A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:
|
|
- Noah Davis
- 6 years ago
- Views:
Transcription
1 A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently registered with the TGA
2 Background The rearrangement of chromosome 9 and 22 leads to the Philadelphia Chromosome formation, characterized by the BCR-ABL translocation ABL BCR Chromosome 22 BCR ABL Depending on chromosomal breakpoint locations, different isoforms of BCR and ABL genes fusion are possible; the most common are: p210 (Mbcr) b2a2, b3a2 p190 (mbcr) e1a2 BCR-ABL translocation is responsible for neoplastic transformation: Chromosome 9 Chromosome Philadelphia 95% Chronic Myeloid Leukemia 30% Acute Lymphoblastic Leukemia
3 Diagnostic work-up of Philadelphia Positive Leukemias Blood withdrawal: complete cell count = hematologic disorder Morphologic analysis on peripheral blood/bone marrow = diagnosis of Acute Lymphoblastic Leukemia = Suspiction of Chronic Myeloid Leukemia Conventional Reverse Transcription- PCR Genetic testing Molecular qualitative, karyotype, FISH Immunophenotyping, flow-cytometry = diagnosis of subtype of Leukemia = risk stratification = Van Dongen et al, Leukemia 1999 TREATMENT Molecular quantitative genetic testing
4 Limitations of conventional RT-PCR
5 Limitations of conventional RT-PCR Total RNA Reverse Transcription Amplification by PCR Gel electrophoresis 3 hours TIME CONSUMING MULTISTEP LACK OF INTERNAL CONTROL LABORIOUS SUBJECTIVE INTERPRETATION In-House/Homebrew
6 Faster Results Enhanced patient management CLINICAL & Scientific NEEDS Improved Reliability Easy adoption Easy set-up
7 Q-LAMP : Multi-plex and Real Time Isothermal Amplification Techniques due to their intrinsic characteristics can overcome the limitations of conventional PCR NON-PCR method Notomi T et al, NAR 2000 further improved by DiaSorin Q-LAMP
8 What is LAMP? LAMP is Loop-Mediated Isothermal Amplification 1. Loop-mediated Refers to the loop structures formed when the LAMP primers bind to target DNA sequence 2. Isothermal Reaction takes place at a single temperature (usually o C) - relatively simple instrumentation 3. Amplification Target is amplified using a combination of intricate primer design and a polymerase enzyme with strand displacement activity The Diagnostic Specialist
9 How DiaSorin Q-LAMP is achieved Amplification monitoring (real-time) in Q-LAMP achieved Q-Primers. Fluorescent molecule conjugated to one end of the Q-Primer LED in the LIAISON Iam instrument excites it Unique property of fluorescence molecule - quenched when incorporated into amplicon: TTATTAGAGGTTCAGACAATAGGTTAGGAA CTCCAAGTCTGTTATCCAATC Quenched DYE 1. Maximum fluorescence when primer is unbound 2. Fluorescence quenched when primer binds target The Diagnostic Specialist
10 Tt (min) Basic Principles Q-LAMP quantitation Decrease in fluorescence over time (quenching) used to monitor progress of reaction. Time taken to reach X% decrease in signal is called the Threshold Time (Tt) X% Quenching Sample Tt y = -1.7x R² = Log copies/ml Threshold Time RESULT The Diagnostic Specialist
11 Q-LAMP vs RT-PCR Steps Enzymes PCR Temperature Enzymes Q-LAMP Temperature Reverse Transcription 1 step, 1 enzyme, 1 temperature, Reverse close tube Transcriptase format 70 C 42 C 99 C Amplification DNA Thermostable Polymerase 4 C 94 C, 30 sec (Denaturation) 65 C, 60 sec (Annealing) 72 C, 60 sec (Polymerization) LAMP Polymerase 35x 65 C
12 Simple Procedure Buffer Freezedried reagents Reconstitution of lyophilized reagents Aliquote in tube strip Addition of controls and samples RNA Loading on Liaison Iam
13 Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription DNA Amplification Internal Control Real Time Rapid
