Supplementary Information

Transcription

1 Supplementary Information Chemical Synthesis of Natural Polyubiquitin Chains through Auxiliary-mediated Ligation of an Expressed Ubiquitin Isomer Ling Xu, a,b Jian-Feng Huang, b Chen-Chen Chen, b Qian Qu, a Jing Shi, b* Man Pan, c Yi-Ming Li a* a School of Biological and Medical Engineering, Hefei University of Technology, Hefei, Anhui , China. b Department of Chemistry, School of Life Science, University of Science and Technology of China; Hefei , China.. c Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, USA. These authors contributed equally to this work. Table of Contents 1. General Information. S2 a. Materials b. HPLC and FPLC c. Molecular biochemistry d. Mass spectrometry e. Protein Expression and Purification 2. Experimental Section.. S5 a. Chemical synthesis b. Construction of Ub/K48Proc-Lys, Ub/K6Proc-Lys, Ub(1-G76C)/K48Proc-Lys, Ub(1-G76C)/K6Proc-Lys plasmid c. Protein expression d. Synthesis of building block of 5, 12 and proximal Ub of 9, 13 e. Sequential hydrazide-based auxiliary-mediated NCL to afford 11, 14, 15 f. Protein folding and purification. g. Circular dichroism spectra determination h. Deubiquitinase (DUB) assays i. MS/MS identification of specific isopeptide bond 3. Experimental figures.. S9 S1

2 General Information a. Materials 4-mercaptophenylacetic acid (MPAA), triisopropylsilane (TIPS) were purchased from Ouhe Technology (Beijing, China). Tris(2-chloroethyl) phosphate (TCEP), 2-mercaptoethanesulfonic (Mesna), N,N-Diisopropylethylamine (DIEA) was purchased from Aladdin (Shanghai, China). Acetonitrile (HPLC grade) was purchased from J. T. Baker (Phillipsburg, NJ, USA). N ε -propargyloxycarbonyl chlorine (Proc-Cl) was purchased from Sigma-Aldrich (USA). Na 2 HPO 4 12H 2 O, guanidine hydrochloride (Gn HCl), were purchased from Sinopharm Chemical Reagent. Ttrifluoroacetic acid (TFA) (HPLC grade), di-tert-butyl dicarbonate ((BOC) 2 O), Tetrakis(triphenylphosphine)platinum(0) (Pd(PPh 3 ) 4 ), Phenylsilane(PhSiH 3 ) were purchased from J&K Scientific (Beijing, China). NaNO 2 and NaCl were purchased from Beijing Chemical Works (Beijing, China). Glycyl 1-(2,4-dimethoxyphenyl)-2-mercaptoethyl auxiliary was purchased from Nantong PPTIDE Biotech ltd (Jiangsu, China). b. HPLC and FPLC Analytical RP-HPLC (SHIMADZU, Prominence LC-20AT) was used with an analytical column (Grace Vydac C18, 250 mm 4.6 mm, 5 µm particle size, flow rate 1.0 ml/min, rt). Semi-preparative HPLC (SHIMADZU, Prominence LC-20AT) was also used with a semi-preparative column (Grace Vydac C18, mm, 10 µm particle size -and welch xb-c18, 250 mm 21.2 mm, 5 µm particle size, flow rate 4.0 ml/min). Analytical and semi-preparative injections were both monitored at 214 nm and 254 nm. Folding proteins were purified by GE Healthcare (AKTA purifier 10 UPC-F920) instrument with Superdex 75 column. The products were monitored at 280 nm. c. Molecular biology and biochemistry Primers were bought from Biomed Biotech (Beijing) Co., Ltd. All enzymes were bought from New England Biolabs (NEB). Bacterial cells were grown in LB agar medium (Sigma) or LB (Luria-Bertani) medium. For SDS-PAGE, samples were loaded onto 12% SDS-PAGE gels, which were electrophoresed for 20 min at 80 V and 60 min at 160 V. All pictures of protein gels were taken on ChemDocXRS+ (Bio-Rad). S2

3 d. Mass Spectrometry Agilent 6210 Time of Flight Mass Spectrometer was used for high-resolution ESI mass spectra. Bruker Daltonics Data Analysis 3.0 workstation was used for normal ESI mass spectra. e. Protein Expression and Purification Protein were incorporated in modified pet22b vectors, and expressed in E. coli. BL21 (DE3) cells. Then the cells were collected with a centrifugal machine bought from Sigma and lysed by sonication. S3

