Title of project: Master s candidate: Y Owusu. Collaborator: Ikbale El Ayachi. Master s Committee: M Donaldson, J Lou, F Garcia-Godoy, G T-J Huang

Transcription

1 Title of project: Isolation and Characterization of Periodontal Ligament Stem Cells of Human Deciduous Teeth Master s candidate: Y Owusu Collaborator: Ikbale El Ayachi Master s Committee: M Donaldson, J Lou, F Garcia-Godoy, G T-J Huang

2 ABSTRACT Background: Human periodontal ligament stem cells (PDLSCs) in the permanent dentition have been isolated and characterized. Studies have shown that PDLSCs are capable of differentiating into cementoblast-like or osteoblast-like cells producing cementum and bone like structures in vivo. While there is an abundance of literature on the isolation and characterization of PDLSCs of permanent teeth; literature on the isolation and characterization of human deciduous periodontal ligament stem cells (DePDLSCs) is limited. Purpose: The purpose of this study was to isolate and characterize stem cell self-renewal properties of periodontal ligament stem cells of human deciduous teeth (DePDLSCs), and to investigate their multiple differentiation capacity in osteo/odontogenesis, adipogenesis and chondrogenesis. DePDLSCs were then compared to better characterized cells; Deciduous Dental Pulp Stem Cells, (DeDPSCs), Adult Dental Pulp Stem Cells (DPSCs) and Adult Periodontal Ligament Stem Cells (PDLSCs), the latter two are cells from permanent teeth. Methods: Isolated DePDLSCs were observed for their colony unit formation fibroblastic (CFU-F) using standard cell culture techniques. The expression of stemness associated genes was examined using qpcr. Specific differentiation induction media was used to test the ability of DePDLSCs to undergo osteo/odontogenic, adipogenic, and chondrogenic differentiation in vitro. The specificity of each cell lineage differentiation was determined by chemical analysis. All analyses mentioned above for DePDLSCs were compared to DeDPSCs, DPSCs, and PDLSCs. Results: DePDLSCs reveal fibroblast-like colony formation in vitro. DePDLSCs show no statistically significant difference in colony forming abilities at high or low densities, when compared to other cell types, DeDPSCs, DPSCs and PDLSCs. However there was a statistically significant difference between colony formation within passages for all cell types, DePDLSCs, PDLSCs, DeDPSCs and DPSCs. DePDLSCs show no statistically significant difference in colony size compared to other cell types. On the contrary, there was a statistically significant difference in colony size within passages for each cell type DePDLSCs, PDLSCs, DPSCs but not DeDPSCs. DePDLSCs, PDLSCs, DeDPSCs, and DPSCs all show some expression of the stemness associated gene OCT 4. DePDLSCs, PDLSCs, and DPSCs but not DeDPSCs show expression of the stemness associated gene NANOG. There was no expression of the stemness associated gene SOX-2 by any cell type. All cell types showed positive alizarin red staining after induction in osteogenic medium for 5 weeks. Only PDLSCs showed adiopogenic-like cells when in induced in adiopogenic medium for weeks. All cell types show positive alcian blue this is an indication of the presence of proteoglycans which is indicative of the extracellular matrix created by chondrocytes. DePDLSCs and PDLSCs appeared to show stronger alcian blue stain then the other two cell types.

3 Conclusion: DePDLSCs show self-renewal ability and they have the potential to differentiate into osteoblasts-like, and chondrocytes-like cells, comparable with previously characterized dental stem cells, DeDPSCs, DPSCs and PDLSCs. DePDLSCs however, showed no capacity to differentiate into adiopogenic-like cells. The deciduous PDLSCs population possess similar characteristics from that of permanent teeth and can be utilized for potential therapeutic procedures related to PDL and other tissue regeneration.

