Lawsone, juglone and β-lapachone derivatives with enhanced mitochondrial-based toxicity.

Transcription

1 Lawsone, juglone and β-lapachone derivatives with enhanced mitochondrial-based toxicity. Laura Anaissi-Afonso a,b, Sandra Oramas-Royo c,, Jessel Ayra-Plasencia a,b, Patricia Martín- Rodríguez d, Jonay García-Luis a, Isabel Lorenzo-Castrillejo a, Leandro Fernández-Pérez d, Ana Estévez-Braun c,*, Félix Machín a,* a Unidad de Investigación, Hospital Universitario Nuestra Señora de La Candelaria, 38010, Tenerife, Spain. b Universidad de La Laguna, Tenerife, Spain. c Instituto Universitario de Bio-Orgánica (CIBICAN), Departamento de Química Orgánica, Universidad de La Laguna, 38206, Spain. d Instituto Universitario de Investigaciones Biomédicas y Sanitarias (IUIBS), Departamento de Ciencias Clínicas, BIOPHARM, Universidad de Las Palmas de Gran Canaria, Spain. These authors equally contributed to this work. * Co-corresponding authors: fmachin@funcanis.es (Tel ); aestebra@ull.es (Tel ) Keywords: lawsone, juglone, lapachol, β-lapachone, antitumor, antibacterial, Saccharomyces cerevisiae, oxidative stress, mitochondria. SUPPORTING INFORMATION 1

2 Supplementary Figures Figure S1. Halo inhibition assays for a 1 µl drop of DMSO 100 %. (A) Halo assay in the reference strain BY4741 (WT), isogenic oxidative stress response mutant yap1δ, DNA damage response double mutant rad9δ rad52δ and spindle checkpoint mutant mad2δ. (B) Halo of growth inhibition for BY4741 and yap1δ under normoxic and hypoxic conditions (photos taken after 24 h and 72 h, respectively). In addition, normoxic inhibition halos for rho0 derivatives of both strains are shown in the 3 rd and 6 th photos (72 h). (C) Halo of growth inhibition for BY4741 and yap1δ growing on YPGly (non-fermentable glycerol as the sole carbon source). The whole Petri dish is shown, although the DMSO drop was placed right at the center. The bright white spots are non-yeast contaminations that do not affect the overall result. 2

3 Figure S2. Time course of BY4741 (WT) halo inhibition assay for lawsone, lapachol and derivatives thereof. Photos were taken at the indicated times after initiation of the assay. Brightness and contrast of original photos have been normalized to those of 72 h. 3

4 Figure S3. Time course of BY4741 (WT) halo inhibition assay for juglone and derivatives thereof. Photos were taken at the indicated times after initiation of the assay. Brightness and contrast of original photos have been normalized to those of 72 h. Figure S4. Time course of BY4741 (WT) halo inhibition assay for juglone and derivatives thereof. Photos were taken at the indicated times after initiation of the assay. Brightness and contrast of original photos have been normalized to those of 72 h. 4

5 Figure S5. Halo inhibition assays for the lot6δ strain. (A) Lawsone, lapachol and derivatives thereof. (B) Juglone and derivatives thereof. (C) β-lapachone and derivatives thereof. 5

6 Figure S6. Example of the two phenotipic tests used to check the rho0 derivatives. (A) Suspected rho0 colonies from FM630 (yap1δ) were analysed for inability to grow in YPGly (rho phenotype) through a spot assay. These colonies were obtained after ~20 generations of continuous growth in liquid YPD supplemented with 20 µg/ml of ethidium bromide. (B) Asynchronously growing cells from these colonies were stained with DAPI to check for the absence of mitochondrial DNA (rho0 genotype). Mitochondrial DNA appears as weak cytoplasmic DAPI-stained dots/chains, as pointed by the white arrows in the FM630 DAPI images. The parental rho+ strain (FM630) was included as a positive control in both assays. 6

7 Experiment #1 Experiment #2 Experiment # Plate # DM DM DM Plate # DM DM DM Figure S7. Representative pictures of the original halo inhibition assays for BY4741 in normoxic YPD. Three independent experiments were performed. The positions of the compounds used in this work are indicated in yellow (DM for DMSO). The selected naphthoquinones were part of a larger drug screening, which included non-quinoid compounds whose spots/halos are not numbered here. Photos were taken at 24 h. 7

8 Table S1. In silico chemical properties of natural NQs and derivatives thereof. Molinspiration Cheminformatics a ChemAxon b Ionized (%) at ph Compound MW milogp TPSA HAB HDR RB pka Lawsone (1) (2) (3) (4) (5) (6) (7) (8) (9) Lapachol (10) Juglone (11) (12) (13) (14) (15) (16) (17) (18) β-lapachone (19) (20) (21) a Data obtained from MW, molecular weight; milogp, logp according to Molinspiration modelling; TPSA, total polar surface area; HAB, H acceptor bonds; HDG, H donors groups; RB, rotable bonds. b Data obtained with Marvin Suite 18.3 ( Percentages of the ionized form of each molecule at relevant phs are included: extracellular ph in non-buffered YPD media (ph 6.5); cytosolic ph (7.2) and ph in the mitochondrial lumen (7.5). 8

