SUPPLEMENTARY DATA. Imaging Studies.

Transcription

1 Imaging Studies. Dexa Total body composition (fat mass and fat-free mass) was measured by dual-energy x-ray absorptiometry using a scanner (Hologic, Inc., Boston, MA). Dual-energy x-ray absorptiometry scans were performed and analyzed using pediatric software (version 1.5e; Hologic, Inc.). Abdominal Magnetic Resonance Imaging (MRI) studies were performed on a GE or Siemens Sonata 1.5 Tesla system (1). Fast-MRI Hepatic steatosis was defined as by the hepatic fat content (HFF%) higher than 5.5% (6). Measurement of liver fat content was performed by MRI using the 2-point Dixon (2PD) method as modified by Fishbein et al (2). Using the MRIcro software program, five regions of interest were drawn on each image and the mean pixel signal intensity level was recorded. The Hepatic Fat Fraction (HFF%) was calculated in duplicate from the mean pixel signal intensity data using the formula: [(Sin-Sout)/(2 Sin)] 100. The imaging parameters included: matrix size = , flip angle ( ) = 30, TR = 18 ms, TEs = 2.38/4.76 ms out-of-phase and in-phase, respectively, bandwidth = 420 Hz/pixel, six averages, slice thickness = 10 mm, one slice, 2.3 seconds/slice (for 2 points), scan time = 14 seconds in a single breath-hold (3). Validation of Fast-MRI against 1H-NMR was performed in 34 lean and obese adolescents. A strong correlation was obtained between the two methods (r = 0.954, p < ) (3). The within-subject standard deviation for HFF was 1.9%. Genotyping. Eighty five Caucasians, 58 African Americans and 75 Hispanics donated the blood to extract the DNA and were included in the genetic analyses. Genomic DNA was extracted from peripheral blood leukocytes. The PNPLA3 rs and GCKR rs variant were genotyped as previously reported (4, 5). To genotype the rs SNP the following pair of primers was used: F=5 - GCC CTG CTC ACT TGG AGA AA-3 and R=5 -TGA AAG GCA GTG AGG CAT GG-3. PCR was carried out using the following conditions: denaturation at 95 C for 5 min followed by 35 cycles of 30 s at 94 C, 30 s at 55 C, and 30 s at 72 C. The FDFT1 rs was sequenced using the following primers: F=5 - AAGGGCTTGGTTCTGCTCA -3, R=5 - ACCACACTTAGCCTCACCCGTCTTTT -3 with the following conditions: denaturation at 95 C for 5 min followed by 35 cycles of 30 s at 94 C, 30 s at 60 C, and 30 s at 72 C. PCR products were analyzed by automated sequencing through the Yale W.M. Keck facility. Metabolic Studies. All metabolic studies were done at the Yale Center for Clinical Investigation (YCCI) at 8.00 am following a h overnight fast. A standard OGTT (1.75 g/kg body weight, up to 75 g) was performed. Indices of insulin sensitivity: Insulin sensitivity was assessed by the whole body insulin sensitivity index (WBISI / Matsuda Index) which we have previously validated by comparison with the euglycemic-hypeinsulinemic clamp studies in obese children and adolescents (6). Beta Cell function: The insulinogenic index (IGI), which represents early phase insulin secretion and is a commonly used index of beta cell function, was calculated from the OGTT data: IGI = insulin (0 30 min) in microunits per milliliter divided by the glucose (0 30 min) in milligrams per deciliter. To better describe the state of insulin secretion in our population we also included the disposition index (DI), which derives from a non-linear hyperbola-like curve and provides an integrate picture of glucose tolerance including both insulin sensitivity and insulin secretion. The DI was calculated as the product of the IGI and the WBISI, based on the curvilinear relation of these OGTT derived parameters previously described by our group in obese children and adolescents (6).

2 Biochemical analyses. Plasma glucose was determined using a glucose analyzer by the glucose oxidase method (Beckman Instruments, Brea, CA). Plasma insulin was measured by the Linco RIA, lipid levels using an Auto-Analyzer (model ), liver enzymes, using standard automated kinetic enzymatic assays. Adiponectin levels were measured using RIA assays from Linco Research (St. Charles, MO). Measurement of the Caspase-Generated CK-18 Fragments (CK-18). The apoptosis associated neoepitope in the C-terminal domain of CK-18 was measured by the M30-Apoptosense ELISA kit (PEVIVA, Bromma, Sweden). All assays were performed in duplicate, and the absorbance was determined using a microplate reader (molecular Devices M2, Sunnyvale, CA).

3 Supplementary Table 1. Clinical features of the study population according to ethnicity. Caucasians African Americans Hispanics P-value N Age (years) 15.0± ± ± Gender (M/F)% 41/59 38/62 54/ GT (NGT/IGT/T2D) 80/19/1 70/29/1 60/38/ BMI (Kg/m2) 31.3± ± ± Fasting glucose (mg/dl) 92.0± ± ± h glucose (mg/dl) 119.1± ± ± WBISI 2.30± ± ± IGI 3.12± ± ± DI 5.88± ± ± Adiponectin ( g/ml) 9.63± ± ± Triglycerides (mg/dl) 107.3± ± ±89.95 <.0001 HFF% 7.3± ± ±13.1 <.0001 Subcutaneous (cm2) 432.5± ± ± Visceral (cm2) 56.63± ± ±33.17 <.0001 ALT (UI/L) 25.9± ± ±31.0 <.0001 GT= glucose tolerance, NGT= normal glucose tolerance, IGT=impaired glucose tolerance, T2D=type 2 diabetes, BMI=Body Mass Index, WBISI=Whole Body Insulin Sensitivity Index, IGI= Insulinogenic Index, DI= Disposition Index, HFF%=Hepatic Fat Content. ANOVA was used to compare the groups.