4 INTRODUCTION Stem cells are cells that can differentiate into other cell types; they are self-renewing, meaning that they can maintain their population by cell division. Advances in research have made it possible to grow lines of human and animal stems cells. This is of considerable importance because it has great therapeutic potentials; as isolated stem cells can be used to generate cells and tissues that can be used to replace diseased, defective and damaged ones. There are two populations of stem cells that have been implicated in tooth formation; Epithelial stem cells (EpSC) and Mesenchymal stem cells (MSCs). EpSCs give rise to ameloblast, while MSCs give rise to odontoblast, cemetoblasts, osteoblasts and fibroblasts of the pulp and periodontium (Bluteau et al., 2012). The information available on dental epithelial stem cells in humans is lacking, and this is likely due to the absence of dental epithelial stem cells populations in erupted teeth (Bluteau et al., 2012). Although information is lacking on EpSC, there has been significant progress and research on MSCs. Consequently, MSCs show promise for therapeutic applications more than other types of stem cells (Shalu et al., 2012). Mesenchymal stem cells (MSCs) are a type of adult stem cell that contributes to the regeneration of mesenchymal tissues such as bone, cartilage and adipose tissue (Pittenger et al., 1999). It has been shown that several types of mesenchymal like stem cells are present in human dental tissues. These dental stem cells have been termed mesenchymal like because of their capacity for self renewal and multilineage differentiation (Huang et al., 2009). Currently, there are five different kinds of dental stem cells that have been isolated and characterized; Dental pulp stem cells (DPSCs), stem cells from exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSCs), stem cells from apical papilla (SCAP) and dental follicle progenitor cells (DFPCs), (Huang et al., 2009). Dental pulp stem cells (DPSCs) are stem cells isolated from human pulp tissue and were the first dental stems cells to be isolated (Gronthos et al., 2000). In vitro DPSC can be induced to differentiate into cells of odontoblastic phenotype (Tsukamoto et al., 1992, About et al., 2000, Couble et al., 2000). Studies have also shown that if seeded onto dentin, DPSCs convert into odontoblast-like cells with polarized cell body and a cell process extending into the existing dentinal tubules (Huang et al., 2006, Huang et al., 2009). Transplanted Ex vivo studies have shown that DPSCs mixed with hydroxyapatite/tricalcium phosphate (HA/TCP) form ectopic pulpdentin like tissue complexes in immunocompromised mice (Gronthos et al., 2000; Batouli et al., 2003). DPSCs not only have dentinogenic potential, but also possess adipogenic and neurogenic differentiation capacities (Gronthos et al., 2002).

5 Stem cells from human exfoliated deciduous teeth (SHED), are known for their high proliferative abilities. SHEDs have the capacity to proliferate faster with greater population density than both dental pulp stem cells and bone marrow mesenchymal stem cells (BMMSCs) (Huang et. al, 2009). Like DPSCs described above, SHEDs have the capacity to undergo osteogenic and adipogenic differentiation (Miura et al., 2003). However, unlike DPSCs, SHEDs are unable to regenerate a complete dentin-pulp complex in vivo (Miura et al., 2003). At best, SHEDs when transplanted into immunocompromised mice can generate human specific odontoblast-like cells. (Miura et al., 2003). SHEDs are mostly known for their osteogenic abilities. Stem Cells from Apical Papilla (SCAP) are cells isolated from the apical papilla of developing permanent teeth. SCAPs show odontogenic, and adopogenic differentiation potential. Studies show that SCAP may be the primary source of primary odontoblasts that are responsible for the formation of root dentin (Huang, 2008). Dental Follicle Precursor Cells (DFPCs) have been isolated from human dental follicles of third molars (Morsczeck et. al 2005). In vitro these cells demonstrate osteogenic differentiation. However transplantation of DFPCs showed no dentin, cementum or bone formation (Morsczeck et al., al 2005, 2008). Periodontal Ligament Stem Cells (PDLSCs) show the ability to differentiate into cementum forming cells and bone forming cells (MuCulloch and Bordin, 1991; Isaka et al., 2001). Transplanted human PDLSCs have been shown to form a thin layer of cementum-like tissues and a dense type I collagen positive PDL like structure in transplants (Huang et. al 2009). These cells have been isolated from both permanent and deciduous teeth, although very little research has been completed on PDLSCs of deciduous teeth. While there is an abundance of literature on the isolation and characterization of dental pulp stem cells (DPSCs), stem cells from exfoliated deciduous teeth (SHED), stem cells from apical papilla (SCAP), dental follicle progenitor cells (DFPCs) and the periodontal ligament stem cells of permanent teeth; information is lacking on the isolation and characterization of periodontal ligament stem cells of deciduous teeth. The purpose of this study was to isolate and characterize periodontal ligament stem cells of primary teeth.