9 Table S2. Yeast strains used in this study. Name/ Collection # Relevant genotype Origin BY4741 MATa his3 1 leu2 0 met15 0 ura3 0 Euroscarf Y03576 BY4741; rad9::kanmx4 Euroscarf Y01392 BY4741; mad2::kanmx4 Euroscarf Y00569 BY4741; yap1::kanmx4 Euroscarf Y01566 BY4741; lot6::kanmx4 Euroscarf FM773 BY4741; rho0 This work FM1329 BY4741; rad9::kanmx4 Δrad52::natMX This work FM2077 BY4741; lot6::kanmx4 rho0 This work FM2269 BY4741; mad2::kanmx4 rho0 This work FM2270 BY4741; yap1::kanmx4 rho0 This work FM2271 BY4741; rad9::kanmx4 Δrad52::natMX rho0 This work 9

10 EXTENDED MATERIAL AND METHODS. Biology. Construction of the rad9::kanmx4 Δrad52::natMX double mutant (strain FM1329). The natmx selection cassette (resistance to nourseotricin, NAT) was amplified by PCR using primers carrying 45-nucleotide tails homologous to the beginning and the end of the RAD52 gene, respectively. The DNA template for the natmx cassette was the pag25 plasmid. 1 The primers were RAD52-A1 (5 - AAGAACTGCTGAAGGTTCTGGTGGCTTTGGTGTGTTGTTGCAGCTGAAGCTTCGTAC GC-3 ) and RAD52-A2 (5 - GATGCAAATTTTTTATTTGTTTCGGCCAGGAAGCGTTTCAGCATAGGCCACTAGTGG ATCTG-3 ). PCR conditions were those recommended for this cassette. 1 The PCR product was then used to transform competent cells of the Euroscarf s rad9::kanmx4 strain through the lithium acetate method. 2 Transformants were selected in YPD plates supplemented with 100 µg/ml of ClonNAT (Werner bioagents, Germany). Positive clones were genotypically confirmed after checking correct deletion of the RAD52 locus by PCR (forward primer: 5 - TAAGAAAAGACGAAAAATATAG-3 ; reverse primer: 5 - AAGTAAATATTAATACGACAC-3 ) followed by BbsI (NEB, #R0539S) restriction pattern. In addition, these clones were phenotypically checked for hypersensitivity to % (v/v) of the DNA damaging agent methyl methanesulfonate (MMS; Sigma-Aldrich, #129925). Halo inhibition assay. Strains were first grown on YPD agar plates under normoxia for 24 h and then harvested and replated as a lawn (~ 50 cells per mm 2 ; i.e., 100 µl of a 0.1 OD 600 suspension) on the corresponding 90 mm plate, either fresh YPD or YPGly. After a brief incubation (~10 ) to eliminate the excess of liquid on the plate surface, 10 nmol of each quinone (1 µl drop from 10 mm stocks in DMSO) were pipetted onto defined plate locations (up to 25 per plate, fewer if the inhibition halos overlapped). Plates were then incubated at 30 ºC under either normoxia or hypoxia ( -O 2 ). Hypoxia was achieved by putting the plate into a sealed bag where a chemical reaction was triggered to quickly remove O 2 from the air (Anaerocult TM A mini kit from Merck, # ). YPD plates under normoxia were incubated for 3 d, taking pictures every 24 h. YPD plates under hypoxia were incubated for 3 d before breaking the bag and taking a single picture. YPGly plates were incubated for 6 d, taking pictures every 72 h. Both partial and total inhibition halos (diameter in mm) were estimated by eye. (1) Goldstein, a L., and McCusker, J. H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, (2) Smith, J. S., and Burke, D. J. (2014) Yeast Genetics: Methods and Protocols (Smith, J. S., and Burke, D. J., Eds.). Springer New York, New York, NY. 10

11 Chemistry. General methods: The reactions under microwave irradiation were performed in a Biotage Initiator 2.5 using standard sealed microwave glass vials and a normal absorption level. Solvents were dried immediately prior to use by distillation from a drying agent. Commercial reagents were purchased from Sigma-Aldrich Chemical Co. and Alfa Aesar and were used without further purification. Analytical thin-layer chromatography was performed on Polygram SIL G/UV254 silica gel plates and chromatograms were visualized under UV light (254 and 360 nm). Purification on column chromatography was carried out on Merck silica gel 60 ( mm) with the indicated solvent mixtures. Pre-coated TLC plates SIL G-100 UV254 (Macherey Nagel) and SILICA GEL GF plates (1000 μm, Analtech) were used for preparative-tlc purification. 1 H and 13 C NMR spectra were acquired in CDCl (0.03% v/v TMS), DMSO-d 3 6 or (CD 3 ) 2 CO at room temperature using Bruker Avance instruments (500 or 600 MHz for 1 H NMR and 125 or 150 MHz for 13 C NMR). Chemical shifts are reported in parts per million (ppm) from tetramethylsilane and referenced to the residual solvent peak (CDCl 3 : δ 7.26 for 1 H NMR, δ 77.00/77.16 for 13 C NMR; DMSO-d 6 : δ 2.50 for 1 H NMR, δ for 13 C NMR; (CD 3 ) 2 CO: δ 2.09 for 1 H NMR, δ for 13 C NMR). For 1 H NMR data are reported in the following manner: chemical shift (integration, multiplicity, coupling constant where applicable). The following abbreviations are used: s (singlet), br (broad), d (doublet), t (triplet), dd (double doublet), td (triple doublet), m (multiplet). Coupling constants (J) are given in Hertz (Hz). 13 C NMR were obtained with complete proton decoupling. MS and HRMS data were recorded in a VG Micromass ZAB-2F spectrometer. Synthesis of 2-methoxy-1,4-naphthoquinone (2) mg (0.11 mmol) of lawsone were dissolved in 3 ml of MeOH and then 0.1 ml of HCl were added. After refluxing the reaction mixture for 24 hours, the solvent was removed under reduced pressure and the resulting crude was purified by preparative-tlc using DCM as eluent, yielding 2-methoxy-1,4-naphthoquinone was isolated as a yellow solid (3.6 mg, 17%). 1 H NMR (, CDCl 3, 400 MHz): 8.08 (1H, d, J=7.3 Hz, H-5/H-8); 8.03 (1H, d, J=7.3 Hz, H-5/H-8); 7.69 (2H, m, H-6+H-7); 6.14 (1H, s, H-3); 3.88 (3H, s, OMe). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-2); (CH, C-6); (CH, C-7); (C, C- 4a); (C, C-8a); (CH, C-5); (CH, C-8); (CH, C-3); 56.5 (CH 3, OMe). 11

