Supplementary Figure 1 Maturation arrest in bone marrow smears from a JAGN1-deficient patient (P4).

Transcription

1 Supplementary Figure 1 Maturation arrest in bone marrow smears from a JAGN1-deficient patient (P4). JAGN1-deficient patients in this study showed (sometimes intermittently, as in this figure) signs of maturation arrest at the promyelocyte/myelocyte stage, a hallmark feature of classical severe congenital neutropenia. 1

2 Supplementary Figure 2 Segregation analysis of the JAGN1 mutation identified in the index family (pedigree A). The mutation shows perfect segregation with the disease, with all affected individuals (P1 P5) homozygous for the mutation (c.3g>a; p.met1ile). All parents are heterozygous, and the non-affected sibling II-1 is a heterozygous carrier of the mutation. No DNA material was available for the study of the non-affected sibling II-5. 2

3 Supplementary Figure 3 Segregation analysis of families B through I. The figure illustrates perfect segregation with the disease in pedigrees B I in this study, consistent with autosomal recessive inheritance. The initial L next to P14 indicates that this patient developed leukemia (see also Supplementary Table 1 for clinical details on the individual patients). 3

4 Supplementary Figure 4 Immunoblot analysis of JAGN1 protein expression in fibroblasts. Fibroblasts were obtained from patients P12, P13 and P14 as well as from the heterozygous father of P13 (P13F) and one unrelated, healthy donor. GAPDH was used as a loading control. Immunoblot analysis for JAGN1 expression confirmed the findings seen in EBVimmortalized B cell lines that JAGN1 protein expression is decreased in P12 and absent in P13. Furthermore, for patient P14, for whom no EBV-immortalized B cell lines were available, the results show that the mutation leads to markedly decreased protein expression for JAGN1. 4

5 Supplementary Figure 5 Transmission electron microscopy analysis of healthy donor neutrophils with or without rh treatment. The figure illustrates that there are no obvious ultrastructural differences between peripheral blood neutrophils in healthy donors with or without injections with recombinant. 5

6 Supplementary Figure 6 MALDI-TOF mass spectrometry of permethylated N-glycans from healthy human neutrophil samples. N-glycomic profiles of permethylated N-glycans from human neutrophil samples from the healthy mother (a) and father (b) of pedigree C. Profiles of permethylated N-glycans are from the 50% MeCN fraction (Online Methods). Putative structures are based on composition, tandem mass spectrometry and biosynthetic knowledge. Healthy human neutrophil N-glycans included high mannose and complex bi-, tri- and tetra-antennary structures, of which the latter were core fucosylated and non-bisected and mainly terminated with sialylated or fucosylated epitopes. Immature truncated N-glycan structures were found to be relatively minor and were restricted to two core-fucosylated bi- and triantennary structures (m/z = 1,835.9 and 2,040.0; top). Most of the N-glycans are multibranched and are rich in the Le X epitope (Galβ1-4(Fucα1-3)GlcNAc). Of note is the presence of up to three Le X moieties on tri- and tetra-antennary N-glycans (for the mother sample, m/z = 3,402.6, 3,851.7, 4,025.7, 4,212.8, 4,300.8, 4,474.9, 4,749.9 and 4,924.0; bottom). These structures were found to be higher in relative abundance than corresponding glycans with absent or single fucose residues attached on their antennae (for the mother sample; m/z = 3,415.6, 3,864.7, 4,038.8, 4,313.8, 4,487.9, 4,762.9 and 4,937.8). 6

7 Supplementary Figure 7 treatment does not alter the glycomic profile of healthy human neutrophils. MALDI-TOF mass spectrometry of permethylated N-glycans from (a) an unrelated healthy donor and (b) an unrelated healthy donor treated additionally with. Other conditions are identical to those in Supplementary Figure 6. treatment does not alter the composition or the relative abundance of the mature N-glycans found in the lower panels of the spectra. 7

8 Supplementary Figure 8 JAGN1-mutated human neutrophils exhibit aberrant glycosylation. MALDI-TOF mass spectrometry of permethylated N-glycans from JAGN1-mutated neutrophils from (a) patient P8 and (b) patient P7. Other conditions are identical to those in Supplementary Figure 6. The N-glycans of the JAGN1-mutated human neutrophils are characterized by decreased abundance or almost a complete absence of the tri- and tetra-antennary core-fucosylated structures containing double and triple antenna-fucosylated residues. 8

9 Supplementary Figure 9 JAGN1-mutated human neutrophils exhibit severely aberrant glycosylation. MALDI-TOF mass spectrometry of permethylated N-glycans from (a) JAGN1-mutated peripheral blood neutrophils from patient P12 and (b) bone marrow derived neutrophil from patient P3. Red peaks depict the glycans whose abundance is markedly altered in patients. Other conditions are identical to those in Supplementary Figure 6. N-glycans from JAGN1-mutated human neutrophil samples from these patients exhibited an abnormal increase in the agalactosylated structures found at m/z = 1,835.9 and 2, Their low-mass N-glycome was characterized by abnormally high abundance of truncated bi- and triantennary agalactosylated structures (m/z = 1,835.9 and m/z = 2,081.0, respectively). Concomitant with this increase in immature glycans was a substantial reduction in all high-molecular-weight tri- and tetra-antennary glycans, including the complete absence of components above an m/z of 3,800. Consequently, these patients neutrophils have a dramatic reduction in functional glycan epitopes, including Le X and sialylated 9

