medical Center Norris Cotton Cancer Center Lebanon, NH

2 CANADA DHMC, Lebanon, NH * * California Boston, MA Texas Florida

3

4

5

6

7 Current Patient Management Is Based on Diagnosis 1.4M New Cancers (US) H&E for Morphology Further Diagnostic Work-up Imaging (CT, MRI, PET) Immuno (IHC), molecular, Proteomic Therapeutic management

8 Hallmarks of Human Cancer Self-sufficiency in growth signals Evading apoptosis Insensitivity to antigrowth signals Sustained angiogenesis Tissue invasion and metastasis Limitless replicative potential

9 Gene Mutations Cause Cancer = New Biomarkers Single gene = Single mutation = Cancer

10 Nothing Else Looks Like This!

11 Susan G. Komen Race for the Cure - Indianapolis

12 Traditional Processing of Tissues

13 Traditional Technologies for Pathology Workup ImmunoHistoChemistry (IHC) Fluorescence in situ Hybridization (FISH) Inexpensive Subjective scoring Semi-quantitative Protein target may be affected by tissue processing Fluorescent labeled DNA probes hybridize to target Hybridized DNA probes fluoresce, giving off brightly lit signals that are easily viewed and analyzed

14 Current Clinical Mutation Analysis Data KRAS Gly13Asp BRAF V600E EGFR Exon 21 Electropherogram

15 Signal Vic (fluorescence) Evolving Molecular Technologies Cycle neg. control SNP Genotyping Assay Fam (fluorescence) Real Time PCR: 1. All specimen types 2. Increased sensitivity and specificity 3. Quantification possible 4. TAT = 2-3 hours

16 qbiomarker Somatic Mutation PCR Array: Human EGFR Pathway qbiomarker Somatic Mutation PCR Array Data Symbol CSMIC ID nt change AA change Known EGFR Known KRAS Known BRAF Mutation Mutation Mutation BRAF 476 c.1799t>a p.v600e EGFR c.2572c>a p.l858m KRAS 532 c.38g>a p.g13d - + -

17 Genomic Approaches to Clinical ncology Tumor classification Prognostic markers Predictive indicators of drug response New therapeutics Monitoring disease Susceptibility to cancer

18 Cystic Fibrosis Single gene disorder (CFTR ) 27 exons, 23 kb F508 >1,800 mutations Clinical heterogeneity Screening program 2001 Treatment of symptoms VX-770 small molecule drug G551D specific (4%) VX F508 specific (90%)

19 Therapies in Human Cancer Challenges: Limited efficacy Emergence of resistance Unexpected toxicities

20 Personalized Medicine

21 Personalized Medicine Current Practice Personalized Medicine ne size fits all Trial and Error Trial and error The right treatment for the right person at the right time

22 Personalized for the Individual Patient ptimal drug response Reduced adverse effects Systemic response

23 Irinotecan Toxicity CAMPTSAR (irinotecan) first line therapy in metastatic colorectal cancer 20-35% of patients experience ADRs

24 Irinotecan Metabolism N N N CH 3 N H H 3 C CES H N CH 3 N H H 3 C UGT1A1 H H H H N CH 3 N H H 3 C Irinotecan SN-38 SN-38G CPT-11, 7-ethyl-10[4-(1-(piperidion)-1-piperidino]carbonylcamptothecin, Camptosar

25 UGT1A1 Dinucleotide Polymorphism Uridine diphosphate glucuronosyl- transferase 1A1 TATAA box UGT1A1 coding region GGTGTATCGATTGGTTTTTGCCATATATATATATATAAGTAGGAGAGGGCGAACC GGTGTATCGATTGGTTTTTGCCATATATATATATATATAAGTAGGAGAGGGCGAACC (TA) 6 TAA (TA) 7 TAA Normal UGT1A1*28, lower enzyme activity

26 Irinotecan Metabolism N N N CH 3 N H H 3 C CES H N CH 3 N H H 3 C UGT1A1 H H H H N CH 3 N H H 3 C Irinotecan SN-38 SN-38G UGT1A1 activity, risk for toxicity

27 Glioblastoma multiforme

28 MGMT Gene Promoter Methylation 6 -Methylguanine-DNA-methyltransferase repairs the 6- methylguanine caused by Temozolomide MGMT is strongly induced by TMZ and other alkylating agents MGMT expression is suppressed by CpG methylation within its own promoter

29

30 Methylation-Specific PCR (MSP) of the MGMT Promoter U M U M U M U M U M U M U M U M U M Patient Samples Control Samples U = Unmethylated MGMT-specific PCR M = Methylated MGMT-specific PCR

31 Personalized Medicine Includes Predicting Response to Targeted Therapies

32 Pharmacogenomics: Targeted Therapy Most targeted therapies are directed against genes or gene products found only in tumor cells acquired or somatic genetic variants