6 MATERIALS AND METHODS Tissue Isolation and culture The study was approved by the Institutional Review Board of the University of Tennessee Health Science Center, (IRB #: XM). Human deciduous teeth were collected from 18 donors, 2-9 years of age undergoing extraction at UTHSC in Department of Pediatric Dentistry and Community Oral Health. These teeth were immediately placed in culture medium containing 3X antibiotic in preparation for tissue isolation. Tissue isolation was performed the same day of tooth extraction. Tissues were carefully separated from the teeth into culture dishes and cut into small fragments (1 X 1 X 1 mm). The tissues were then washed with medium containing 3X concentrated antibiotic. Tissue digestion was performed using the collagenase/dispase method. Isolated fragments were digested in a solution of 3 mg/ml collagenase type I (Worthington Biochem, Freehold, NJ) and 4 mg/ml dispase (Roche Molecular Biochemical) for 1 hour at 37 C. Cells were cultured in a medium containing alpha modification Eagle s medium (Gibco/BRL), 10-15% FBS, 100 µm L-ascorbic acid 2-phosphate, 2mM L-glutamine, 100 U/ml penicillin-g, 100 µg/ml streptomycin, 0.25 µg/ml fungizone (Gemini Bio-Products, Woodland, Calif., USA). Cells were incubated at 37 C in 5% CO2.Cells were observed for 2-3 weeks for cell attachment. Once cells became confluent they were frozen using freezing medium 10% DMSO and 90% FBS and stored at -80 C. CFU-F assay Isolated DePDLSCs, DeDPSCs, PDLSCs, DPSCs were seeded at low density starting at passage 0 to allow discernible cell colonies to form. Normally MSCs form CFU-F until approximately passage 5. The more self-renewal ability, the greater the cells capability of forming CFU-F at higher passages. To assess colony forming formation, single cell suspensions (100 cells and 200 cells) at passages 2, 6, and 10 were separately seeded into 6 well culture dishes. After 10 days of culture, the cells were fixed and stained with 0.5% crystal violet in methanol. Aggregates of 50 or more cells were scored as colonies. Colonies were further classified into low, medium or high density and a quantitative analysis of colonies formed was completed using ImageJ cell counter software. ImageJ is a public domain, java-based image processing program, developed at the National Institutes of Health (Bethseda, MD, USA) and released in 1997 (Schneider et al., 2012). Detection of the expression of stemness associated genes Using qpcr the stemness of DePDLSCs, PDLSCs, DeDPSCs and DPSCs was assess by their ability to express stemness associated genes NANOG, OCT4 and SOX2. Gene expression was detected using qcpcr with the following procedure.

7 The cells were harvested and total RNA isolated using RNeasy mini kit (Qiagen). First strand cdna from purified RNA was generated using the SuperScripttm III First-Strand synthesis system for qpcr (Invitrogen). The sequence of primers is listed in Table I. The iq SYBR green (BioRad) method was used as described by the manufacturer. Briefly, 1 μl of cdna template was mixed to 12.5 μl iq SYBR Green PCR Master Mix, 0.5 μl forward primer (10 μm), 0.5 μl forward primer (10 μm) and sterile distilled water to a final volume of 24 μl. Twenty-three μl of the reaction mixture was placed in each wells of a 96-well plate, covered and centrifuged at 1000 rpm for 5 minutes at 4oC. The plate was then placed in a 7500 Real Time PCR System (AB Applied Biosystems) and run for 40 cycles with the following thermal cycling conditions: 50 C for 2 minutes, 95 C for 10 min, 95 C for 15 seconds, C (depending on the primers used) for 30 seconds, 60 C for 1 min, cycled to step 3 for 40 cycles. A relative quantitative analysis method was performed to quantify the relative gene expression compared to the level of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Odonto-/Osteogenic differentiation DePDLSCs, DeDPSCs, PDLSCs, DPSCs were seeded separately at a density of 1X10 4 cells per well in a 48 well plate, grown to approximately 70% confluence and incubated in differentiation medium containing 10 nm dexamethasone, 10 mm β-glycerophosphate, 50 µg/ml ascorbate phosphate, 10 nm 1, 25 dihydroxyvitamin D3 and 10% FBS for approximately 5 weeks. This differentiation medium has been used for osteogenic studies for osteoblast differentiation. PDLSCs may undergo both odontogenic (cementogenic) and/or osteogenic differentiation, therefore, we designated the term odonto-/osteogenic differentiation medium. Cultures were then fixed in 60% isopropanol, and mineralization of extracellular matrix stained with 1% Alizarin red S (ARS) (Huang et al., 2010). For quantitative analysis, the culture wells were washed three times with dh2o, fixed with 70% ice cold ethanol and the ARS stain dissolved in cetylpyridinium chloride (CPC) buffer (10% CPC (w/v) in 10mM Sodium Phosphate Buffer, Sigma) for 1 hour. Three aliquots in 200 µl of ARS/CPC extract from each well were then be transferred to a 96-well reading plate and quantified by absorbance measurement at 550 nm by a spectrophotometer (Bio-Rad). Adipogenic differentiation DePDLSCs, DeDPSCs, PDLSCs, DPSCs were seeded separately at a density of 1.2X10 5 cells per well in a 24 well plate, grown to subconfluence and incubated in adipogenic medium containing 1 µm dexamethasone, 1 µg/ml insulin, 0.5 mm 3-isobutyl-1-methylxantine (IBMX) and 10% FBS for 3 weeks. Cells were then fixed in 10% formalin for 60 min, washed with 70% ethanol, and