10 sequences. 10

11 Supplementary Figure 10 MALDI-TOF mass spectrometry of permethylated O-glycans from healthy and JAGN1-mutated human peripheral blood and bone marrow neutrophil samples. MALDI-TOF mass spectrometry of permethylated Ο-glycans from (a) the healthy mother from pedigree C, (b) the healthy father from pedigree C, (c) an unrelated healthy donor, (d) an unrelated healthy donor additionally stimulated with, (e) patient P8, (f) patient P7, (g) patient P12 and (h) patient P3. Peripheral blood neutrophil were available for a g; for patient P3, neutrophil from bone marrow were assessed. Ο-glycomic profiles of permethylated Ο-glycans are from the 35% MeCN fraction (Online Methods). Putative structures are based on composition, tandem mass spectrometry and biosynthetic knowledge. 11

12 Supplementary Figure 11 Investigation of the effects of JAGN1 knockdown on the protein expression levels, glycosylation and localization of neutrophil elastase (ELANE). To study the effect of JAGN1 silencing on the expression of neutrophil elastase, wild-type HA-tagged ELANE was expressed in JAGN1- silenced HeLa cells. In protein blotting, neutrophil elastase and JAGN1 were detected, and actin was used as a loading control. sirnamediated knockdown of JAGN1 did not influence the protein expression levels or the molecular weight of neutrophil elastase (a). To study further the possible effect of JAGN1 on the glycosylation of neutrophil elastase, HA-tagged ELANE was expressed in HeLa cells in combination with sirna-mediated JAGN1 knockdown. Treatment of protein lysates with either the EndoH or PNGase enzymes revealed no difference in the glycosylation pattern between control and sirna-treated samples (b). Immunofluorescence studies were performed in HeLa cells to assess the potential effects of JAGN1 knockdown on neutrophil elastase (green) subcellular localization. Nuclei were visualized by DAPI staining (blue). Scale bar, 10 µm. No difference in subcellular localization between control and JAGN1 knockdown cells was detected (c). 12

13 Supplementary Figure 12 Assessment of apoptosis in neutrophil in patient P13. The figure illustrates increased numbers of apoptotic cells following apoptosis induction using staurosporine, similar to the data for patient P12 displayed in Figure 2d. 13

14 Supplementary Figure 13 Enhanced loss of mitochondrial membrane potential in patient P13. The figure illustrates the accelerated loss of mitochondrial membrane potential in patient P13, similar to the data for patient P7 displayed in Figure 2e. 14

15 Supplementary Figure 14 Immunofluorescence-based localization studies using GFP-tagged JAGN1 constructs. HeLa cells (a,b) and fibroblasts (c,d) transiently transfected with constructs expressing GFP or fusion proteins (N-terminally fused EGFP-JAGN1 or C-terminally fused JAGN1-EGFP) were counterstained using an antibody either against the ER marker protein calnexin or the Golgi apparatus marker protein golgin-97. Live-cell staining was performed with MitoTracker for mitochondria staining. In all cases, the characteristic reticulated staining pattern of the ER is observed. The far right panel depicts the merged images for GFP (green) and the specific cell organelle (red), where colocalization of the signals is demonstrated in yellow. The overlay shows that colocalization of calnexin and JAGN1 is extensive but incomplete. There is no colocalization of JAGN1 and the Golgi apparatus or mitochondria. 15

16 Supplementary Figure 15 Investigation of the effects of JAGN1 knockdown on ER stress and the glycosylation, localization and functionality of - R (CSF3R). (a) The induction of ER stress was studied in HeLa cells by transfecting the cells first with JAGN1-specific oligonucleotides (numbered 1 and 2) and then treating them with thapsigargin. In protein blotting, BIP levels were detected as an indicator of ER stress, and knockdown of JAGN1 is shown. Actin was used as a loading control. No differences in induced BIP levels were observed between control sirna and JAGN1-silenced samples. (b) Glycosylation of -R was studied in more detail in JAGN1-silenced HeLa cells. Cells were first transfected with either control sirna or JAGN1-specific sirnas and were then transfected with construct encoding HAtagged -R. The samples were then either left untreated or treated with EndoH or PNGase enzymes. Protein blotting analysis shows HA-tagged -R and actin as a loading control. No differences in glycosylation between control sirna and JAGN1-silenced samples were detected. (c) The localization of -R was further studied by immunofluorescence staining in JAGN1-silenced HeLa cells. The cells were first transfected with sirnas as explained above and were then transiently transfected with a construct encoding GFP-tagged -R (in the pmmp vector). -R fused to GFP is detected on a green channel, and anti--r is detected on a red channel. DAPI was used to stain nuclei (blue). No differences in the localization of -R between control sirna and JAGN1- silenced samples were detected. Scale bar, 10 µm. (d) To study the effect of JAGN1 knockdown on -R dependent signaling, G- CSF-R GFP was expressed in JAGN1-silenced HeLa cells. In contrast to cells treated with control sirna, JAGN1 knockdown HeLa cells showed reduced phosphorylation of STAT3 upon exposure to rh. 16