4 1. Experimental Section a. Chemical synthesis H-Lys(Proc)-OH compound was prepared from the Boc-Lys-OH, which was transferred into the Boc-Lys(Proc)-OH with a reaction with Proc-Cl. Then Boc group was removed with 50% TFA in DCM to give H-Lys(Proc)-OH. The synthesis procedures were totally the same with Chen s approach. 1 b. Construction of Ub/K48Proc-Lys, Ub/K6Proc-Lys, Ub(1-G76C)/K48Proc-Lys, Ub(1-G76C)/K6Proc-Lys plasmid The pet22b vector was used for Ub gene insert. Subsequently, various mutants were cloned by using primers according to the following table. Primer Sequence, 5-3 UbG76C F UbG76C R Ub-K48TAG/ UbG76C-K48TAG F Ub-K48TAG/ UbG76C-K48TAG R Ub-K6TAG/ UbG76C-K6TAG F Ub-K6TAG/ UbG76C-K6TAG R TTAAGACTGCGTGGGTGCTAACTCGAG GCACCCACGCAGTCTTAAGACCAGATG GTCTGATCTTTGCGGGCTAGCAGCTGGAAG CTAGCCCGCAAAGATCAGACGCTGCTGATC ATATGCAGATCTTCGTCTAGACGTTAACCGG CTAGACGAAGATCTGCATATGTATATCTCCT c. Protein expression The plasmids UbG76C was transformed into pet22b vectors and expressed in E. coli. BL21 (DE3) cells. The cells grew at 37 until OD600 reached to 0.8, then 0.5 mm isopropyl β-d-1-thiogalactopyranoside (IPTG) was added to induce the cells at 16 for 18 hours. The cells were harvested by centrifugation at 8000 rpm for 5 min and then lysed by sonication with a lysis buffer (50 mm Tris ph7.4). To precipitate non-ubiquitin proteins, 70% perchloric acid was added to the lysate with 0.1% final volume concentration. After centrifugation at rpm for 0.5 h, supernatant was dialyzed to the buffer (50 mm Tris, ph7.4) overnight to remove HClO 4. After dialysis, the supernatant was centrifuged with 3 KDa milipore until the final concentration 20 mg/ml. The final step was N-S acyl transfer. According to the final volume of the supernatant, S4

5 100 mg MesNa, 5 mg TCEP and 50 mg hydrazine hydrochloride were added to the solution per 1 ml. When ph was adjusted to 7, the color of the solution would present slightly pink, and the reaction vessel was sealed with N 2 protection. Put the reaction vessel in Shaker with 150 rpm at 50, and the reaction completed within 42 h. At last, the solution was filtrated, followed by HPLC purification to afford protein Ub(1-75)-NHNH 2 (30 mg/l). Each Ub-K48TAG, UbG76C-K48, Ub-K6TAG, UbG76C-K6TAG plasmid and PylRS- Pyl trna CUA synthetase plasmid were co-transformed into E. coli BL21 (DE3) cells respectively. The cells grew in LB media supplied with two antibiotics (ampicillin 50 mg/l and chloramphenicol 34 mg/l) at 37 until OD600 reached to 0.6. Proc-Lys was added to the LB media with the final concentration of 1-2 mm. After 30 min, 1 mm IPTG and 0.2% arabinose were used to induce the cells at 30 for 16 h. The cells and following lysates were disposed as depicted above in Ub(1-75)-NHNH 2 before separation. Protein Ub/K48Proc-Lys (5 mg/l) and Ub/K6Proc-Lys (5 mg/l) were purified by HPLC. Ub(1-G76C)/K6Proc-Lys and Ub(1-G76C)/K48Proc-Lys were concentrated with 3 KDa milipore to final concentration 20 mg/ml. After concentration, the N-S acyl transfer manipulation was proceeded as depicted in Ub(1-75)-NHNH 2 above. But the reaction temperature and time were changed to 37, 54 h. Finally, the solutions were filtrated, followed by HPLC purification to afford protein Ub(1-75)-NHNH 2 /K6Proc-Lys (3 mg/l)and Ub(1-75)-NHNH 2 /K48Proc-Lys (3 mg/l). d. Synthesis of building block of 5, 12 and proximal Ub of 9, 13 The preparations of protein 5, 12, 9, 13 were quite similar. They were originated from expressed Ub(1-75)-NHNH 2 /K48Proc-Lys, Ub(1-75)-NHNH 2 /K6Proc-Lys, Ub/K48Proc-Lys and Ub/K6Proc-Lys respectively. Here take protein 5 as an example for specific illustration. 8.8 mg Ub(1-75)-NHNH 2 /K48Proc-Lys was dissolved in 300 µl dimethyl sulfoxide (DMSO), followed by 3.6 µl (Boc) 2 O and 1.6 µl DIEA addition. After 1 h at room temperature, the reaction mixture was precipitated with cold diethyl ether. The precipitate was dissolved in 300 µl DMSO containing mg Pd(PPh 3 ) 4 and 1.23 µl of PhSiH 3. After 1 h, ether was added to the reaction to precipitate the product. The precipitate was then dissolved in 300 µl DMSO again, with addition of 6 µl DIEA and 2.6 mg Glycyl 1-(2,4-dimethoxyphenyl)-2-mercaptoethyl auxiliary. After 45 min, cold ether was added to precipitate the product. Finally, the new precipitate was S5