8 lipid droplets were stained with 2% (w/v) Oil Red O reagent for 5 min and washed with water (Huang et al., 2010). Chondrogenic differentiation 96-microwell polypropylene plates (Nunc, Roskilde, Denmark) were seeded with 2 x 10 5 cells per well, and cell pellets formed by centrifugation at 1,100 rpm for 6 minutes. The pellet cultures were treated for 3 weeks with chondrogenic medium, consisting of high-glucose DMEM supplemented with 100 nmol/l dexamethasone, 50 μg/ml ascorbic acid-2-phosphate, 100 μg/ml sodium pyruvate, 40 μg/ml l-proline, 10 ng/ml recombinant human transforming growth factorβ3 (TGF-β3; R&D Systems, Minneapolis, MN), and 50 mg/ml ITS-premix stock (BD Biosciences). The cell pellets were harvested for Alcian blue nuclear fast red staining. Chondrogenic cell pellets were fixed in 4% buffered paraformaldehyde, rinsed with PBS, serially dehydrated, paraffin embedded, and sectioned at 10-μm thickness. Sections were stained with Alcian blue (ph 2.5) to detect sulfated proteoglycans and with Nuclear Fast Red to visualize nuclei. Statistical Analysis Descriptive statistics such as mean, standard deviation, median, minimum, and maximum for colony forming units and colony forming units according to size were reported for each cell type, passage, and seeded number. We used the average of data from 8 replicates (2 donors and 4 wells each). Linear mixed-effect modeling was used to explore the association between fixed factors (cell type, passage and seeded number) and colony forming units. Donors and wells were considered random factors in the model. Residual plots (residual scatter plot, QQ plots, residual histogram) and fit statistics (AIC BIC etc.) were used to verify the validity of the modeling. To check the association between fixed factors (cell type, passage and seeded number) and colony forming size, mixed-effect logistic regression was used. An effect with a p-value less than 0.1 was considered statistically significant in the model. Both main effects and cross effects were tested. All analysis was performed using SAS 9.3.

9 Lineage Gene GenBank Accession Primer ( ) Sense Antisense Product size Pluripotencyassociated NANOG NM_ TAATAACCTTGGCTGCCGTCTCTG GCCTCCCAATCCCAAACAATACGA 150 OCT4 NM_ CAGTGCCCGAAACCCACAC 161 GGAGACCCAGCAGCCTCAAA SOX2 NM_ ACACCAATCCCATCCACACT 224 GCAAACTTCCTGCAAAGCTC House keeping GAPDH NM_ CAAGGCTGAGAACGGGAAGC 194 AGGGGGCAGAGATGATGACC Table I. Primers used for qpcr NANOG: Named after the mythological Celtic land of the ever- young Tir nan O (Calloni et al, 2013), OCT 4: Octamer binding transcription factor (OCT)-4, SOX2: also called SRY (sex determining region Y)-box 2, GAPDH: Glyceraldehyde 3-phosphate dehydrogenase

10 RESULTS Characterization of DePDLSCs Human DePDLSCs were capable of forming adherent clonogenic cell clusters of fibroblast like cells (Figure, 1) with a typical fibroblastic spindle shape similar to PDLSCs, DeDPSCs and DPSCs. Formation of CFU-Fs DePDLSCs isolated from the PDL tissue of deciduous teeth showed typical fibroblastic appearance in cultures and form separate colonies (Figure 1). The colonies took 1-2 days to appear and the colonies continued to increase in size over time. CFU-Fs also formed after cells were passaged in low densities. CFU analysis To determine whether CFU forming ability is different between DePDLSCs and other dental stem cells, we compared the following for the CFU analysis: i) the difference in colony forming units between cell type, DePDLSCs, PDLSCs, DeDPSCs, and DPSCs ii) the difference in the number of colony forming units within passages of each individual cell P2, P6 and P10 iii) the difference of colony size between cell types DePDLSCs, PDLSCs, DeDPSCs, and DPSCs and iv) the difference in colony size between passages (P2, P6, P10) of each individual cell type. When examining each individual cell, we found that there is a statistically significant difference in the number of colony forming units within passages for each cell type (Table 5, Figure 2). The analysis of passages (P2, P6, P10) in each individual cell type for colony forming size revealed that for the four cell types (DeDPSCs, DPSCs, PDLSCs, DePDLSCs), passage is a statistically significant factor for colony size in DPSCs, PDLSCs and DePDLSCs, but not in DeDPSCs (Table 8, Figures 3 and 4). Pluripotent gene expression OCT 4, NANOG and SOX 2 are a homoeodomain transcription factor involved in the self-renewal of undifferentiated embryonic stem cells. OCT4 gene expression DePDSCs showed decreased gene expression from passage 2 to passage 10, while DPSCs increased gene expression from passage 2 to passage 10 (Figure 6, A). When comparing the pluripotent gene expression of OCT4 in DePDLSCs to that of PDLSCs there was no significance difference in gene expression (Figure 6, C). NANOG gene expression