12 EIMS m/z (%): 188 ([M] +, 100); 173 (39); 159 (26); 158 (43); 130 (14); 102 (42); 89 (44); 76 (31); 63 (11); 51 (12). HREIMS: (calcd for C 11 H 8 O 3, [M] ). FT-IR (ATR) (cm -1 ): 3053, 2926, 2854, 1681, 1646, 1337, 1245, 1196, 1042, 1021, 867. Synthesis of 2-ethoxy-1,4-naphthoquinone (3). To a solution of 50.0 mg (0.29 mmol) of lawsone in 4 ml of EtOH, 0.1 ml of HCl were added. After refluxing the reaction mixture for 24 hours, the solvent was removed under reduced pressure and the resulting crude was purified by preparative-tlc using DCM/MeOH (3%) as eluent. 2-ethoxy-1,4-naphthoquinone was isolated as a yellow solid (49.9 mg, 86%). 1 H NMR (, CDCl 3, 400 MHz): 8.08 (1H, dd, J=7.1, 1.5 Hz, H-5); 8.03 (1H, dd, J=7.1, 1.5 Hz, H-8); 7.67 (2H, m, H-6+H-7); 6.11 (1H, s, H-3); 4.07 (2H, q, J=7.0 Hz, H-1 ); 1.50 (3H, t, J=7.0 Hz, H-2 ). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-2); (CH, C-6); (CH, C-7); (C, C-4a); (C, C-8a); (CH, C-5); (CH, C- 8); (CH, C-3); 65.4 (CH 2, C-1 ); 14.0 (CH 3, C-2 ). EIMS m/z (%): 202 ([M] +, 100); 187 (15); 173 (26); 158 (88); 146 (40); 130 (22); 105 (69); 102 (31); 89 (48); 76 (30); 63 (10). HREIMS: (calcd for C 12 H 10 O 3, [M] ). FT-IR (ATR) (cm -1 ): 1684, 1658, 1595, 1247, 1210, 1048, 784. Synthesis of 2-isopropoxy-1,4-naphthoquinone (4). To a solution of 50.0 mg (0.29 mmol) of lawsone in 4 ml of 2-propanol, 0.1 ml of HCl (5%) were added. After refluxing the reaction mixture for 24 hours, the solvent was removed under reduced pressure and the resulting crude was purified by preparative-tlc using DCM as eluent, yielding 2-isopropoxy-1,4-naphthoquinone as a yellow solid (46.3 mg, 75%). 1 H NMR (, CDCl 3, 400 MHz): 8.06 (1H, dd, J=7.5, 1.0 Hz, H-5); 8.02 (1H, dd, J=7.5, 1.0 Hz, H-8); 7.67 (2H, m, H-6+H-7); 6.10 (1H, s, H-3); 4.54 (1H, q, J=6.0 Hz, H-1 ); 1.42 (6H, d, J=6.2 Hz, H-2 +H-3 ). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-2); (CH, C-6); (CH, C-7); (C, C-4a); (C, C-C-8a); (CH, C-5/C- 8); (CH, C-5/C-8); (CH, C-3); 72.5 (CH, C-1 ); 21.2 (2xCH 3, C-2 +C-3 ). EIMS m/z (%): 216 ([M] +, 76); 175 (39); 173 (92); 158 (23); 146 (100); 105 (68); 101 (11); 89 (36); 76 12

13 (22). HREIMS: (calcd for C 12 H 10 O 3, [M] ). FT-IR (ATR) (cm -1 ): 1676, 1650, 1604, 1333, 1303, 1244, 1104, 1001, 889. Synthesis of 2-allyloxy-1,4-naphthoquinone (5) mg (0.58 mmol) of K 2 CO 3 were added to a solution of mg (0.58 mmol) of lawsone in 5 ml of DMF and it was left stirring for 15 minutes at room temperature. Then, a solution of allyl bromide (124.4 µl, 1.44 mmol) in DMF (0.25 ml) was added dropwise. After 15 minutes the reaction mixture was filtered and the solvent was removed under reduced pressure. The oily residue was purified by column chromatography (SiO 2 ; hexanes/ethyl acetate (100:0-0:100)) to afford 5 (81.6 mg, 66%) as a yellow solid. 1 H NMR (, CDCl 3, 400 MHz): 8.12 (1H, dd, J=12.9, 1.6 Hz, H-8); 8.07 (1H, dd, J=12.9, 1.6 Hz, H-5); 7.76 (1H, td, J=7.4, 1.4 Hz, H- 6); 7.71 (1H, d, J=7.4, 1.4 Hz, H-7); 6.16 (1H, s, H-3); 6.05 (1H, m, H-2 ); 5.48 (1H, dd, J=17.2, 1.0 Hz, H-3 a); 5.40 (1H, dd, J=10.5, Hz, H-3 b); 4.61 (2H, d, J=5.5 Hz, H-1 ). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-2); (CH, C-6); (CH, C-7); (C, C-4a); (C, C-8a); (CH, C-2 ); (CH, C-5); (CH, C-8); (CH 2, C-3 ); (CH, C-3); 70.1 (CH 2, C-1 ). EIMS m/z (%): 214 ([M] +, 26); 197 (27); 186 (100); 173 (23); 158 (46); 130 (14); 102 (23); 89 (78); 76 (21); 63 (9). HREIMS: (calcd for C 13 H 10 O 3, [M] ). FT-IR (ATR) (cm -1 ): 3056, 2928, 1681, 1650, 1600, 1334, 1247, 998, 934. Synthesis of 2-propargyloxy-1,4-naphthoquinone (6). A mixture of mg (0.58 mmol) of lawsone and 79.5 mg (0.58 mmoles) of K 2 CO 3 in DMF (4 ml) was stirred at room temperature for 15 minutes. Then 61.5 µl (0.69 mmol) of propargyl bromide were added, and the reaction mixture was left stirring for 72 hours. After this time, it was filtered, the solvent was removed under reduced pressure and the residue was purified by column chromatography (SiO 2 and DCM as eluent) to afford 6 as a yellow solid (107.8 mg, 88%). 1 H NMR (, CDCl 3, 400 MHz): 8.14 (1H, d, J=6.9 Hz, H-5); 8.07 (1H, d, J=6.9 Hz, H-8); 7.74 (2H, m, H-6+H-7); 6.36 (1H, s, H-3); 4.81 (2H, s, H-1 ); 2.65 (1H, s, H-3 ). 13 C NMR (, CDCl 3,