14 Q-LAMP for BCR/ABL Translocation: Triplex Multiplex BCRABL p190/p210/gusb p190 p210 GUSb To validate negative results by excluding: incorrect extraction procedure low quality of extracted RNA presence of inhibitors incorrect reaction conditions
15 Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA cdna Amplification + Reverse Transcription signal detection Internal Control Real Time
16 Q-LAMP vs RT- PCR Temp ( C) PCR Amplification X 35 cycles Time 1 step, 1 enzyme, 1 temperature, close tube format Multiplex Temp ( C) Internal Control Real Time Q-LAMP Constant Amplification Time Rapid
17 Rapid solution constant temperature avoiding thermocycling Employment of a unique enzyme for RT and amplification High efficiency (characteristic of LAMP) 60 min 20 min 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription cdna Amplification + signal detection Internal Control Real Time Rapid
18 Instrumentation Liaison IAM incubation constant T real time reading of fluorescence (3 channels) automatic elaboration of data Compact Design 8 wells
19 Q-LAMP BCR-ABL performance: Verification SPECIFICITY Specificity established on negative RNA and NTC (water): Negative cell lines Replicates HL KASUMI 23 NB4 24 TOT replicates 390 BCR-ABL Results Negative* *validated through amplification of Gusb endogeneous control 100% specificity No Target Control Replicates BCR-ABL Results water 312 No amplification* *absence of primers dimers
20 Q-LAMP BCR-ABL performances SENSITIVITY 10-2 mut into wt dilution is the minimum amount of mutation found at the disease onset Sensitivity established on serial dilutions of mutated RNA into wild type RNA: Dilution tested (K562 RNA into HL60 RNA) BCR-ABL p210 % Detection #Reps % % 78 Dilution tested (TOM1 RNA into HL60 RNA) BCR-ABL p190 % Detection #Reps % % 78 Sensitivity required for diagnosis
21 RESULTS RT-PCR Q-LAMP BCR-ABL performances COMPARISON with RT-PCR on CLINCAL SAMPLES 85 samples RESULTS Q-LAMP BCR-ABL BCR-ABL p190 BCR-ABL p210 Negative TOT Average detection time for positive samples: 20 min BCR-ABL p BCR-ABL p Negative TOT % concordance
22 Faster Results Real time monitoring: 20 min for detection of +ve 60 min reaction time fo r Neg Control Better utilization of resources Validated, QA etc Timely administration of correct therapy Early identification of appropriate monitoring method Enhanced patient management MET CLINICAL NEEDS Improved Reliability Close tube/single step format Internal control Less risks of procedural errors Automatic elaboration of data Small Analyser Easy adoption Easy set-up Lyophilized reagents, Simple single-step procedure Less risks of procedural errors
23 Thank you!!! Giulia Amicarelli: Molecular Scientific Affairs Manager Paul Eros: Vice President Molecular Marketing AIMS Organising Committee
ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA
ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA 1Rosline H, 1Majdan R, 1Wan Zaidah A, 1Rapiaah M, 1Selamah G, 2A A Baba, 3D M Donald 1Department of Haematology, 2Department
More informationMolecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML
Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More informationLeukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ
More informationipsogen BCR-ABL1 Mbcr Kit Handbook
March 2015 ipsogen BCR-ABL1 Mbcr Kit Handbook 52 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM 7000, 7700, or 7900HT SDS, Applied Biosystems 7500 Real-Time PCR System,
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationApplication. Application of molecular biology methods in hematology and oncology. Oncogenes are involved in:
Application Application of molecular biology methods in hematology and oncology Research on the etiology of cancer Diagnostics / Differential diagnostics Stratifying for treatment Prognosing the outcome
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationChronic myeloid leukemia (CML)
Bioscientia Int. Support Services Dept. Konrad-Adenauer-Strasse 17 55218 Ingelheim Germany Phone 49(0)6132-781-203 49(0)6132-781-224 49(0)6132-781-165 Fax 49(0)6132-781-236 int.support@bioscientia.com
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationipsogen BCR-ABL1 Mbcr Kit Handbook
March 2015 ipsogen BCR-ABL1 Mbcr Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM, LightCycler, and SmartCycler instruments 670123 QIAGEN GmbH, QIAGEN Strasse
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More informationTHE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA. Ava Greco
THE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA Ava Greco REVIEW OF LITERATURE What is Leukemia? Abnormal growth of cells in the blood stream Progresses rapidly
More informationMRD in CML (BCR-ABL1)
MRD in CML (BCR-ABL1) Moleculaire Biologie en Cytometrie cursus Barbara Denys LAbo Hematologie UZ Gent 6 mei 2011 2008 Universitair Ziekenhuis Gent 1 Myeloproliferative Neoplasms o WHO classification 2008:
More informationipsogen BCR-ABL1 mbcr Kit Handbook
March 2015 ipsogen BCR-ABL1 mbcr Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM, LightCycler, and SmartCycler instruments 670023 QIAGEN GmbH, QIAGEN Strasse
More informationMonitor TM assay: comparison with traditional RT-qPCR methods
Preliminary evaluation of the GeneXpert Dx System for CML patients monitoring through the Xpert BCR-ABL Monitor TM assay: comparison with traditional RT-qPCR methods Silvia Calatroni Division of Hematology
More informationMP BCR-ABL1 Testing in Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia
Medical Policy BCBSA Ref. Policy: 2.04.85 Last Review: 10/18/2018 Effective Date: 10/18/2018 Section: Medicine Related Policies 8.01.30 Hematopoietic Cell Transplantation for Chronic Myelogenous Leukemia
More informationOctober Courier Service on Holidays There will be no courier service Thursday, Dec. 24th, 2011.
University of Washington October 2011 TEST CHANGE ACTH Aldosterone BCR/ABL by PCR, Qualitative Chlamydia trachomatis & N.gonorrhoeae, Amp. NA Creutzfeldt-Jakob, CSF Desipramine Doxepine and Nordoxepine,
More informationIdentification of Novel Variant of EML4-ALK Fusion Gene in NSCLC: Potential Benefits of the RT-PCR Method
International journal of Biomedical science ORIGINAL ARTICLE Identification of Novel Variant of EML4-ALK Fusion Gene in NSCLC: Potential Benefits of the RT-PCR Method Martin K. H. Maus 1, 2, Craig Stephens
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationipsogen BCR-ABL1 Mbcr IS-MMR Kit Handbook
July 2016 ipsogen BCR-ABL1 Mbcr IS-MMR Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, Applied Biosystems, ABI PRISM, and LightCycler instruments 670723 QIAGEN GmbH,
More informationAIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
More informationRealLine HBV / HCV / HIV Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE AND DIFFERENTIAL DETECTION OF HEPATITIS B VIRUS DNA, HEPATITIS C VIRUS RNA, AND HUMAN IMMUNODEFICIENCY VIRUS TYPES 1 AND 2 RNA USING THE PCR/RT-PCR METHOD
More informationTemplate for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)
Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is
More informationR&D AND INNOVATION. Francesco Colotta Senior Corporate VP and Chief Medical Officer
R&D AND INNOVATION Francesco Colotta Senior Corporate VP and Chief Medical Officer IN VITRO DIAGNOSTICS: BASICS DETECTION IN BIOLOGICAL FLUIDS... E.G. BLOOD, URINE, CSF, IN VITRO DIAGNOSTICS...OF A MOLECULE......