11 DeDPSC showed no expression of NANOG, while DPSCs showed increase gene expression from P2 to P10 (Figure 6, B). There was no significant difference in expression of NANOG between DePDLSC and PDLSC (Figure 6, D). SOX 2 gene expression There was no gene expression of SOX 2 in DeDPSCs, DePDLSCs, DPSCs or PDLSCs. Multiple Differentiation Capacity of DePDLSCs in vitro The multiple differentiation capacity of DePDLSCs was verified by their induction in osteogenic, adipgogenic and chondrogenic media in vitro. When DePDLSCs were cultured in osteogenic medium, the chemical assay showed that many calcified nodules appeared in the culture after 5 weeks of induction as indicated by Alzarin red staining (Figures 7 and 8), this finding was consistent with DeDPSCs, DPSCs and PDLSCs. In contrast, when DePDLSCS was cultured in adipogenic medium, there was no evidence of adipogencity as confirmed by Oil Red O staining (Figure 9, A and B), PDLSC was on the only cell to show the capacity to differentiate into adipogenic like cells (Figure 9, G and H). All cells DePDLSCs, DeDPSsC, DPSCs and PDLSCs show pre-chondroblast like cells (Figure 10). A B C D Figure 1: Colonies formation of DePDLSCs, PDLSCs, DeDPSCs and DPSCs. (A) Single colonies of DePDLSCs showed typical fibroblast-like morphology under light microscopy. (B) Single colonies of PDLSCs showed typical fibroblast-like morphology under light microscopy. (C) Single colonies of DeDPSCs showed typical fibroblast-like morphology under light microscopy. (D) Singe colonies of DPSCs showed typical fibroblast-like morphology under light microscopy.

12 Colony forming units N Mean Std Min Median Max Cell Type Passage Seeded number DPSC DeDPSC

13 Colony forming units N Mean Std Min Median Max DePDLSC PDLSC Table 2: summary table for number of colony forming units in each cell type, passage and seeded number

14 Figure 2: Number of colony forming units in each cell type and passage, and seeded number (100 cells, 200 cells)

15 Colony forming units N Mean Std Min Median Max Cell Type Passage Seeded number Colony Size DPSC <= > <= > <= > <= > <= > <= >

16 Colony forming units N Mean Std Min Median Max DeDPSC <= > <= > <= > <= > <= > <= >

17 Colony forming units N Mean Std Min Median Max DePDLSC <= > <= > <= > <= > <= > <= >

18 Colony forming units N Mean Std Min Median Max PDLSC <= > <= > <= > <= > <= > <= > Table 3: Summary table for number of colony forming units according colony size in terms of cell type, passage and seeded number

19 Figure 3: Colony forming units according to colony size ( 3mm, >3mm) in terms of cell type, passage and seeded number (100 cells) Figure 4: Colony forming units according to colony size ( 3mm, >3mm) in terms of cell type, passage and seeded number (200 cells)

20 Effect Type 3 Tests of Fixed Effects Num DF Den DF F Value Pr > F Cell_Type Passage <.0001 Seeded_number <.0001 Cell_Type*Passage Cell_Type*Seeded_num <.0001 Table 4: fixed effects for regression analysis on colony forming units Figure 5: diagnostic plots for multiple regression of colony forming units in terms of cell type, passages and seeded number

21 Cell type DeDPSC DPSC PDLSC DePDLSC Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t < Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t Table 5: least square means for colony forming units within passages of each cell type Effect Type III Tests of Fixed Effects Num DF Den DF F Value Pr > F Cell_Type Passage <.0001 Seeded_number Cell_Type*Passage <.0001 Cell_Type*Seeded_num Table 6: The fixed effect factors of regression model for colony size

22 Cell Type Differences of Cell_Type Least Squares Means Cell Type Estimate Standard Error DF t Value Pr > t DPSC DeDPSC DPSC DePDLSC DPSC PDLSC DeDPSC DePDLSC DeDPSC PDLSC DePDLSC PDLSC Table 7: pairwise comparison of cell types in colony forming size

23 DeDPSC Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t DPSC Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t < < PDLSC Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t < DePDLSC Differences of Passage Least Squares Means Passage Passage Estimate Standard Error DF t Value Pr > t Table 8: least square means for colony size within passages of each cell type