33 Targeted Therapy Tamoxifen Z N

34 HER History 1960s 1970s 1980s 1990s 2000s EGF identified verexpression of HER1/EGFR reported in cancer cells Monoclonals identified Small molecule TK inhibitors identified HER1/HER2 overexpression correlates with poor prognosis First HERtargeted MAb, trastuzumab (Herceptin ) approved for HER2+ MBC Gefitinib (Iressa ) approved as monotherapy for patients with locally advanced or metastatic NSCLC HER-targeted therapies being explored in wide range of human cancers

35 Transmembrane structure of HER2 monomer Extracellular domain (632 amino acids) Ligand-binding site Plasma membrane Cytoplasm Intracellular domain (580 amino acids) Tyrosine kinase activity

36 Increased HER2 production Normal Amplification/verexpression HER-2/neu receptor protein HER-2/neu mrna Cytoplasm Cytoplasmic membrane HER-2/neu DNA Nucleus

37 Targeted Therapy Anti-monoclonal Antibody and Anti-TKI Therapy Are Directed Lapatinib (Tykerb) Trastuzumab (Herceptin)

38 Detecting HER-2 Protein expression by IHC HER-2 Genes Gene amplification by FISH HER-2 Protein

39 KRAS & EGFR Testing: predicting response to targeted therapy in Colon and Lung Cancers

40 Prognostic vs Predictive Markers Prognostic marker- indicator of survival independent of therapy; indicator of tumor aggressiveness Predictive marker- indicator of response to therapy, such as PFS or S; (or in some cases prediction of severe toxicity)

41 EGFR and KRAS EGFR- epidermal growth factor receptor, ErbB1 Cell-surface receptor tyrosine kinase Activating mutations confer susceptibility to small molecule TKI s Resistance mutations also occur KRAS- Kirsten rat sarcoma virus (human homolog) GTP binding protein; signal transduction downstream of cell surface receptor Activating mutations (reduced GTPase activity) negate the requirement for upstream receptor activation

42 EGFR and Targeted Therapies, Panitumumab

43 EGFR EGFR activating mutations confer susceptibility to small molecule TKI s in NSCLC. Two common mutations account for >80% of EGFR mutant alleles. In frame del exon 19 and point mutation exon 21 (L858R) Receptor L-domain Furin-like domain Receptor L-domain Transmembrane region E18 Substitutions 6% Kinase domain E19 E20 In-frame deletions Duplications/insertions Substitutions 42% 6% E21 Substitutions (L858R) 46% Lassus H, et al. J Mol Med. 2006;84: Lacroix L, et al. Int J Cancer. 2006;118: Stadlmann S, et al. Mod Path. 2006;19: Schilder RJ, et al. Clin Cancer Res. 2005;11:

44

45

46 KRAS Activating Mutations Found in 30-50% of CRCa s Associated with smoking in NSCLC ccur most often in codons 12 and 13 Missense mutations (change of amino acid) 7 common mutations, account for at least 95% of all identified A few mutations in other locations have been reported ex: codon 61

47 KRAS Mutations Lievre et al., J Clin ncol 2008 (Jan);26:374 Cetuximab monoclonal Ab to EGFR KRAS mutations associated with resistance to Cetuximab Amado et al., J Clin ncol 2008 (Mar);26:1 Panitumamab monoclonal Ab to EGFR Response associated with wild type KRAS

48 KRAS mutation testing DNA extracted from archival FFPE tumor sample (typically primary tumor) riginal kit (DxS, European) used allele-specific PCR Detection limit: 1% mutation in wild-type background Detects 7 mutations in codons 12 and 13 Gly12Asp Gly12Cys Gly12Ala Gly12Arg Gly12Val Gly13Asp Gly12Ser

49 Allelic Discrimination for KRAS Mutations GLY12ARG, 34G>C GLY12ASP, 35G>A GLY12CYS, 34G>T GLY12ALA, 35G>C

50 KRAS Mutation Detected in FFPE Tumor Codon 12 Gly Codon 13 Gly G>A mutation (Gly12Asp)

51 Correlating Molecular Findings with Pathology Adenomatous polyp with villous architecture Pre-existing adenomatous polyp with villous architecture Invasive adenocarcinoma with ulceration Chen H. et al. Correlation of polypoid colorectal adenocarcinoma with pre-existing adenomatous polyps and KRAS mutation. Cancer Genet, Apr 204: , 2011

52 Correlating Molecular Findings with Pathology

53 Resected Specimen Diagnosis? Prognosis? Predictive and therapeutic?

54 A Changing Paradigm? Patient #1 Poorly differentiated Aggressive Pos for therapeutic targets Patient #2 Well-Moderately differentiated Less aggressive Neg for therapeutic targets

55 Conclusions Targeted therapies offer a better way to destroy cancer cells beyond the typical chemotherapy Knowledge of tumor cell biology will lead to more treatments against various pathway constituents ur field is changing rapidly and so will our roles

56 What if..

57 DHMC Molecular Pathology Laboratory and Translational Research Program Samantha Allen Claudine Bartels, Ph.D. Heather Bentley Betty Dokus Susan Gallagher Carol Hart Arnold Hawk Joel Lefferts, Ph.D. Rebecca Meara Elizabeth Reader Mary Schwab Laura Tafe, M.D. Brian Ward Brendan Wood Eric York