14 MHz): (C, C-4); (C, C-1); (C, C-2); (CH, C-6); (CH, C-7); (C, C-4a); (C, C-8a); (CH, C-5); (CH, C-8); (CH, C-3); 78.3 (CH, C- 3 ); 75.6 (C, C-2 ); 56.9 (CH 2, C-1 ). EIMS m/z (%): 212 ([M] +, 99); 211 (100); 184 (26); 180 (25); 168 (25); 158 (31); 130 (35); 128 (45); 118 (28); 89 (68); 76 (28); 68 (88). HREIMS: (calcd for C 13 H 8 O 3, [M] ). FT-IR (ATR) (cm -1 ): 3249, 3054, 2131, 1678, 1648, 1336, 1245, 1014, 876. Synthesis of 2-acryloyloxy-1,4-naphthoquinone (7). A mixture of lawsone (100.0 mg, 0.58 mmol) and mg (1.44 mmol) of K 2 CO 3 in dried DCM (4 ml) was stirred at room temperature. After 15 minutes 93.0 µl (1.15 mmol) of acryloyl chloride were added and the reaction mixture was left stirring for 48 hours. Then it was filtered, the solvent was removed under reduced pressure and the residue was purified by column chromatography (SiO 2 and n-hexane/ethyl acetate 40% as eluent) to afford 7 as an orange amorphous solid 95.4 mg (73%). 1 H NMR (, CDCl 3, 400 MHz): 8.07 (2H, m, H-5+H-8); 7.74 (2H, m, H-6+H-7); 6.81 (1H, s, H-3); 6.65 (1H, d, J=17.3 Hz, H-3 a); 6.32 (2H, dd, J=17.3, 10,5 Hz, H-2 ); 6.11 (1H, t, J=10.5 Hz, H- 7 3 b). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C- 1); (C, C-1 ); (C, C-2); (CH 2, C-3 ); (CH, C-6); (CH, C-7); (C, C-4a); (C, C-8a); (CH, C-5); (CH, C-8); (CH, C-2 ); (CH, C- 3). EIMS m/z (%): 228 ([M] +, 10); 200 (15); 174 (58); 146 (16); 105 (40); 89 (32); 76 (16); 55 (100). HREIMS: (calcd for C 13 H 8 O 4, [M] ). FT-IR (ATR) (cm -1 ): 3350, 1753, 1664, 1591, 1295, 1129, 968. Synthesis of 2-hydroxy-3-iodo-1,4-naphthoquinone (8) mg (0.14 mmol) of NIS were added to a solution of 25.0 mg (0.14 mmol) of lawsone in 4 ml of DCM. After refluxing for 20 minutes, the reaction mixture was cooled and washed with cool water (3 x 5 ml). Then the combined organic phases were dried over anhydrous MgSO 4 and the solvent was removed under reduced pressure, obtaining, in this way, compound 8 as a yellow solid (43.3 mg, 100%), without further purification. 1 H NMR (, CDCl 3, 400 MHz): 8.21 (1H, dd, J=7.2, 1.5 Hz, H-8); 8.15 (1H, dd, J=7.2, 1.5 Hz, H-5); 8.08 (1H, brs, OH); 7.78 (1H, td, J=7.4,