4 Supplementary Table 2. Anthropometric features according to the genotypes in the sub-group of Caucasians obese children and adolescents. CAUCASIANS GCKR rs CC (34) CT (41) TT (10) P-value Age (years) 15.6± ± ± Gender (M/F)% 29/71 41/59 80/ BMI (Kg/m2) 30.6± ± ± HFF% 5.01± ± ± WBISI 2.29± ± ± PNPLA3 rs CC (44) CG (30) GG (11) P-value Age (years) 16.1± ± ± Gender (M/F)% 43/57 33/67 55/ BMI (Kg/m2) 31.5± ± ± HFF% 3.41± ± ±15.3 <.0001 WBISI 2.53± ± ± FDFT1 rs GG (27) AG (38) AA (20) P-value Age (years) 15.8± ± ± Gender (M/F)% 40/60 40/60 45/ BMI (Kg/m2) 29.4± ± ± HFF% 6.52± ± ± WBISI 2.10± ± ±

5 Supplementary Table 3. Anthropometric features according to the genotypes in the sub-group of African Americans obese children and adolescents. AFRICAN AMERICANS GCKR rs CC (41) CT (16) TT (1) P-value Age (years) 15.2± ± Gender (M/F)% 38/62 38/62 100/ BMI (Kg/m2) 32.3± ± HFF% 1.15± ± WBISI 2.75± ± PNPLA3 rs CC (39) CG (17) GG (2) P-value Age (years) 14.9± ± ± Gender (M/F)% 44/56 33/67 0/ BMI (Kg/m2) 32.4± ± ± HFF% 1.08± ± ± WBISI 2.61± ± ± FDFT1 rs GG (10) AG (34) AA (14) P-value Age (years) 15.3± ± ± Gender (M/F)% 14/86 45/55 50/ BMI (Kg/m2) 31.9± ± ± HFF% 2.18± ± ± WBISI 2.27± ± ±

6 Supplementary Table 4. Anthropometric features according to the genotypes in the sub-group of Hispanic obese children and adolescents. HISPANICS GCKR rs CC (30) CT (32) TT (13) P-value Age (years) 13.8± ± ± Gender (M/F)% 50/50 69/31 38/ BMI (Kg/m2) 31.6± ± ± HFF% 9.80± ± ± WBISI 1.90± ± ± PNPLA3 rs CC (25) CG (31) GG (19) P-value Age (years) 13.1± ± ± Gender (M/F)% 40/60 68/32 58/ BMI (Kg/m2) 32.2± ± ± HFF% 10.0± ± ± WBISI 1.68± ± ± FDFT1 rs GG (32) AG (33) AA (10) P-value Age (years) 13.4± ± ± Gender (M/F)% 55/45 59/41 50/ BMI (Kg/m2) 32.1± ± ± HFF% 13.9± ± ± WBISI 1.66± ± ±

7 References 1. Cali AM, De Oliveira AM, Kim H, Chen S, Reyes-Mugica M, Escalera S, Dziura J, Taksali SE, Kursawe R, Shaw M, Savoye M, Pierpont B, Constable RT, Caprio S. Glucose dysregulation and hepatic steatosis in obese adolescents: is there a link? Hepatology. 2009; 49: Fishbein MH, Gardner KG, Potter CJ, Schmalbrock P, Smith MA. Introduction of fast MR imaging in the assessment of hepatic steatosis. Magn Reson Imaging. 1997; 15: Kim H, Taksali SE, Dufour S, Befroy D, Goodman TR, Petersen KF, Shulman GI, Caprio S, Constable RT. Comparative MR study of hepatic fat quantification using single-voxel proton spectroscopy, two-point Dixon and three-point IDEAL. Magn Reson Med. 2008; 59: Santoro N, Kursawe R, D'Adamo E, Dykas DJ, Zhang CK, Bale AE, Calí AM, Narayan D, Shaw MM, Pierpont B, Savoye M, Lartaud D, Eldrich S, Cushman SW, Zhao H, Shulman GI, Caprio S A common variant in the patatin-like phospholipase 3 gene (PNPLA3) is associated with fatty liver disease in obese children and adolescents. Hepatology. 2010; 52: Santoro N, Zhang CK, Zhao H, Pakstis AJ, Kim G, Kursawe R, Dykas DJ, Bale AE, Giannini C, Pierpont B, Shaw MM, Groop L, Caprio S. Variant in the glucokinase regulatory protein (GCKR) gene is associated with fatty liver in obese children and adolescents. Hepatology. 2012; 55: Yeckel CW, Weiss R, Dziura J, Taksali SE, Dufour S, Burgert TS, Tamborlane WV, Caprio S. Validation of insulin sensitivity indices from oral glucose tolerance test parameters in obese children and adolescents. J Clin Endocrinol Metab. 2004; 89: