Burhansstipanov-Bemis GENA obj. 14 mirna & CBPR excerpt from obj. 29

Transcription

1 ABRIDGED EXCERPT from Genetic Education for Native Americans (GENA ) Objective 14 and 29 In honor of our brother, friend, colleague Linda Burhansstipanov, MSPH, DrPH (Cherokee Nation of OK) Lynne Bemis, PhD, UCHSC For further information, please contact Linda B at Native American Cancer Research 3022 South Nova Road Pine, CO Phone: ; Fax: Native Cancer Survivor s Support Network: Web Page: Frank C. Dukepoo, Ph.D. Hopi and Laguna Pueblo Nations 1 2 Objective: By the end of this session, the participant will be able to: 1. Identify at least one Native American cultural issues that are likely to be related to microrna research. 2. Examine current genetic research-related micro- RNA issues and discoveries and their potential impact for public health on Native American and other Medically Underserved communities. Introduction to GENA Say hello to the person sitting next to you please 3 Some Interesting Human Traits Free earlobes vs. attached ear lobes Bent little fingers vs. straight little fingers Dimples vs. no dimples Hitchhiker s thumb vs. straight thumb Ability to roll the tongue vs. inability to roll your tongue Some Interesting Human Traits Quickly fold your hands. Which thumb is on top? Reclasp your hands so that the other thumb is on top Quickly cross your arms. Which arm is on top? Re-cross your arms so that the other arm is on top. How does it feel? 5 6 1

2 Common Conditions With Known Or Suspected Inherited Susceptibility Allergies Arthritis Atherosclerosis Breast cancer Dementia Depression Diabetes mellitus Epilepsy Hypertension Infertility Inflammatory bowel Lung cancer Multiple sclerosis Parkinson s disease Obesity Schizophrenia Peptic ulcers Thyroid disease 7 Excerpt from GENA Obj. 29 Native American Cultural and Ethical Issues related to Genetic Science and Research Contemporary Topics Related to Genetic Research that are of Interest to AIANs Contemporary Topics Related to Genetic Research that are of Interest to AIANs Native health issues / priorities Alcohol Diabetes Heart Disease Cancer Obesity HIV / AIDS Native plant issues Medicinal plants and herbs Crops (e.g., corn, tobacco) Environmental contamination of plant life Protection of Mother Earth Hybrids / cloning 9 10 Community-based Participatory Research (CBPR) - definition Partnerships / Community-Based Participatory Action Research (short excerpt) CBPR is a partnership approach to research that equitably involves community members, organization representatives and researchers in all aspects of the research process. Israel BA, Eng E, Schulz AJ, and Parker EA. Eds. Multiple Methods for Conducting Community-Based Participatory Research for Health Jossey-Bass 12 2

3 Community-Driven The idea or priority issue originates with the Tribal community But they do not have the staff or ability to address the priority issue They find a research organization who will work with them The tribal community does NOT have a role or decision-making responsibility on every phase of the research project -- NACES Example of Project Approval Processes among IHS / Tribal / Urban Programs Local Tribal Committee for partnerships / decision-makers / leaders Tribal Resolutions / ordinance Tribal Research Committee/IRB IHS Area IRB IHS National IRB approvals NOTE: IHS IRB is currently dysfunctional What Are Criteria For Community Based Participatory Research (CBPR)? Equal partner and decision-making role on every step / phase of the research project Planning the project Identifying the hypothesis Formulating the research plan Analyzing the data Writing the reports Disseminating and presenting project findings Not the (publications, same process professional as traditional and community research meetings) and involves more than simply What do Native Communities say they want? Control over the: Planning (i.e., Health problems of priority to the community, not just to the researcher) Methodology Implementation Evaluation Quality data collection, storage and management Reporting Dissemination NACR giving a community money Common Issues with Genetics and CBPR could be resolved with ground rules Examples of issues: CBPR is the vogue in RFAs and research institutions use traditional research methods but call the study CBPR CBPR requires years of community interactions to create the trust needed for an actual partnership = researchers have a few months to comply with RFA deadlines 17 Common Issues with Genetics and CBPR could be resolved with ground rules (next slide) Examples of issues: Storage or genetic specimens IHS gave DHHS genetic specimens without prior approval from tribal nations Ownerships of the project Ownership of the data 18 3

4 QUESTION: What are Examples of Ground Rules? Who will collect the genetic specimen? Who will store the genetic specimen? How are tribal salaries supported for their decision-making role on every phase of the research project? no volunteers! How are data owned or shared with both partners (tribal nation and researcher)? Where are inservice trainings held? What time of day? What day of the week? GENA Objective 14: Examine current genetic research-related related issues and discoveries and their potential impact for Native communities. Focus: Micro RNA 19 Central Dogma of Biology Human Beings are 99.9% Similar DNA RNA Protein 2% 3 billion base pairs total per genome 3 million base pairs differ through out the genome 2% of that or 60 thousand base pairs would be found in the coding regions. Differences in noncoding RNAs could be as much as 2.94 million QUESTION: How do microarrays differ from micrornas? Microarrays (also referred to as biochips earlier) Act as a catalog of all of the genes May catalog all of the genes in a particular organism 30,000 genes or more can be in a microarray MicroRNAs can be included on a microarray They may be cataloged within a microarray QUESTION: What are MicroRNAs? abbreviated as mirnas Small RNAs that can turn genes off mirnas are nucleotides long Found in all mammalian cells and in many other organisms including plant cells