15 Hz, H-6); 7.74 (1H, td, J=7.4, 1.4 Hz, H-7). 13 C NMR (, CDCl 3, 100 MHz): (C, C-1); (C, C-4); (C, C-2); (CH, C-7); (CH, C-6); (C, C-4a); (C, C-8a); (CH, C-5); (CH, C-8); 92.1 (C, C-3). EIMS m/z (%): 299 ([M] +, 100); 271 (17); 174 (16); 173 (23); 105 (15); 89 (15); 77 (9). HREIMS: (calcd for C 10 H 5 O 3 I, [M] ). FT-IR (ATR) (cm -1 ): 3147, 2928, 1673, 1624, 1583, 1299, 1258, 1214, 1122, 1000, 861. Synthesis of 2-allyl-3-hydroxy-1,4-naphthoquinone (9) though Claisen rearrangement of 5. In a microwave glass vial 19.7 mg (0.092 mmol) of 2-allyloxy-1,4-naphthoquinone were dissolved in 1 ml of 1,4-dioxane and the reaction mixture was heated in a microwave reactor at 180ºC for 15 minutes. Then, after removing the solvent under reduced pressure, compound 9 was obtained as a yellow solid in a quantitative manner and without further purification. 1 H NMR (, CDCl 3, 400 MHz): 8.13 (1H, d, J=7.6 Hz, H-8); 8.09 (1H, d, J=7.5 Hz, H-5); 7.77 (1H, t, J=7.4 Hz, H-6/H-7); 7.69 (1H, d, J=7.4 Hz, H-6/H-7); 5.91 (1H, m, H-2 ); 5.17 (1H, d, J=17.0 Hz, H-3 a); 5.06 (1H, d, J=9.9 Hz, H-3 b); 3.37 (2H, d, J=6.2 Hz, H-1 ). 13 C NMR (, 9 CDCl 3, 100 MHz): (C, C-1); (C, C-4); (C, C-3); (CH, C-7); (CH, C-2 ); (CH, C-6); (C, C-4a); (C, C-8a); (CH, C-8); (CH, C-5); (C, C-2); (CH 2, C-3 ); 27.6 (CH 2, C-1 ). EIMS m/z (%): 214 ([M] +, 100); 199 (39); 186 (27); 171 (34); 168 (21); 158 (25); 139 (15); 129 (24); 115 (21); 105 (16); 86 (27); 77(20); 58 (32). HREIMS: (calcd for C 13 H 10 O 3, [M] ). Synthesis of 5-methoxy-1,4-naphthoquinone (12) mg (1.27 mmol) of silver (I) oxide and 78.8 µl (1.27 mmol) of methyl iodide were added to a solution of mg (0.58 mmol) of juglone in 5 ml of DCM. The reaction mixture was refluxed in the dark for 72 hours. Then, the suspension was filtered through a celite plug and the solvent eliminated under reduced pressure. Purification of the crude preparative- TLC using n-hexane/ethyl acetate (50%) yielded 3.5 mg of compound 12 as a yellow solid (105.5 mg, 98%). 15

16 1 H NMR (, CDCl 3, 400 MHz): 7.69 (2H, m, H-7+H-8); 7.30 (1H, d, J=8.1 Hz H-6); 6.86 (2H, s, H-2+H-3); 4.00 (3H, s, OMe). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-5); (CH, C-3); (CH, C-7); (CH, C-2); (C, C-8a); (C, C-4a); (CH, C- 8); (CH, C-6); 56.6 (CH 3, OMe). EIMS m/z (%): 188 ([M] +, 100); 170 (14); 159 (23); 130 (28); 104 (35); 102 (32); 76 (28); 63 (12). HREIMS: (calcd for C 11 H 8 O 3, [M] ). FT-IR (ATR) (cm -1 ): 2933, 2896, 2839, 1653, 1582, 1469, 1297, 1272, 1167, 1019, 855. Synthesis of 5-allyloxy-1,4-naphthoquinone (13) and 5-allyloxy-6-allyl-1,4-naphthoquinone (14). Allyl bromide (0.21 ml, 1.73 mmol) and Ag 2 O (334.8 mg, 1.45 mmoles) were added to a mixture of mg (0.58 mmol) of juglone in 3 ml of DCM and the reaction mixture was refluxed for 48 hours. After that time, 5 ml of water were added and it was extracted with DCM (3 x 5 ml) and dried over MgSO 4. Purification of the residue by column chromatography with n-hexane/ethyl acetate (30%) as eluents yielded compound 13 (94.3 mg, 76%) and 12.9 mg (9%) of 5-allyloxy-6-allyl-1,4-naphthoquinone (14), as yellow solids. 1 H NMR (, CDCl 3, 400 MHz): 7.69 (1H, d, J=7.6 Hz, H-8); 7.63 (1H, t, J=7.7 Hz, H-7); 7.27 (1H, d, J=8.3 Hz, H-6); 6.85 (2H, dd, J=10.2, 1.4 Hz, H-2+H-3); 6.08 (1H, m, H-2 ); 5.65 (1H, d, J=17.2 Hz, H-3 a); 5.36 (1H, d, J=10.7 Hz, H-3 b); 4.71 (2H, d, J=2.8 Hz, H-1 ). 13 C NMR (, 13 CDCl 3, 100 MHz): (C, C-4); (C, C-4); (C, C-5); (CH, C-2); (CH, C-3); (CH, C-7); (C, C-8a); (CH, C-2 ); (C, C- 4a); (CH, C-6); (CH, C-8); (CH 2, C-3 ); 69.8 (CH 2, C-1 ). EIMS m/z (%): 214 ([M] +, 100); 213 (35); 199 (21); 186 (70); 170 (83); 157 (11); 130 (78); 118 (27); 102 (31); 89 (31); 63 (38). HREIMS: (calcd for C 13 H 10 O 3, [M] ). FT-IR (ATR) (cm -1 ): 2995, 2868, 1656, 1585, 1457, 1303, 1254, 1170, 1087, 1008, 934, 858, H NMR (, CDCl 3, 400 MHz): 7.87 (1H, d, J=8.0 Hz, H-8); 7.60 (1H, d, J=7.8 Hz, H-7); 6.87 (2H, m, H-2+H-3); 6.19 (1H, m, H-2 ); 5.96 (1H, m, H-2 ); 5.43 (1H, d, J=17.2 Hz, H-3 a); 5.31 (1H, d, J=10.6 Hz, H-3 b); 5.12 (2H, m, H-3 a+h-3 b); 4.47 (2H, d, J=5.7 Hz, H-1 ); (2H, d, J=6.5 Hz, C-1 ). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-5); (C, C-6); (CH, C-2); (CH, C-3); (CH, C-7); (CH, C-2 ); (CH, C-2 ); (C, C-8a); (C, C-4a);