24 OCT4 DeDPSC vs DPSC A NANOG DeDPSC vs DPSC B DeDPSC DPSC 1 0 P2 P6 P10 P2 P6 P No expression P2 P6 P10 P2 P6 P OCT4 DePDLSC vs PDLSC P2 P6 P10 P2 P6 P10 C NANOG DePDLSC vs PDLSC P2 P6 P10 P2 P6 P10 D DePDLSC PDLSC Figure 6: Pluripotent gene expression of DeDPSCs vs DPSC and DePDLSCs vs PDLSCs at passages 2, 4 and 6. (A) OCT4 genes expression of DePDSCs vs. DPSCs at P2, P6 and P10. (B) NANOG gene expression of DeDPSCs vs DPSCs at P2, P6 and P10. (C) OCT 4 gene expression of DePDLSCs vs. PDLSC. (D) NANOG gene expression of DePDLSCs vs. PDLSCs

25 A A B C D E F G H Figure 7: Osteogenic capacity of periodontal ligament stem cells from human deciduous teeth (DePDLSCS) in comparison to other more characterized human dental stem cells. (A) DePDLSCs in the standard culture medium showed no alizarin red positive staining. (B) DePDLSCs showed positive alizarin red staining after induction in osteogenic medium for 5 weeks. (C) DeDPSCs in the standard culture medium showed no alizarin red positive staining. (D) DePDLSCs showed positive alizarin red staining after induction in osteogenic medium for 5 weeks. (E) PDLSCs in the standard culture medium showed no alizarin red positive staining. (F) PDLSCs showed positive alizarin red staining after induction in osteogenic medium for 5 weeks. (G) DPSCs in the standard culture medium showed no alizarin red positive staining. (H) DPSCs showed positive alizarin red staining after induction in osteogenic medium for 5 weeks.

26 A B C D E Absorbance Figure 8: Osteogenic differentiation of DePDLSCs compared with DeDPSCs, DPSCs, and PDLSCs. (A) DePDLSCs showed no alizarin red positive staining when cultured in standard medium (left 3 wells) but after 5 weeks in osteogenic medium show a positive alizarin red positive staining (right 3 wells). (B) DeDPSCs showed no alizarin red positive staining when cultured in standard medium but after 5 weeks in osteogenic medium show a positive alizarin red positive staining. (C) PDLSCs showed no alizarin red positive staining when cultured in standard medium but after 5 weeks in osteogenic medium show a positive alizarin red positive staining. (D) DPSCs showed no alizarin red positive staining when cultured in standard medium but after 5 weeks in osteogenic medium show a positive alizarin red positive staining. (E) Quantification of each cell type by absorbance measurement at 550 nm with a spectrophotometer revealed no significant difference in the osteogenic differentiation ability of each cells type.

27 A B C D E F G H Figure 9: Adipogenic capacity of periodontal ligament stem cells from human deciduous teeth (DePDLSCS) in comparison to other more characterized human dental stem cells. (A) DePDLSCs showed no adipogenic capacity in standard medium or (B) when induced in adipogenic medium. (C) DeDPSCs showed no adipogenic capacity in standard culture or (D) when induced in adipogenic medium. (E) DPSC showed no adipogenic capacity in standard culture medium showed or (F) when in induced in adipogenic medium. (G) PDLSCs showed no adipogenic capacity in standard medium. (H) PDLSCs when cultured in adipogenic medium differentiated into adipogenic-like cells.

28 A B C D E F G H I J K L Figure 10: Chondrogenic differentiation, pellets after induction with chondrogenic medium and three dimension pellets with toluidine blue staining. (A) DePDLSCs pellet cultured after 3 weeks with chondrogenic medium (B-C) DePDLSC chondrogenic pellet demonstrated in three dimension at 20 X and 40X magnification, respectively. (D) DeDPSC pellet cultured after 3 weeks with chondrogenic medium. (E-F) DePDLSCs chondrogenic pellet demonstrated in three dimension at 20 X and 40 X magnification, respectively. (G) DPSCs pellet cultured after 3 weeks with chondrogenic medium. (H-I) DPSCs chondrogenic pellet demonstrated in three dimension at 20 X and 40 X magnification, respectively. (J) PDLSC pellet cultured after 3 weeks with chondrogenic medium. (K-L) PDLSC chondrogenic pellet demonstrated in three dimension at 20 X and 40 X magnification, respectively.