17 Supplementary Table 1 List of genes on chromosome 3 contained in the linkage interval, listed in their order on the chromosome. Before embarking on the positional search, we sequenced HAX1, G6PC3 and ELANE/ELA2 to rule out mutations in these previously established neutropenia genes. Genes marked with (*) were assessed partially or completely excluded by Sanger sequencing for potential mutations. 1. LHFPL4 lipoma HMGIC fusion partner-like 2. MTMR14 myotubularin related protein CPNE9 copine family member IX *4. BRPF1 bromodomain and PHD finger containing, 1 5. OGG1 8-oxoguanine DNA glycosylase *6. CAMK1 calcium/calmodulin-dependent protein kinase I *7. TADA3L transcriptional adaptor 3 (NGG1 homolog, yeast)-like *8. ARPC4 actin related protein 2/3 complex, subunit 4, 20kDa 9. TTLL3 tubulin tyrosine ligase-like family, member RPUSD3 RNA pseudouridylate synthase domain containing CIDEC cell death-inducing DFFA-like effector c *12. JAGN1 jagunal homolog 1 (Drosophila) *13. IL17RE interleukin 17 receptor E *14. IL17RC interleukin 17 receptor C 15. CRELD1 cysteine-rich with EGF-like domains PRRT3 proline-rich transmembrane protein TMEM111 transmembrane protein LOC hypothetical LOC *19. FANCD2 Fanconi anemia, complementation group D2 *20. C3orf24 chromosome 3 open reading frame 24 *21. C3orf10 chromosome 3 open reading frame VHL von Hippel-Lindau tumor suppressor *23. IRAK2 interleukin-1 receptor-associated kinase TATDN2 TatD DNase domain containing GHRL ghrelin/obestatin prepropeptide *26. SEC13 SEC13 homolog (S. cerevisiae) 27. ATP2B2 ATPase, Ca++ transporting, plasma membrane 2 *28. MIRN885 microrna SLC6A11 solute carrier family 6 (neurotransmitter transporter, GABA), member SLC6A1 solute carrier family 6 (neurotransmitter transporter, GABA), member 1 1

18 Supplementary Table 2 Exome sequencing of patient P2. Variants with a minor allele frequency above 0.01 were excluded from further analysis. Remaining variants were checked for appearance in dbsnpbuilt137 or the 1000 Genomes project as well as for recurrence among all three individuals. JAGN1 remained the only gene with a variant not present in any database. Gene Function Chr Start Ref Obs dbsnp Patient Genomes P2 JAGN1 missense chr G A no no 2

19 Supplementary Table 3 Bioinformatic results for JAGN1 amino acid substitutions. For SIFT 43, scores near 0.0 are most strongly predicted to be deleterious; when dichotomizing results, scores 0.05 are assigned the prediction Affect Protein Function. For PolyPhen-2 44, scores near 1.0 are most strongly predicted to be deleterious. For Consurf 45, predictions for positions Gly14, Arg20, Glu21 and His44 were given the highest rating of confidence. Substitution SIFT prediction (score) PolyPhen2 prediction (score) Consurf prediction p. Gly14Ser Affect Protein Function (0.04) Probably Damaging (1.0) Functional p. Arg20Gln Affect Protein Function (0.00) Probably Damaging (1.0) Functional p. Glu21Asp Tolerated (0.21) Probably Damaging (1.0) Functional p. His44Tyr Tolerated (0.07) Possibly Damaging (0.489) Structural p. Gln162Arg Tolerated (0.11) Probably Damaging (0.993) Unknown 3

20 Supplementary Table 4 Serial full blood counts of several JAGN1-deficient patients. Patient Patient Patient

21 Patient Patient Patient every 4 days n/a 1218 n/a n/a 6 every 4 days 5

22 Patient Patient Patient n/a Patient 10 comment n/a n/a 5 Allogeneic bone marrow transplantati on at age 10 months n/a n/a 0 2 Patient

23 Patient Patient Patient comment 7

24 year after BMT years after BMT years after BMT 8

25 Supplementary Table 5 List of the primers used for cloning of JAGN1 Primers Sequence 5-3 JAGN1 in pegfp-c1 GTCAGATCTATGGCGTCTCGAGCAGGCCCGCG (upstream) JAGN1 in pegfp-c1 ACCGTCGACTCATTTATGCTTCTTCTCCTGTGTGC (downstream) JAGN1 in pegfp-n1 ATAGCTAGCGCCACCATGGCGTCTCGAGCAGGCCCGCG (upstream) JAGN1 in pegfp-n1 AGTGGATCCGACCCGCTGCCTTTATGCTTCTTCTCCTGTGTGC (downstream) 9