17 (CH, C-8); (CH 2, C-3 ); (CH 2, C-3 ); 75.5 (CH 2, C-1 ); 34.4 (CH 2, C-1 ). EIMS m/z (%): 254 ([M] +, 22); 253 (100); 239 (18); 225 (17); 213 (54); 200 (54); 186 (42); 170 (15); 141 (18); 115 (25); 77 (13); 66 (61); 55 (11). HREIMS: (calcd for C 16 H 14 O 3, [M] ). FT-IR (ATR) (cm -1 ): 3079, 2918, 1662, 1580, 1413, 1292, 1250, 1073, 994, 920, 841. Synthesis of 5-acryloyloxy-1,4-naphthoquinone (15). A mixture of juglone (100.0 mg, 0.58 mmol) and mg (2.88 mmol) of K 2 CO 3 in dry DCM (5 ml) was stirred at room temperature. After 15 minutes µl (2.30 mmol) of acryloyl chloride were added and the reaction mixture was refluxed for 96 hours. Then the solvent was removed under reduced pressure and the residue was purified by preparative-tlc using n-hexane/ethyl acetate (30%) to yield 73.2 mg (56%) of compound 15 as an orange solid. 1 H NMR (, CDCl 3, 400 MHz): 8.03 (1H, dd, J=7.7, 1.0 Hz, H-8); 7.75 (1H, t, J=7.9 Hz, H-7); 7.41 (1H, dd, J=8.1, 1.0 Hz, H-6); 6.91 (1H, d, J=10.3 Hz, H-3); 6.82 (1H, d, J=10.3 Hz, H-2); 6.65 (1H, dd, J=17.3, 10.4 Hz, H-3 a); 6.42 (1H, dd, J=17.3, 10.4 Hz, H-2 ); 6.10 (1H, dd, 15 J=10.4, 1.0 Hz, H-3 b). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-1 ); (C, C-5); (CH, C-2); (CH, C-3); (CH, C-7); (C, C-8a); (CH 2, C-3 ); (CH, C-6); (CH, C-2 ); (CH, C-8); (C, C-4a). EIMS m/z (%): 228 ([M] +, 26); 199 (10); 174 (22); 63 (6); 55 (100). HREIMS: (calcd for C 13 H 8 O 4, [M] ). FT-IR (ATR) (cm -1 ): 3320, 3074, 2965, 1740, 1658, 1404, 1294, Synthesis of 3-amino-5-hydroxy-1,4-naphthoquinone (16). After acidifying (ph 4) with 10% HCl a solution of mg (3.45 mmol) of sodium azide (NaN 3 ) in 1.6 ml of H 2 O, a solution of mg (0.58 mmol) of juglone in 4.8 ml of MeOH was added. The reaction mixture was stirred at room temperature under an argon atmosphere for 29 hours. Then, water (5 ml) was added and it was extracted with AcOEt (3 x 10 ml). The combined organic layers were dried over MgSO 4, filtered and the solvent removed under reduced pressure. The oily residue was purified with silica gel column chromatography and DCM/MeOH (5%) as eluent, yielding 84.7 mg of 3-amino-5-hydroxy-1,4-naphthoquinone 16 (78%) as a red solid and 6.6 mg (6%) of 2-amino-5-hydroxy-1,4-naphthoquinone (17). 17

18 1 H NMR (, CDCl 3, 400 MHz): 11.5 (1H, s, OH); 7.62 (2H, m, H-7+H-8); 7.16 (1H, brs, H-6); 5.97 (1H, s, H-2); 5.14 (2H, brs, NH 2 ). 1 H NMR (, DMSO-d 6, 400 MHz): (1H, s, OH); 7.68 (1H, t, J=8.0 Hz, H-7); 7.41 (1H, d, J=7.4 Hz, H-8); 7.18 (1H, d, J=8.6 Hz, H-6); 5.75 (1H, s, H- 2). EIMS m/z (%): 189 ([M] +, 100); 162 (38); 161 (17); 133 (11); 120 (25); 119 (16); 91 (13); 77 (4); 68 (10); 63 (8). HREIMS: (calcd for C 10 H 7 NO 3, [M] ). FT-IR (ATR) (cm -1 ): 3399, 3246, 3195, 1583, 1544, 1455, 1377, 1377, 1317, 1262, 1216, 1151, 1064, 931, 827, 677. Synthesis of 2-amino-5-hydroxy-1,4-naphthoquinone (17) ml (0.86 mmol) of Et 3 N were added to a solution of mg (1.01 mmol) of O- benzylhydroxylamine hydrochloride in 3 ml of EtOH at 5ºC. Then a solution of mg (0.58 mmol) of juglone in EtOH (4 ml) was added dropwise. After 4 hours the solvent was removed under reduced pressure and the residue was purified by column chromatography (SiO 2 ; hexanes/ethyl acetate (100:0-0:100)) to afford 28.9 mg (27%) of 2-amino-5-hydroxy-1,4- naftoquinona as the only product. 1 H NMR (, (CD 3 ) 2 CO, 400 MHz): (1H, s, OH); 7.60 (2H, m, H- 7+H-8); 7.27 (1H, d, J=7.7 Hz, H-6); 6.91 (2H, brs, NH 2 ); 5.94 (1H, s, H- 3). 1 H NMR (, DMSO-d 6, 400 MHz): (1H, s, OH); 7.60 (1H, t, J=7.9 Hz, H-7); 7.52 (1H, da, J=7.0 Hz, H-8); 7.29 (1H, d, J=8.3 Hz, H- 6); 5.78 (1H, s, H-3). 13 C NMR (, (CD 3 ) 2 CO, 100 MHz): (C, C-4); (C, C-1); (C, C-5); (C, C-2); (CH, C-7); (C, C-8a); (CH, C-6); (CH, C-8); (C, C-4a); (CH, C-3). 13 C NMR (, DMSO-d 6, 100 MHz): (C, C-4); (C, C-1); (C, C-5); (C, C-2); (CH, C-7); (C, C-8a); (CH, C-6); (CH, C-8); (C, C-4a); (CH, C-3). EIMS m/z (%): 189 ([M] +, 100); 162 (27); 161 (13); 133 (11); 120 (17); 119 (15); 92 (13); 77 (5); 76 (36); 68 (8); 63 (8). HREIMS: (calcd for C 10 H 7 NO 3, [M] ). FT-IR (ATR) (cm -1 ): 3432, 3156, 2819, 2754, 1690, 1627, 1546, 1456, 1353, 1259, 1154, 914, 817, 768, 667. Synthesis of 2-bromo-8-hydroxy-1,4-naphthoquinone (18) µl (1.15 mmol) of Br 2 were added to a solution of mg (1.15 mmol) of juglone in 3 ml of AcOH at 4ºC. The reaction mixture was left stirring in the darkness for 15 minutes and then it was poured into ice and the resulting solid was filtered, washed with cold 18

