Frequency of Bacille Calmette-Guérin (BCG) and Mycobacterium tuberculosis in Tissue Biopsy Specimens of Children Vaccinated With BCG

Transcription

1 Microbiology and Infectious Disease / BCG and M TUBERCULOSIS After BCG Vaccination Frequency of Bacille Calmette-Guérin (BCG) and Mycobacterium tuberculosis in Tissue Biopsy Specimens of Children Vaccinated With BCG Maryam Monajemzadeh, MD, 1 Reza Shahsiah, MD, 1 Abdolmajid Zarei, MD, 1 Alireza Alai Alamooti, MD, 1 Fatemeh Mahjoub, MD, 1 Setareh Mamishi, MD, 2 Ghamartaj Khotai, MD, 2 Reza Pazira, MD, 1 and Neda Eram, MD 1 CME/SAM Key Words: Bacille Calmette-Guérin; BCG; Mycobacterium tuberculosis; Disseminated mycobacterial infection; Lymph node; Real-time polymerase chain reaction; Melting curve analysis Upon completion of this activity you will be able to: describe the predisposing factors of disseminated bacille Calmette- Guérin (BCG) infection and why it is important to differentiate BCG infecton from Mycobacterium tuberculosis infection. list the advantages of molecular assays and strategies for increasing assay sensitivity for detection of mycobacteria in tissue specimens. apply polymerase chain reaction data to determine the mycobacterial species. The ASCP is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The ASCP designates this educational activity for a maximum of 1 AMA PRA Category 1 Credit per article. This activity qualifies as an American Board of Pathology Maintenance of Certification Part II Self-Assessment Module. The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose. Questions appear on p 162. Exam is located at Abstract Vaccination of all newborns with bacille Calmette- Guérin (BCG) vaccine is a standard practice in developing countries. Disseminated mycobacterial infection in an immunocompromised child can be caused by BCG and other mycobacteria. A total of 21 patients with a histopathologic diagnosis of mycobacterial infection were studied in a period of 4 years. DNA was extracted from formalin-fixed, paraffin-embedded tissues. Real-time polymerase chain reaction was performed to determine the mycobacterial species. The overall sensitivity of the assay was 71.5%. The prevalence rates of BCG, Mycobacterium tuberculosis, and other mycobacteria in the positive results were 80% (12/15), 13% (2/15), and 7% (1/15), respectively. Bacille Calmette-Guérin (BCG) is an attenuated strain of Mycobacterium bovis introduced as a human vaccine against tuberculosis in the early 1920s. 1,2 Vaccination of all newborns with BCG vaccine is a standard practice in Iran and other developing countries, and all newborns receive the vaccine in the first or second day of life. This practice is generally considered safe, but rare complications may occur in approximately 1.9% of cases. 3 These complications include regional lymphadenopathy, subcutaneous abscess, osteomyelitis, eczema vaccinatum, hypertrophic scars, and keloid formation, which are often self-limiting, and usually no treatment is necessary. 3,4 Most lymphadenopathies related to BCG complications are subclinical and regress spontaneously in immunocompetent patients. 3 On the other hand, severe disseminated BCG infection may occur in children with defective immunity and HIV infection. 5,6 The incidence of disseminated BCG infection has been reported between 0.01 and 3.4 per million in different studies. 1,7,8 Disseminated mycobacterial infection in an immunocompromised child can also be caused by mycobacteria other than BCG Mycobacterium tuberculosis infects about one third of the world s population each year and is prevalent in areas in which BCG vaccination is recommended. 7,12 Meanwhile nontuberculous mycobacteria are widespread in the environment and a cause of opportunistic infection in immunocompromised hosts. 13 In addition to rapidity, molecular techniques are confirmatory for the presence of the exact type of mycobacterial infection. The ability to rapidly and specifically identify BCG is clinically important because of different treatment 102 Am J Clin Pathol 2010;133: Downloaded 102 from