5 What are MicroRNAs? MicroRNAs are part of what has been referred to as junk DNA mirnas function to silence cellular genes Function by binding to messenger RNA (mrna) and blocking translation into a protein The petunia is an interesting example What Cellular Processes Do mirnas Regulate In Animal Cells? Apoptosis (programmed cell death) Development Fat metabolism Immunology Virology Why are MicroRNAs Exciting? How were MicroRNAs Discovered? Explain many aspects of biology that were previously incomprehensible or ignored. Expected to be the next wave of therapeutics for a variety of previously untreatable conditions. Melanoma, some leukemias, viral infections Initially (~1993) found in model organisms like worms and plants abbreviated as Si RNAs In plants they act differently and are usually called, Small Inhibitory RNAs CAUTION: This becomes confusing if you read plant and mammalian articles. Those articles may refer to Si RNAs as micrornas How were MicroRNAs Discovered? In humans the naturally occurring types or variety are called, micrornas SiRNAs in humans are not naturally occurring. Researchers insert SiRNA into human cells to learn more about how genes work. SiRNAs have been tested in clinical trials as cancer therapeutics. Where are mirnas in the Genome? May overlap with other genes May be in the introns (part of the gene that is removed before expression) Within junk DNA

6 Where Have MicroRNAs Been All This Bioinformatics is the use Time? of computers to identify complex structures in DNA sequence For 40 or more years we have been studying DNA and RNA. During that time the micrornas were thrown out with the waste. Once the Human Genome Sequence was available MicroRNAs were discovered. Where have MicroRNAs Been All This Time? Bioinformatics is not always correct. Each MicroRNA must be confirmed by laboratory experimentation. Bioinformatics experiments are called in silico experiments Mostly Discovered by Bioinformatics mirna Goes Through Changes To Become Mature Processing and Activity of MicroRNAs bp=base pairs MicroRNA starts out very large (1-2,000 nucleotides) As it matures, the mirna becomes smaller Mature means it is nucleotides mirna must be mature to be active Primary microrna (2000 bp) Preliminary microrna (70-90 bp) Mature microrna (20-25 bp) Targets in the 3 Untranslated region of messenger RNA This Is How You Usually See Base Sequences UGGGAUGAGGUAGUAGGUUGUAU AGUUUUAGGGUCACACCCACCACU GGGAGAUAAAUAUACAAUCUACU GUCUUUCCUA How are MicroRNAs Made? Initially mirnas are copied from the DNA They take on a unique shape You usually see part of the sequence in a straight line, but it has loops and stems NOTE: Normally the DNA bases are AGTC, but in RNA the T becomes a U

7 RNA Transcript Works similar to a zipper Species Sequence Comparisons of mir-137 human chimp macaca cow pig dog opossum ttctggtggcggcggcggcggcag ttctggtggcggcggcggcggcag ttctggtggcggcagcggcggcag ttctggtggcggcggcggcggcag ttctggtggcggcggcgg cag ttctggtggcggcggcggcggcgg ggaggaagaaaaggagcagcag Complex MicroRNA Structure UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGG GUCACACCCACCACUGGGAGAUAAAUAUACAAU CUACUGUCUUUCCUA But this is how it forms U GU UGGGA GAG AGUAGGUUGUAUAGUU AUCCU UUC UCAUCUAACAUACUCAA UG You would see this in the database UUAG GGUCA CACCC ACCACU GGGAG GAUAA AUAUA Complex MicroRNA Structure UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCC ACCACUGGGAGAUAAAUAUACAAUCUACUGUCUUUCCUA These are loops U GU UGGGA GAG AGUAGGUUGUAUAGUU AUCCU UUC UCAUCUAACAUACUCAA UG UUAG GGUCA CACCC ACCACU GGGAG GAUAA AUAUA This is a stem How Do mirnas Function? The protein begins here How Do mirnas Function? ATG The protein ends here Messenger RNA of your favorite gene STOP AAAA ATG Messenger RNA of your favorite gene STOP AntimiRNA AntimiRNA mirna AAAA = Your favorite protein is not formed = Your favorite protein is formed

8 How Are The Targets of mirnas Identified / Found? Bioinformatics approach Target Scan (software program) found 451 target messenger RNAs for one mirna This represented 400 distinct genes Software estimates the likelihood of microrna regulation with a percentile score mirna Web Resources url to download TargetScan and TargetScanS results: url for mirbase html Searchable database of all known/predicted mirnas and targets Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB (2003). Prediction of mammalian microrna targets. Cell 115: MicroRNAs Background for Interactive Activity Multiple Targets of MicroRNAs The mature MicroRNA can find its target and block gene expression. In cancer a mirna could be shutting down a gene that prevents cancer (p53) mirna target multiple genes Since mirnas can bind imperfectly more than one gene can be targeted in the same cell at the same time Or if a microrna is lost (e.g., through deletion), a gene that should not be present can not be turned off. The Activity: Interactivity 1. Each of you has a laminated piece of microrna or a messenger RNA on your desk. 2. These laminated pieces represent diseases like cancer, diabetes and heart disease. Remember than one mirna regulates many different genes. 3. Please walk around the room to find the match so that each disease-specific messenger RNA matches the respective microrna. Interactivity 4. Each completed messenger RNA with its microrna match should find others who have that same grouping (i.e., multiple groups of cancer, diabetes and heart disease ). 5. Each group will answer some questions about the microrna and your group s given disease