19 water and treated with 5 ml de EtOH and refluxed for 10 minutes. The solvent was removed under reduced pressure and the residue was purified by column chromatography (SiO 2 ; DCM as eluent) to afford 18 (187.7 mg, 65%) as an orange solid. 1 H NMR (, CDCl 3, 400 MHz): 11.7 (1H, s, OH); 7.66 (2H, m, H-5+H-6); 7.50 (1H, s, H-3); 7.30 (1H, d, J=7.9 Hz, H-7). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-8); (CH, C-3); (C, C-2); (CH, C-6); (C, C-4a); (CH, C-7); (CH, C-5); (C, C-8a). EIMS m/z (%): 253 ([M] +, 99); 251 ([M] +, 100); 223 (8); 172 (68); 145 (66); 92 (12); 89 (23); 63 (25); 52 (12). HREIMS: (calcd for C 10 H 5 O 79 3 Br, [M] ) and (calcd for C 10 H 5 O 81 3 Br, [M] ). FT-IR (ATR) (cm -1 ): 3295, 3057, 2930, 1649, 1627, 1583, 1449, 1358, 1265, 1208, 1167, 1083, 949, 821. Synthesis of 3-bromo- -lapachone (20) ml (1.65 mmol) of lutidine and µl (1.49 mmol) of acetyl chloride were added to a solution of mg (0.83 mmol) of lapachol in 2 ml of DCM at 0ºC. Then 5 ml of water were added, and it was extracted with DCM (3 x 5 ml). The combined organic layers were dried over anhydrous MgSO 4, filtered and the residue was purified by column chromatography (SiO 2 ; hexanes/ethyl acetate 9:1) to afford 2-acetyl-lapachol (174.9 mg, 75%) as a yellow solid and -deshydrolapachone (7.5 mg, 4%) µl (0.61 mmol) de Br 2 were added to a solution of 2-acetyl-lapachol (172.5 mg, 0.61 mmol) in 8 ml of dried DCM. The reaction mixture was stirred at room temperature under an argon atmosphere for 15 minutes. After removing the solvent, the residue was purified by column chromatography (SiO 2 ; hexanes/ethyl acetate 40%) yielding 20 as an orange solid (132.0 mg, 68%). 1 H NMR (, CDCl 3, 400 MHz): 8.03 (2H, m, H-5+H-8); 7.67 (2H, m, H-6+H-7); 5.05 (1H, bt, J=7.2 Hz, H-2 ); 3.24 (2H, d, J=7.2 Hz, H- 1 ); 2.36 (3H, s, Me-2 ); 1.73 (3H, s, Me); 1.64 (3H, s, Me). 13 C NMR (, CDCl 3, 100 MHz): (C, C-4); (C, C-1); (C, C-1 ); (C, C-2); (C, C-3 ); (C, C-4a/C-8a); (CH, C-6); (CH, C-7); (C, C-4a/C-8a); (C, C-3); (CH, C-5); (CH, C-8); (CH 2, C- 2 ); 25.7 (CH 3, Me); 28.6 (CH 2, C-1 ); 20.3 (CH 3, Me-2 ); 17.9 (CH 3, Me). EIMS m/z (%): 284 ([M] +, 6); 241 (61); 227 (24); 226 (100); 198 (8); 105 (4); 76 (5). HREIMS: (calcd for 19