2 Microbiology and Infectious Disease / Original Article schemes. 14 On the other hand, in many situations, the physician is unaware of the infectious nature of the disease before the result of the microscopic examination of the tissue is reported; therefore, often no tissue is sent for culture at the time of biopsy. This is an important problem, especially in cases in which mycobacterial infection is found in autopsy material; therefore, establishing a method for the diagnosis of the specific type of mycobacterial infection in formalin-fixed, paraffin-embedded tissue seems mandatory. 15 To our knowledge, there no published studies about the frequency of BCG and other mycobacterial infections in Iranian children. The aim of this study was to determine the frequency of BCG and other mycobacteria in biopsy materials in which the Ziehl-Neelsen stain was positive for acid-fast bacilli. Materials and Methods The cases were collected in a period of 4 years, 2004 to 2008, in a children s medical center hospital. In addition to being a referral tertiary care center, this hospital is the major teaching center of Tehran University of Medical Sciences, Tehran, Iran. Patients are admitted from all regions of Iran, representing a wide spectrum of socioeconomic levels. A total of 23 patients with a histopathologic diagnosis of mycobacterial infection were identified. Patients clinical records were studied. Of 23 selected cases, 2 had limited tissue and were excluded from the study. Paraffin blocks of 21 remaining cases were suitable for the study and were retrieved. The H&E- and Ziehl-Neelsen stained slides were reviewed. DNA was extracted from formalin-fixed, paraffinembedded tissues using a previously described method. 16 Two rounds of real-time polymerase chain reaction (PCR) were performed. The flowchart for identification is shown in Figure 1. The first round of real-time PCR was performed using Mycobacterium genus control primers as described by Pinsky and Banaei. 17 The procedures of block sectioning, extraction, and PCR were repeated for the negative samples. This was done owing to uneven distribution of acid-fast bacilli in the specimen. 16 The positive samples were subjected to a second round of real-time PCR using Mycobacterium tuberculosis and M bovis BCG-specific primers as described by Pinsky and Banaei. 17 Extraction Three consecutive 5-μm sections were made using disposable blades, and then the paraffin sections were transferred to sterile 1.5-mL Eppendorff tubes by using a plastic applicator; a new blade and applicator were used for each block. Sections were pelleted by centrifugation of the tubes at 16,000g for 1 minute, and then 200 μl of sterile distilled water with 0.5% vol/vol polysorbate 20 was added. The tubes were placed in a heating block at 100 C for 10 minutes and then snap frozen in liquid nitrogen. The cycle of boiling and freezing was repeated 2 times, and the tubes were boiled again for 10 minutes and finally centrifuged at 3,000g for 20 minutes. The supernatant was transferred to a fresh tube and stored at 20 C. Polymerase Chain Reaction: Each reaction volume was 20 μl and contained AccuPower Greenstar PreMix (Bioneer, Alameda, CA), 10 pmol of each primer, and 5 μl of template. Reaction 1 had primers to detect a region of the 16S ribosomal RNA gene that is common to all mycobacteria (Mycobacterium genus control primers) Table 1. Reaction 2 had primers to detect the presence of RD9 (specific for M tuberculosis) or the absence of RD1 (specific M bovis BCG-specific primers; Table 1). Negative control, no template control, M tuberculosis, M bovis, and M bovis BCG control samples were included in each PCR run. The reactions were performed in a Rotor-Gene 3000 BCG Yes (RD1 deleted) Reaction #1 Amplification with genus control primers Product? Yes Reaction #2 Amplification with RD1 and RD9 primers Product? No Other Mycobacterium Reextraction No Tuberculosis Yes (RD9 present) Figure 1 Two real-time polymerase chain reactions and identification algorithm. (Modified from the original method described by Pinsky and Banaei. 17 ) For product specifications, see Table 1. BCG, bacille Calmette-Guérin. Downloaded from Am J Clin Pathol 2010;133:

3 Monajemzadeh et al / BCG and M TUBERCULOSIS After BCG Vaccination Table 1 Primers and Product Characteristics Used in This Study * Length Product (bp) Mycobacterium Melting Peak ( C) Reaction Primer Sequence RD9 present 51 Tuberculosis TTTCGAGCCGTAAATTACTGTG; RD1 deleted 226 BCG GAGCATTCTCGCTCCGAAT 5-GGATTTGACGTCGTGCTTCT; Mycobacterial 16S rrna 78 Genus control TTCAACGGGTTACTGCGAAT 5-CAACGCGAAGAACCTTACCT; 5-TGCACACAGGCCACAAGGGA BCG, bacille Calmette-Guérin; bp, base pairs; rrna, ribosomal RNA. * Designed by Pinsky and Banaei. 17 real-time machine (Corbett Research, Mortlake, Australia) as follows: initial denaturation at 95 C for 5 minutes and 40 cycles of 95 C for 15 seconds, 60 C for 30 seconds, and 72 C for 30 seconds. Final extension involved 72 C for 5 minutes and a last step composed of a 60 C to 95 C temperature ramp at a rate of 1 C/second to generate the melting curve. Positive control experiments were run on 2% agarose gel to confirm the amplicon size. Results Of 21 selected patients, 10 were boys, and the rest were girls. Ages of patients at the time of admission ranged from 2 to 72 months with a mean and standard deviation of 20 and 25 months, respectively. Two histomorphologic patterns were observed as follows: (1) well-circumscribed granulomas, with multinucleated giant cells and a scant number of acid-fast bacilli (type I reaction); and (2) ill-defined granulomas or diffuse histiocytic reaction with a large number of acid-fast bacilli (type II reaction). These findings are consistent with previous studies. 