29 DISCUSSION Dental caries has been reported as the most common cause of tooth lost in the primary dentition (Asheneifi T et al., 2001). Extracted deciduous teeth, much like the umbilical cord, will become biological waste. Such materials serve the best source for stem cells as they are not needed otherwise. Until recently, there has been very little research on the periodontal ligament stem cells of deciduous teeth. In the present study, periodontal ligament stem cells were isolated from human deciduous teeth using the collagenase/dispase method. Isolated DePDLSCs showed mesenchymal like qualities. More specifically, DePDLSCs showed the ability to form fibroblast-like colonies, and differentiate into osteogenic, and chondrongenic like-cells. Stem cells are cell that can differentiate into other cell types; and they are defined by their selfrenewing and multiple differentiation abilities. In order for a cell to be a called a stem cell they must show two abilities; self replication and differentiation. We provide evidence that DePDLSCs have self-renewal ability, as indicated by the colony forming unit-fibroblast assay (Figure 1), and can differentiate into osteoblast-like and chondrocyte-like (Figures 7 and 10 respectively) cells when induced in vitro under different conditions. Single colonies of DePDLSCs showed typical fibroblast-like morphology under light microscopy, similar to PDLSCs, DeDPSCs and DPSCs (figure 1 A-D). Using the colony forming units fibroblastic assay we demonstrate that DePDLSCs is able to form colonies at low and high densities. We also show that there is no statistical significant difference in the number of colonies formed between cell types (Table 4); however, there is a statistically significant difference between the number of colonies formed within passages of each cell type (Table 5, Figure 2). This finding is contrary to Ji K et al., 2013 who found that DePDLSCs showed greater colony forming units compared to PDLSCs. There was no statistically significant difference in colony size between cell types. For colony size passage was the statistically significant factor for DePDLSCs, PDLSCs and DPSCs but not DeDPSCs (Table 8, Figures 3 and 4). Embryonic stem cells are generally identified by a set of surface markers and their expression of a number of pluripotent genes such as transcription factors; OCT 4, NANOG and SOX 2. Octamer binding transcription factor (OCT)-4, also called OCT 3, OCT 3/4, POU5F1, OTF3, or NF-A3 (Calloni et. al 2013), is a transcription factor that aids in the role of the pluripotency in embryonic stem cells. NANOG, named after the mythological Celtic land of the ever- young Tir nan Og, is also transcription factor that aids in the role of the pluripotency of embryonic stem cells. SOX-2 also plays a role in the pluripotency of embryonic stem cells. While the roles of these transcription factors (OCT-4, NANOG, SOX-2) have been well established in embryonic stem cells, their role in mesenchymal cells is not very well defined, and their expression has been considered as a primitive phenotype and an indication of stem potential of the cells (Calloni et. al, 2013). In addition, the expression of NANOG in MSCs could be due to a transition from in vivo to in vitro

30 conditions, from the quiescent to the proliferative state (Callnoi et. al, 2013). In fact, NANOG seems to have roles in the maintenance and differentiation of MSCs in vitro (Callnoi et al, 2013). In this study we demonstrate that DePDLSCs show limited expression of stemness associated genes Octamer binding transcription factor (OCT) - 4 and NANOG (Figures 6 C and D). We also demonstrate that there was no statistically significant difference in the expression of OCT-4 or NANOG expression in DePDLSCs compared to PDLSCs (Figures 6 C and D); both cells types DePDLSCs, and PDLSCs showed limited expression of OCT-4 and NANOG. The limited expression of NANOG and OCT-4 in both DePDLSCs and PDLSCs is likely due to the fact that these transcription factors play a larger role in the early stages of embryonic development (i.e. blastocyst stage), and not as much in the later stages, as adult stem cells which have limited life span relatively. For example, one study showed that NANOG is down regulated when organogenesis is initiated at the time of embryo implantation (Callnoi et. al, 2013). Our study also demonstrates that DPSCs and DeDPSCs show expression of OCT-4 while only DPSCs showed expression of NANOG and DeDPSCs showed no expression (Figure 6, A, B). Interestingly, there was a decrease in expression of OCT-4 with increased passages (P2-P10), while there was an increase in OCT-4 expression with increased passage in DPSC. This inverse relationship between stemness and passage stage could be due to the type/age of (deciduous vs. adult) of the stem cell. DePDLSCs show multiple differentiation abilities. In this study we show that DePDLSCs illustrate osteogenic ability when induced in vivo. DePDLSCs demonstrated positive alizarin red staining, similar to PDLSC, DPSCs, and DeDPSCs (Figure 7). Spectrophotometry at 550 nm of each cell type (DePDLSCs, PDLSCs, DeDPSCs and DPSCs) revealed no significant difference in the osteogenicity between cells (figure 8). DePDLSCs revealed chondrogenic ability when induced in vivo. DePDLSCs show positive proteoglycan staining when stained with alcian blue, this is indicative of the typical of the extracellular matrix of chondrocyte-like cells (Figure 10). Both DePDLSCs and PDLSCs show more intense alcian blue staining compared to DeDPSCs and DPSCs (Figure 10). PDLSCs were the only cell type to show adipogenic-like cells in our study, no other cell type exhibited positive oil red oil staining. This finding is contrary to Ji et al., 2013 who demonstrated adipogenic abilities in both PDLSCs and DePDLSCs. CLINICAL SIGNIFICANCE Isolation and characterization of periodontal ligament stem cells has clinical implications. We provide evidence that DePDLSCs can be induced to form odonto/osteogenic and chondrogeniclike cells, similarly to DPSCs, DeDPSCs and PDLSCs. Consequently, we may also be able to induce these cells to repair and or/regenerate the dental, periodontal and neural tissues. Regeneration of the periodontal tissue including periodontal ligament and the supporting alveolar bone is important to reverse periodontal loss. DePDLSCs may also be useful in cases of avulsion, when