20 C 17 H 16 O 4, [M] ). FT-IR-ATR (cm -1 ): 2984, 2922, 1763, 1675, 1640, 1593, 1372, 1332, 1291, 1195, 1172, 1048, 1071, 946, H NMR (, CDCl 3, 400 MHz): 7.99 (1H, d, J=7.6 Hz, H-7); 7.77 (1H, d, J=7.6 Hz, H-10); 7.63 (1H, t, J=7.6 Hz, H-9); 7.49 (1H, t, J=7.6 Hz, H- 8); 4.21 (1H, m, H-3); 3.16 (1H, dd, J=18.0, 5.3 Hz, H-4 A ); 2.93 (1H, dd, J=18.0, 7.4 Hz, H-4 B ); 1.59 (3H, s, Me); 1.56 (3H, s, Me). 13 C NMR (, 20 CDCl 3, 100 MHz): (C, C-6); (C, C-5); (C, C-10b); (CH, C-8); (C, C-10a); (CH, C-9); (C, C-6a); (CH, C-7); (CH, C-10); (C, C-4a); 81.1 (C, C-2); 50.0 (CH, C-3); 27.9 (CH 2, C-4); 26.1 (CH 3, Me); 23.6 (CH 3, Me). EIMS m/z (%): 322 ([M] +, 27); 320 ([M] +, 24); 241 (74); 213 (100); 197 (14); 172 (42); 159 (86); 105 (14); 76 (24); 69 (24); 55 (18). HREIMS: (calcd for C 11 H 13 O 79 3 Br, [M] ) and (calcd for C 11 H 13 O 81 3 Br, [M] ). FT-IR (ATR) (cm -1 ): 3073, 2989, 2941, 1693, 1605, 1573, 1451, 1374, 1291, 1231, 1116, 987, 929, 857, 774, 658. Synthesis of 3-iodo- -lapachone (21) mg (0.83 mmol) of NIS were added to a solution of mg (0.41 mmol) of lapachol in 3 ml of dried DCM. After stirring the reaction mixture at room temperature for 24 hours, the solvent was removed under reduced pressure and the residue was purified by preparative-tlc using n-hexane/ethyl acetate (40%) to yield 3.5 mg of compound 21 (88.5 mg, 58%) and 32.4 mg (21%) of 3-iodo- -lapachone as yellow amorphous solids. 1 H NMR (, CDCl 3, 400 MHz): 8.10 (1H, d, J=7.5 Hz, H-7); 7.78 (1H, d, 21 J=7.5 Hz, H-10); 7.65 (1H, t, J=7.5 Hz, H-9); 7.51 (1H, t, J=7.5 Hz, H-8); 4.33 (1H, dd, J=8.0, 5.7 Hz, H-3); 3.28 (1H, dd, J=18.1, 5.4 Hz, H-4 A ); 3.08 (1H, dd, J=18.1, 8.4 Hz, H-4 B ); 1.67 (3H, s, Me); 1.61 (3H, s, Me). 13 C NMR (, CDCl 3, 100 MHz): (C, C-6); (C, C-5); (C, C-10b); (CH, C-8); (C, C-6a); (CH, C-9); (C, C-10a); (CH, C-7); (CH, C-10); (C, C-4a); 81.4 (C, C-2); 30.4 (CH 2, C-4); 28.1 (CH, C-3); 26.8 (CH 3, Me); 25.3 (CH 3, Me). EIMS m/z (%): 367 ([M] +, 17); 241 (100); 227 (38); 213 (34); 199 (17); 173 (24); 173 (24); 159 (15); 115 (13); 104 (13); 76 (17); 69 (50); 55 (9). HREIMS: (calcd for para C 15 H 13 O 3 I, [M] ). FT-IR (ATR) (cm -1 ): 3068, 2984, 2936, 1692, 1650, 1603, 1573, 1372, 1290, 1089, 985, 927, 848,

21 1 H NMR (, CDCl 3, 400 MHz): 8.08 (2H, m, H-7+H-8); 7.69 (2H, m, H-6+H-9); 4.31 (1H, dd, J=8.2, 5.6 Hz, H-3); 3.39 (1H, dd, J=19.1, 5.4 Hz, H-4a); 3.20 (1H, dd, J=19.1, 5.4 Hz, H-4b); 1.67 (3H, s, Me); 1.60 (3H, s, Me). 13 C NMR (, CDCl 3, 100 MHz): (C, C-5); (C, C-10); (C, C-10a); (CH, C-7); (CH, C-8); (C, C-9a); (C, C-5a); (CH, C-6); (CH, C-9); (C, C-4a); 80.5 (C, C-2); 31.0 (CH 2, C-4); 27.8 (C, C- 3); 26.7 (CH 3, Me); 24.8 (CH 3, Me). EIMS m/z (%): 367 ([M] +, 21); 241 (100); 213 (41); 199 (55); 173 (31); 115 (16); 104 (20); 89 (15); 76 (24); 69 (52); 55 (10). HREIMS: (calcd for C 15 H 13 O 3 I, [M] ). FT-IR (ATR) (cm -1 ): 2989, 2939, 1672, 1649, 1616, 1337, 1262, 1203, 1111, 1070, 953,

22 1 H-NMR AND 13 C-NMR SPECTRA OF COMPOUNDS 2-9, AND H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 2. 22

23 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 3. 23

24 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 4. 24

25 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 5. 25

26 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 6. 26

27 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 7. 27

28 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 8. 28

29 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound 9. 29

30 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound

31 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound

32 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound

33 1 H NMR (CDCl 3, 400 MHz) of compound C NMR (CDCl 3, 100 MHz) of compound

34 1 H NMR (DMSO-d 6, 400 MHz) of compound H NMR (DMSO-d 6, 400 MHz) of compound

35 13 C NMR (DMSO-d 6, 100 MHz) of compound H NMR (CDCl 3, 400 MHz) of compound

36 13 C NMR (CDCl 3, 100 MHz) of compound H NMR (CDCl 3, 400 MHz) of compound

37 13 C NMR (CDCl 3, 100 MHz) of compound H NMR (CDCl 3, 400 MHz) of compound

38 13 C NMR (CDCl 3, 100 MHz) of compound