6 treated with 500 µl of TFA/TIS/H 2 O (95/2.5/2.5) to remove the Boc group for 20 min. After once more cold ether precipitation, the crude product was purified by HPLC to give 4.0 mg 5. 4 mg 5 was dissolved in 500 µl reaction solution (containing 6 M Gn HCl, 0.2 M Na 2 HPO 4, 0.4 M MeONH 2, ph 4). After 4 h at 37, protein 5 was obtained after HPLC purification with 3.2 mg (36% overall yield for the five steps). Other three protein 12, 9, 13 were also obtained in similar process with isolation yields 38%, 42%, 41%. e. Sequential hydrazide-based auxiliary-mediated NCL to afford 11, 14, 15 The preparations of protein 11, 14, 15 were very similar to each other. Taking 11 as an example, lyophilized 11.3 mg protein 2 was dissolved in 900 µl buffer (containing 6 M Gn-HCl, 200 mm Na 2 HPO 4, ph 3). After precooled and stirred in an ice-salt bath (-10 ), 10 eq of NaNO 2 was added to the reaction buffer for 30 min. Then 60 eq of MPAA was added directly and ph was adjusted to 5.0 to convert the peptide acyl azide into peptide thioester in 5 min. Finally, 8.8 mg protein 5 was added to the reaction mixture and adjusted the ph to 6.9 at 37. The reaction mixture was stirred about 4 h to afford 6 mg protein 6 (separated by HPLC, isolated yield of 34%). To remove the auxiliary, 6 mg 6 was treated with 400 µl TFA/TIS/H 2 O (95/2.5/2.5) cocktail for 60 min. Cold ether was added to precipitate the product. After purification, 4.5 mg of 7 was obtained with an isolated yield of 75%. Several times of NCL reactions between protein 2 and 5 to give enough amount protein 7 to process on next step NCL. 7 (9 mg) was dissolved in 200 µl buffer (containing 6 M Gn-HCl, 200 mm Na 2 HPO 4, ph 3). 10 eq of NaNO 2 was added to the reaction buffer for 30 min After precooled and stirred in an ice-salt bath (-10 ), then 100 eq of MPAA was added, adjusted the ph to 5.0 to convert the peptide acyl azide into peptide thioester in 5min. Finally, 1.8 mg protein 5 was added to the reaction mixture and adjusted the ph to 6.9 at 37. The reaction mixture was stirred about 5 h to afford approximate 0.6 mg protein 10 (separated by HPLC, isolated yield of 10.5%). To remove the auxiliary, 0.6 mg 10 was treated with 50µL TFA/TIS/H 2 O (95/2.5/2.5) cocktail for 60 min. Cold ether was added to precipitate the product. After purification, approximate 0.5 mg of 11 was obtained. The overall isolation yield is 2.27%. After several rounds of NCL, we eventually obtained protein 11 on a multi-milligram scale. The isolated yield of 14 and 15 were 1.8% and 2.1% respectively. S6

7 f. Protein folding and purification. Synthetic proteins were dissolved in a small amount of buffer (containing 6 M Gn-HCl, 200 mm Na 2 HPO 4, ph 7.4) with a final concentration of 2 mg/ml, and then transferred to a 3 KDa dialysis membrane against ubiquitin folding buffer (20 mm Tris, 150 mm NaCl, ph 7.5) with gradually decreased gradient concentration of urea (8 M to 0 M). Then diluted protein solution was concentrated using an Amicon Ultra-15 3 kda MWCO centrifugal device (Millipore) and further purified by gel filtration (Superdex 75). g. Circular dichroism spectra determination CD spectrometer was recorded at 298 K on a Pistar π-180 CD with a wavelength from 240 nm to 190 nm. The concentrations of 11, 14, 15, mono-ub, and di-ub were mg/mL. Three times were repeated for each experiment. h. Deubiquitinase (DUB) assays 35 um (18 ug) tri-ub protein 11 and 15 were incubated respectively in 20 ul buffer (containing 50 mm Tris, 150 mm NaCl; 5 mm TCEP; ph 7.5). 2 um OTUB1 was added to both of the buffer. The hydrolysis was monitored by SDS-PAGE every ten minutes for protein 11 and a half hour for 15. Three times were repeated for each experiment. i. MS/MS identification of specific isopeptide bond For LC-MS/MS analysis of different linkage site, the peptide fragments were isolated by eluting with a 60 min gradient elution with a flow rate of 0.25 µl/min using a Thermo-Dionex Ultimate 3000 HPLC system, which was linked to the Thermo LTQ-Orbitrap Velos pro mass spectrometer directly. The MS/MS spectra was searched against Ub database in Proteome Discoverer (Vesion 1.4) searching algorithm. S7

8 2. Experimental figures m Figure S1 HPLC and ESI-MS characterization of protein 1 and 2 in N-S acyl transfer process (oxidative form of 2 is labeled with a star). Figure S2 HPLC and ESI-MS characterization of protein 3 and 4 in N-S acyl transfer process (oxidative form of 4 is labeled with a star). S8

9 min Figure S3 HPLC and ESI-MS characterization of protein Ub(1-G76C)/K6Proc-Lys and Ub(1-75)-NHNH 2 /K6Proc-Lys in N-S acyl transfer process (oxidative form of Ub(1-75)-NHNH 2 /K6Proc-Lys is labeled with a star). Figure S4 HPLC and ESI-MS characterization of all the intermediates during synthesis of Ub isomer 5(De-Proc form of 4 is labeled with 4*). S9

10 Calculated: Observed: protein 9' 9' Calculated: Observed: protein 9 Figure S5 HPLC and ESI-MS characterization of all the intermediates during synthesis of Ub 9. Figure S6 Size exclusion chromatography (SEC) (λ = 280 nm, Superdex 75 column (10/300 GL)) analysis of K 48 -Ub S10

11 Ub(1-75)-NHNH 2 /K6Proc-Lys Calculated: Observed: De-ProcofUb(1-75)-NHNH 2 /K6Proc-Lys Ub(1-75)-NHNH 2 /K6(a'G) protein 12 Figure S7 HPLC analysis of all the intermediates during synthesis of Ub isomer 12 and ESI-MS characterization of Figure S8 HPLC and ESI-MS characterization of all the intermediates during synthesis of Ub 13. S11

12 0h 4h 0h 5h Retention time(min) Figure S9 HPLC traces for K48-Ub 3 NCL ligation. 2 is MPAA thioester of 2, and left side * label is the hydrolysis product of 2. 7 is MPAA thioester of 7, and right side * label is the hydrolysis product of 7. Figure S10 ESI mass spectra of protein 6 and 7 S12

13 Figure S11 FPLC purification and MS characterization of protein MW= MW= ESI-MS (m/z) ESI-MS (m/z) Figure S12 HPLC traces (214 nm) and ESI-MS of 14 (calculated: Da, observed: Da) and 15 (calculated: Da, observed: Da). y 2 b 2 y10y9y8y7 MQIFVK*TLTGK b2b3b4 b5 y 3 b 3 y 4 y5 y4y3y2 b7b8b9b10 b 5 y 5 b 4 y 8 14 y 7 b 8 y 8 b 7 y 9 b 8 b 9 b 10 y m/z y14 y12y11 LIFAGK*QLEDGRTLSDYNIQK b5 y 5 y7 b6 b8 b9b10 b12b14b15b16 y5 y4 y3 y y 4 3 b 5 b 6 y 7 b 8 b 9 b 10 y 11 b 16 y 12 b b 14 b15 12 y m/z MQIFVK*TLTGK y10y9y8y7 y5 y4 y3y2 b2b3b4 b5 b7 b8b9b10 b 2 y b 3 3 y b 5 5 y b 4 2 y 4 y 8 y 9 y 8 y 7 b 8 b b 9 8 b 7 b 10 y m/z Figure S13 MS/MS spectra of the products 14 and S13

14 A B Figure S14 SDS-PAGE (A: monoub, diub, triub 11) (B: triub 14, 15) Figure S15 Deubiquitinase (DUB) assays of K48-Ub 3 S14

15 Figure S16 Deubiquitinase (DUB) assays of mix triub Ub 6,48 Figure S17 MS/MS of K6-Ub 3 S15

16 Figure S18 MS/MS of OTUB1 hydrolysed K6-Ub 2 Figure S19 MS/MS of mix triub K 6,48 Reference: 1. J. Li, P R. Chen, Nat. Chem. Biol., 2016, 12, S16