31 the periodontal ligament of a reimplanted is lost and the tooth undergoes ankylosis or replacement resorption. If we can prevent these processes by transplantation of DePDLSCs and induce these cells to form a new periodontal ligament, the number of teeth lost due to trauma could be decreased. DePDLSCs may also be used for bone regeneration indicated by its strong osteogenic potential. CONCLUSION Our data provide evidence that DePDLSCs have self-renewal and multiple differentiation abilities. This project is one of the first to characterize PDLSCs from deciduous teeth to this extensiveness. The results of the project will provide a basis for further exploration of tissue regeneration capacities. ACKNOWLEDGEMENTS Supported in part by the UTHSC College of Dentistry Alumni Endowment Fund and the Tennessee Dental Association Foundation. The authors acknowledge Lei Wang, Dr. Tran and Dr. Hong for statistical analysis and support. REFERENCES 1. About I, Bottero MJ, de Denato P, Camps J, Franquin JC, Mitsiadis TA (2000). Human dentin production in vitro. Exp Cell Res 258: Alshenefi T, and Hughes CV (2001). Reasons for dental extractions in children. Pediatr Dent 23: Batouli S, Miura M, Brahim J, Tsutsui TW, Fisher LW, Gronthos S, et al. (2003). Comparison of stem cell mediated osteogenesis and dentogenesis. J Dent Res 82: Bluteau G, Luder HU, Bari DE, Mitsiadis TA (2008). Stem cells for tooth engineering. Eur Cell Mater 16: Calloni R, Cordero EA, Henriques JA, et al (2013). Reviewing and updating the major markers for stem cells. Stem Cell Dev 22(9): Couble ML, Farges JC, Bleicher F, Perrat-Mabiliion B, Boudeulle M, Magloire H (2000). Odontoblast differentiation of human dental pulp cells in explants cultures. Calcif Tissue Int 66: Gronthos S, Zannettino AC, Graves SE, Ohta S, Hay SJ, Simmons PJ (1999). Differential cell surface expression of the STRO-1 and alkaline phosphatase antigens on discrete developmental stages in primary cultures of human bone cells. J bone Miner Res 14:

32 8. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000). Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natal Acad Sci USA 97: Huang GTJ, Gronthos S, and Shi S (2009). Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J DENT RES 88 (9): Huang GTJ, Shagramanova K, Chan SW (2006). Formation of odontoblast-like cells from cultured human dental pulp cells on dentin in vitro. J Endod 32(11): Huang GTJ, Sonoyama W, Liu Y, Liu H, Wang S, Shi S (2008). The hidden treasure in apical papilla: the potential role in pulp/dentin regeneration and boot engineering. J Endod 34: Huang GTJ, Yamaza T, Lonnie SD et al. (2010) Stem/Progenitor Cell-Mediated De Novo Regeneration of Dental Pulp with Newly Deposited Continuous Layer of Dentin in an In Vivo Model. Tissue Eng Part A 16(2): Ji K, Liu Y, Lu W, et al. (2013). Periodontal tissue engineering with stem cells from the periodontal ligament of human retained deciduous teeth. J Periodontal Res 48: Isaka J, Ohazama A, Kobayahi M, Nagashima C, Takiguchi T, Kawasaki H, et al. (2001). Participation of periodontal ligament cells with regeneration of alveolar bone. J Periodontal 72: McCulloch CA, Bordin S (1991). Role of fibroblast subpopulations in periodontal physiology and pathology. J Periodontal Res 26: Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, et al. (2003). SHED: stem cells from human exfoliated deciduous teeth. Pro Natl Acad Sci USA 100: Morsczeck C, Gotz W, Schierholz J, Zeilhofer F, Kuhn U, Mohl C, et al. (2005). Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth. Matrix Biol 24: Morsczeck C, Schmalz G, Reichert T, Vollner F, Gallwer K, Drimel O (2008). Somatic stem cells for regenerative dentistry. Clin Oral Investig 12: Pittenger MF, Mackay AM, Beck SC, Jaiswel RK, Douglas R, Mosca JD, et al. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284: Schneider CA, Rasband WS, and Eliceiri KW (2012). NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7): Shalu R, Mandeep K, et al. (2013). Redefining the potential applications of dental stems cells: An asset for future. Indian J Hum Genet: Tsukamoto Y, Fukutani S, Shin-ike T, et al. (1992). Mineralized nodule formation by cultures of human dental pulp-derived fibroblast. ARCH ORAL BIO 37(12):