3 One of the patients (case 1) had bacteriologic confirmation of BCG infection before the present study. Of 21 samples, 6 were negative after 2 rounds of sectioning-extraction and PCR reaction 1. Twelve were positive for BCG, 2 were positive for tuberculosis, and the rest were negative in PCR reaction 2. The sensitivity of the assay was 71.5%. The prevalence rates of BCG, tuberculosis, and other mycobacteria in the positive samples were 80% (12/15), 13% (2/15), and 7% (1/15), respectively. The results are summarized in Table 2. Table 2 Clinical Data and Results for First- and Second-Round Real-Time Polymerase Chain Reaction Case No./Sex/Age (mo) Block No. Result Morphologic Reaction Biopsy Site Other 1/M/ N II Liver 2/F/ N I Lymph node NIMD 3/M/ TB I Lung NIMD 4/M/ A BCG I Lymph node NIMD 5/M/ BCG I Liver 6/F/ BCG I Appendix 7/F/ BCG II Lymph node 8/M/ BCG II Lymph node 9/F/ BCG I Lymph node 10/F/ TB I Lymph node 11/F/ BCG II Lymph node 12/M/ N II Liver SCID * 13/M/ BCG II Paravertebral mass SCID * 14/M/NA BCG I Liver 15/F/ M I Liver; spleen 16/F/ N I Liver 17/M/ BCG I Liver SCID * 18/F/ A BCG I Liver; spleen 19/F/ N I Lymph node 20/F/ N II Lymph node SCID * 21/M/ BCG II Liver BCG, bacille Calmette-Guérin; I, granulomatous; II, histiocytic; M, mycobacterium other than tuberculosis or BCG; N, negative; NA, not available; NIMD, no immunodeficiency found; SCID, severe combined immunodeficiency. * Diagnosis based on clinical data, serum immunoglobulin level, and flow cytometry. 104 Am J Clin Pathol 2010;133: Downloaded 104 from

4 Microbiology and Infectious Disease / Original Article Discussion BCG vaccination is contraindicated in infants with immunodeficiency; however, they are vaccinated before this diagnosis is made, and immunodeficiency may be diagnosed after the development of BCG complications. 6 Meanwhile, proving this infection, even in autopsy materials, can improve the management of future siblings in affected families. For Ziehl-Neelsen staining to become positive, biopsy material must contain a minimum of 10,000 bacteria per gram of tissue. 18 Despite the presence of acid-fast bacilli in microscopic slides, 6 specimens were PCR-negative, for an overall sensitivity of 71.5%. This finding is consistent with other studies on formalin-fixed, paraffin-embedded tissues 19 and might be due to nucleic acid fragmentation secondary to formalin fixation. 20 Another cause of false negativity would be nonspecific product formation, especially when the target concentration is low and background DNA is high. These nonspecific products, which are produced by the process of mispriming or primer dimerization, compete with the target during amplification and decrease the efficiency of reaction. 21 Mispriming also complicates the evaluation of melting curves by producing nonspecific, wide melting peaks. Although the aforementioned extraction method has been shown to be efficient, 16 multiple phases of boiling and freezing leave a substantial amount of single-stranded background DNA, which would increase the probability of mispriming. 21 Therefore, using a high-efficiency hot-start polymerase is mandatory. Meanwhile, touch-down PCR and standardization of the background DNA concentration are additional strategies for pushing the reaction in favor of target amplification and escalating the overall sensitivity of the assay. 22,23 While prognosis for BCG lymphadenitis is good, in patients with disseminated BCG infection, the outcome is often poor. The histomorphologic pattern might be related to the type of immunodeficiency disorder and clinical outcome. 24,25 HIV infection is reported by researchers as the most common predisposing factor for postvaccination BCG infection in South Africa. 26 Although primary in contrast with secondary immunodeficiency was more common in the current series, the increase of HIV infection may change this pattern in future. Moreover, when acid-fast bacilli are observed, the infectious agent may be BCG, M tuberculosis, or nontuberculous mycobacteria. Determination of species is clinically important because of different treatment schemes. Meanwhile, clinical management of the disease is difficult, and rapid diagnosis is mandatory. 