More informationHuman influenza A virus subtype (H1)
PCRmax Ltd TM qpcr test Human influenza A virus subtype (H1) Haemoglutinin H1 gene 150 tests For general laboratory and research use only 1 Introduction to Human influenza A virus subtype (H1) Influenza,
More informationCorrespondence should be addressed to Hooman H. Rashidi;
Case Reports in Hematology Volume 2015, Article ID 458052, 6 pages http://dx.doi.org/10.1155/2015/458052 Case Report Optimal Molecular Methods in Detecting p190 BCR-ABL Fusion Variants in Hematologic Malignancies:
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationNon-competitive Internal Control Concept for PCR-based Qualitative Assays
Christian O. Simon Roche Molecular Diagnostics Rotkreuz, CH Non-competitive Internal Control Concept for PCR-based Qualitative Assays 23 rd SoGAT Meeting, 16 th 17 th April, 2012, Vilnius, Lithuania Design
More informationRetro-X qrt-pcr Titration Kit User Manual
Takara Bio USA Retro-X qrt-pcr Titration Kit User Manual Cat. No. 631453 PT3952-1 (030218) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United States/Canada
More informationHuman Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationHematopathology Case Study
Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An
More informationRotavirus A. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO
More informationSWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL LEUKEMIA FORMS CHAPTER 16A REVISED: DECEMBER 2017
LEUKEMIA FORMS The guidelines and figures below are specific to Leukemia studies. The information in this manual does NOT represent a complete set of required forms for any leukemia study. Please refer
More informationHuman Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationMolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.
Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com
More informationPG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
More informationMyelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data
Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationUpdate on LAMP Project. OFFLU Technical Meeting, 4-5 April 2012 Royal Holloway, UK Sasan Fereidouni, Anja Globig
Update on LAMP Project OFFLU Technical Meeting, 4-5 April 2012 Royal Holloway, UK Sasan Fereidouni, Anja Globig Early and Rapid Diagnosis of Influenza Need for (rapid) tests with the following properties:
More informationREALQUALITY RS-BCR-ABL
User manual REALQUALITY RS-BCR-ABL p190 without RT reagents code RQ-S55A Kit for identification and quantification of the t(9;22)(q34;q11) translocation p190 variant In accordance with the European Against
More informationCytogendies, in situ Hybridization and Molecular Approaches in the Diagnosis of Cancer*
ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 28, No. 6 Copyright 1998, Institute for Clinical Science, Inc. Cytogendies, in situ Hybridization and Molecular Approaches in the Diagnosis of Cancer* ARMAND
More informationRT-PCR ANALYSIS OF E2A-PBX1, TEL-AML1, BCR-ABL AND MLL- AF4 FUSION GENE TRANSCRIPTS IN B-LINEAGE ACUTE LYMPHOBLASTIC LEUKEMIA
Analele Ştiinţifice ale Universităţii Alexandru Ioan Cuza, Secţiunea Genetică şi Biologie Moleculară, TOM XIV, 2013 RT-PCR ANALYSIS OF E2A-PBX1, TEL-AML1, BCR-ABL AND MLL- AF4 FUSION GENE TRANSCRIPTS IN
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationRealLine Mycoplasma genitalium Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1
More informationHuman Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.
PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded
More informationncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
More informationDetection of Tamiflu resistant Swine H1N1 Influenza Human Pandemic Strain
PrimerDesign TM Ltd Detection of Tamiflu resistant Swine H1N1 Influenza Human Pandemic Strain H275Y mutation For general laboratory and research use only Contents Introduction to Swine H1N1 Influenza Human
More informationWhen to change therapy? Andreas Hochhaus Universitätsklinikum Jena, Germany
When to change therapy? Andreas Hochhaus Universitätsklinikum Jena, Germany Chromosome 22 Chromosome 9 e1 1b m-bcr M-bcr e1 e2 b1 b5 5 3 BCR ABL 5 3 1a a2 a3 μ -bcr e19 a11 e1a2 b2a2 b3a2 e19a2 p190 bcr-abl