26 Molecular methods can be used for rapid and accurate diagnosis. From the Departments of 1 Pathology and 2 Pediatric Infectious Disease, Tehran University of Medical Sciences, Tehran, Iran. Address reprint requests to Dr Shahsiah: Dept of Pathology, Tehran University of Medical Sciences, Keshavarz Blvd, Tehran, Iran. Supported by a grant from Tehran University of Medical Sciences Research Center. Acknowledgments: We thank Benjamin A. Pinsky, MD, PhD, for excellent comments, Zahra Omidi for devoted technical support, and Golnaz Keyvanmehr, Takapouzist, Tehran, for kindly providing the positive control samples. References 1. Dietrich G, Viret JF, Hess J. Mycobacterium bovis BCG-based vaccines against tuberculosis: novel developments. Vaccine. 2003;21: Lugosi L. Theoretical and methodological aspects of BCG vaccine from the discovery of Calmette and Guérin to molecular biology: a review. Tuber Lung Dis. 1992;73: Al-Bhlal LA. Pathologic findings for bacille Calmette-Guérin infections in immunocompetent and immunocompromised patients. Am J Clin Pathol. 2000;113: Grange JM. Complications of bacille Calmette-Guérin (BCG) vaccination and immunotherapy and their management. Commun Dis Public Health. 1998;1: Talbot EA, Perkins MD, Silva SF, et al. Disseminated bacille Calmette-Guérin disease after vaccination: case report and review. Clin Infect Dis. 1997;24: Afshar Paiman S, Siadati A, Mamishi S, et al. Disseminated Mycobacterium bovis infection after BCG vaccination. Iran J Allergy Asthma Immunol. 2006;5: Manissero D, Lopalco PL, Levy-Bruhl D, et al. Assessing the impact of different BCG vaccination strategies on severe childhood TB in low-intermediate prevalence settings. Vaccine. 2008;26: Casanova JL, Blanche S, Emile JF, et al. Idiopathic disseminated bacillus Calmette-Guérin infection: a French national retrospective study. Pediatrics. 1996;98(4 pt 1): Okascharoen C, Nuntnarumit P, Sirinavin S. Neonatal tuberculosis associated with shock, disseminated intravascular coagulation, hemophagocytic syndrome, and hypercalcemia: a case report. J Perinatol. 2003;23: Galkina E, Kondratenko I, Bologov A. Mycobacterial infections in primary immunodeficiency patients. Adv Exp Med Biol. 2007;601: Mazade MA, Evans EM, Starke JR, et al. Congenital tuberculosis presenting as sepsis syndrome: case report and review of the literature. Pediatr Infect Dis J. 2001;20: Raviglione MC, Snider DE Jr, Kochi A. Global epidemiology of tuberculosis: morbidity and mortality of a worldwide epidemic. JAMA. 1995;273: Covert TC, Rodgers MR, Reyes AL, et al. Occurrence of nontuberculous mycobacteria in environmental samples. Appl Environ Microbiol. 1999;65: Talbot EA, Williams DL, Frothingham R. PCR identification of Mycobacterium bovis BCG. J Clin Microbiol. 1997;35: Salian NV, Rish JA, Eisenach KD, et al. Polymerase chain reaction to detect Mycobacterium tuberculosis in histologic specimens. Am J Respir Crit Care Med. 1998;158: Whittington RJ, Reddacliff L, Marsh I, et al. Detection of Mycobacterium avium subsp paratuberculosis in formalin-fixed paraffin-embedded intestinal tissue by IS900 polymerase chain reaction. Aust Vet J. 1999;77: Downloaded from Am J Clin Pathol 2010;133:

5 Monajemzadeh et al / BCG and M TUBERCULOSIS After BCG Vaccination 17. Pinsky BA, Banaei N. Multiplex real-time PCR assay for rapid identification of Mycobacterium tuberculosis complex members to the species level. J Clin Microbiol. 2008;46: Jeyanathan M, Alexander DC, Turenne CY, et al. Evaluation of in situ methods used to detect Mycobacterium avium subsp paratuberculosis in samples from patients with Crohn s disease. J Clin Microbiol. 2006;44: Park DY, Kim JY, Choi KU, et al. Comparison of polymerase chain reaction with histopathologic features for diagnosis of tuberculosis in formalin-fixed, paraffin-embedded histologic specimens. Arch Pathol Lab Med. 2003;127: Lehmann U, Kreipe H. Real-time PCR analysis of DNA and RNA extracted from formalin-fixed and paraffin-embedded biopsies. Methods. 2001;25: Chou Q, Russell M, Birch DE, et al. Prevention of pre-pcr mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 1992;20: Don RH, Cox PT, Wainwright BJ, et al. Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 1991;19: Evans MF, Adamson CS, Simmons-Arnold L, et al. Touchdown General Primer (GP5+/GP6+) PCR and optimized sample DNA concentration support the sensitive detection of human papillomavirus. BMC Clin Pathol. 2005;5:10. doi: / Abramowsky C, Gonzalez B, Sorensen RU. Disseminated bacillus Calmette-Guérin infections in patients with primary immunodeficiencies. Am J Clin Pathol. 1993;100: Emile JF, Patey N, Altare F, et al. Correlation of granuloma structure with clinical outcome defines two types of idiopathic disseminated BCG infection. J Pathol. 1997;181: Hesseling AC, Rabie H, Marais BJ, et al. Bacille Calmette- Guérin vaccine induced disease in HIV-infected and HIV-uninfected children. Clin Infect Dis. 2006;42: Am J Clin Pathol 2010;133: Downloaded 106 from