More informationHuman Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C. genesig PLEX kit. 100 tests. Primerdesign Ltd
Primerdesign Ltd Human Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C genesig PLEX kit 100 tests For general laboratory and research use only 1 Introduction HIV1 & HIV2 Human immunodeficiency
More informationVIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer
VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of
More informationRESEARCH ARTICLE. Abstract. Introduction
DOI:10.22034/APJCP.2017.18.5.1343 New Genetic Variation in the BCR Gene RESEARCH ARTICLE New Genetic Variation in BCR gene of Major B3a2 Breakpoint BCR-ABL Fusion Gene in Patients with Chronic Myelogenous
More informationHuman influenza A virus subtype (H3)
PCRmax Ltd TM qpcr test Human influenza A virus subtype (H3) Haemoglutinin H3 gene 150 tests For general laboratory and research use only 1 Introduction to Human influenza A virus subtype (H3) Influenza,
More informationHuman Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More information"Molecular Monitoring Strategies to Track Response to BCR-ABL Kinase Inhibitors in CML"
Association of Molecular Pathology USCAP Companion Meeting Sunday, February 12, 2006 7:00 PM Dan Jones, MD, PhD Associate Professor Medical Director, Molecular Diagnostic Laboratory Division of Pathology
More informationISOTHERMAL AMPLIFICATION IN MOLECULAR DIAGNOSIS OF SLEEPING SICKNESS
Molecular Diagnostics Symposium 2014 Zurich, 27 February 2014 ISOTHERMAL AMPLIFICATION IN MOLECULAR DIAGNOSIS OF SLEEPING SICKNESS Stijn Deborggraeve Parasite Diagnostics Unit, Institute of Tropical Medicine
More informationHuman Influenza Types A(M1) & B and Respiratory Syncytial Virus. genesig PLEX kit. 100 tests. Primerdesign Ltd
Primerdesign Ltd Human Influenza Types A(M1) & B and Respiratory Syncytial Virus genesig PLEX kit 100 tests For general laboratory and research use only 1 Introduction FluA-M1 & FluB Influenza, commonly
More information[COMPREHENSIVE GENETIC ASSAY PANEL ON
2014 SN GENELAB AND RESEARCH CENTER DR. SALIL VANIAWALA, PH.D [COMPREHENSIVE GENETIC ASSAY PANEL ON MYELOPROLIFERATIVE NEOPLASMS] SN Genelab presents one of the most comprehensive genetic assay panel for
More informationAtypical BCR-ABL fusion transcript (e6a2) in pediatric acute lymphoblastic leukemia
www.edoriumjournals.com CASE REPORT OPEN ACCESS Atypical BCR-ABL fusion transcript (e6a2) in pediatric acute lymphoblastic leukemia Dushyant Kumar, Manoj Kumar Panigrahi, Deepti Dewangan, Sarjana Dutt,
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome
More informationINSULIN MOUSE SERUM KITS
INSULIN MOUSE SERUM KITS PROTOCOL Part # 62IN3PEF & 62IN3PEB Test size#: 200 tests (62IN3PEF), 5 x 200 tests (62IN3PEB) - assay volume: 20 µl Revision: 03-Jan.2018 Store at: 2-8 C (62IN3PEF); 2-8 C (62IN3PEB)
More informationMixed Phenotype Acute Leukemias
Mixed Phenotype Acute Leukemias CHEN GAO; AMY M. SANDS; JIANLAN SUN NORTH AMERICAN JOURNAL OF MEDICINE AND SCIENCE APR 2012 VOL 5 NO.2 INTRODUCTION Most cases of acute leukemia can be classified based
More informationAvian influenza A virus subtype (H7)
TM Primerdesign Ltd Avian influenza A virus subtype (H7) Haemoglutinin H7 gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationMRD in ALL: Correct interpretation in clinical practice. Deepak Bansal Prof., Pediatric Hematology-Oncology unit PGIMER, Chandigarh
MRD in ALL: Correct interpretation in clinical practice Deepak Bansal Prof., Pediatric Hematology-Oncology unit PGIMER, Chandigarh Minimal residual disease Subclinical level of residual leukemia Below
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091533 Age 28 Years Gender Male 1/9/2017 120000AM 1/9/2017 105415AM 4/9/2017 23858M Ref By Final LEUKEMIA DIAGNOSTIC COMREHENSIVE ROFILE, ANY 6 MARKERS t (1;19) (q23
More informationInfluenza A viruses Detection with real time RT-PCR reagents
Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza
More informationHeterogeneity of Abnormal RUNX1 Leading to Clinicopathological Variations in Childhood B-Lymphoblastic Leukemia
Heterogeneity of Abnormal RUNX1 Leading to Clinicopathological Variations in Childhood B-Lymphoblastic Leukemia Xiayuan Liang, MD Department of Pathology University of Colorado School of Medicine Children
More informationWHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationDEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE. An Undergraduate Research Scholars Thesis
DEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE An Undergraduate Research Scholars Thesis by EESHA FAROOQI Submitted to Honors and Undergraduate Research
More informationSwine H1N1 Influenza Human Pandemic Strain
Techne qpcr test Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain 150 tests For general laboratory and research use only
More informationRare pitfalls associated with the routine use of real time PCR
Rare pitfalls associated with the routine use of real time PCR Dr RN Gunson On Behalf of the West of Scotland Specialist Virology Centre R+D team Gartnavel General Hospital Glasgow Scotland Talk outline:
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationMolecular Diagnosis Future Directions
Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular
More information1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir
New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal
More informationSERUM GLUCAGON KITS PROTOCOL
SERUM GLUCAGON KITS PROTOCOL Part # 62SGLPEB & 62SGLPEF Test size#: 5 x 200 tests (62SGLPEB), 200 tests (62SGLPEF) - assay volume: 20 µl Revision: 02-Jan.2018 Store at: -60 C or below (62SGLPEB); -60 C
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationClinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018
1 Clinical Utility of Droplet ddpcr, moving to diagnostics 2 Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018 Disclaimer Disclaimer: all consumables, instruments, applications and software covered
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationJAK2 V617F analysis. Indication: monitoring of therapy
JAK2 V617F analysis BCR-ABL genotyping The exact chromosomal defect in Philadelphia chromosome is a translocation. Parts of two chromosomes, 9 and 22, switch places. The result is a fusion gene, created
More informationHIV-1 Viral Load Real Time (RG)
-1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationOncology Genetics: Cytogenetics and FISH 17/09/2014
Oncology Genetics: Cytogenetics and FISH 17/09/2014 Chris Wragg Head of Oncology Genomics, BGL BGL Bristol Genetics Laboratory (BGL) CPA accredited Genetics laboratory serving a core population of 4-5million
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationRealLine HCV Qualitative Str-Format
Instructions for use REAL TIME PCR DETECTION KIT FOR THE HEPATITIS C VIRUS RNA (HCV) Research Use Only (RUO) (Str-format) VBD0795 96 Tests valid from: October 2018 Rev05_1018_EN Page 1 of 8 Explanation
More informationBD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop
BD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop Maria Dinkelmann, PhD Senior Marketing Applications Specialist BD Biosciences, Ann Arbor, MI 23-14380-00 Cellular Communication
More informationTemplate for Reporting Results of Biomarker Testing for Myeloproliferative Neoplasms
Template for Reporting Results of Biomarker Testing for Myeloproliferative Neoplasms Version: MPNBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is NOT required for accreditation
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationHEMATOPATHOLOGY SUMMARY REPORT RL;MMR;
HEMATOPATHOLOGY SUMMARY REPORT RL;MMR; Page 1 of 1 05/15/20XX HP000000-20XX 05/21/20XX (212) 123-457 (51) 32-3455 (51) 123-457 Age: 78 DOB: 0/05/19XX SS#: 45-45-45 Clinical Information: 78 y/o female with
More informationExosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
More informationAvian Influenza A H5N8
TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza
More informationMolecular Hematopathology Leukemias I. January 14, 2005
Molecular Hematopathology Leukemias I January 14, 2005 Chronic Myelogenous Leukemia Diagnosis requires presence of Philadelphia chromosome t(9;22)(q34;q11) translocation BCR-ABL is the result BCR on chr
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationA. ILEA 1* A. M. VLADAREANU 2 E. NICULESCU-MIZIL 3
Bulletin of the Transilvania University of Braşov Series VI: Medical Sciences Vol. 9 (58) No. 1-2016 THE SIMULTANEOUS OCCURRENCE OF THE BCR-ABL TRANSLOCATION AND THE Jak2V617F MUTATION. DETECTION AND DYNAMICS
More information