Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

Size: px
Start display at page:

Download "Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU)."

Transcription

1 Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between groups) Day 0 Day 15 Day 30 Day 0 Day 15 Day 30 Day 0 Day 15 Day 30 Trend of change* Age (week) 29.8± ± Body weight (g) 427.1± ± ± ± ± < ± Oral glucose tolerance test 0 min (mmol/l) 5.5± ± ± ± ± ± min (mmol/l) 12.7± ± ± ± ± ± min (mmol/l) 14.3± ± ± ± ± ± min (mmol/l) 12.1± ± ± ± ± ± AUC 30.6± ± ± ± ± ± <0.001 Insulin tolerance test 0 min (mmol/l) 6.1± ± ± ± ± ± < min (mmol/l) 7.0± ± ± ± ± ± < min (mmol/l) 6.2± ± ± ± ± ± < min (mmol/l) 6.2± ± ± ± ± ± <0.001 AUC 15.8± ± ± ± ± ± <0.001 Data are mean±sd; * p value of trend test between groups.

2 Supplementary Table 2. P-value of terms related to lipid metabolism generated by DAVID tool. Term Count p-value Lipid biosynthetic E-13 Cholesterol metabolic E-08 Fatty acid metabolic E-06 Bile acid metabolic E-02 Supplementary Table 3. P-value of terms related to lipid metabolism generated by Chi-square test. Terms Lists Counts Negative counts Lipid biosynthetic Our list Fatty acid metabolic Cholesterol metabolic Bile acid metabolic Union Background Our list Background Our list Background Our list Background Our list Background Chi-square with Yates' correction

3 Supplementary Figure 1. The berberine-containing 3-herb formula JCU. The phytochemical profiles of JCU were identified by high performance liquid chromatography (HPLC) A. The three herbs and their main chemicals in the berberine-containing JCU. B. HPLC graphs of the three herbs JCU-1, JCU-2 and JCU-3. C. HPLC graphs of JCU extract preparations after 5 and 16 months of storage.

4 Supplementary Figure 2. The time line of the three sets of animal experiments. Note: the upward arrows indicate the days when OGTT were performed. A. Single-dose treatment and 1-week follow up study. B. Two-week treatment and 2-month follow up study. C. One-month treatment and 12-month follow-up study.

5 Supplementary Figure 3. Characterization and validation of the male Zucker diabetic fatty (ZDF) rats. Note: data are mean±sd, * p<0.05. A. Genotyping of Zucker rats by PCR. B. Body weight gain of aging male Zucker fatty rats (dark line, n=6) and their lean littermates (light line n=9). C. One obese and one lean rat at 3 months of age. D. Blood glucose levels of male Zucker fatty (solid line), lean (light line) and normal (dash line) rats during OGTT (2.5g/kg glucose). Each group contained 6 animals of 14- to 16- week old. E. Blood glucose levels of male Zucker fatty (solid line), lean (light line) and normal (dash line) rats during ITT (0.5 U/kg, i.p.). Each group contained 6 animals of 14- to 16- weeks old. F. Blood glucose levels of male Zucker fatty rats during OGTT (2.5g/kg glucose). Each group contained 6 animals of 6 (dash line), 12 (light line) and 18 (solid line) weeks of age. G. Blood glucose levels of male Zucker diabetic fatty rats (n=6) before (solid line) and after (dash line) one-week oral treatment with metformin (50 mg/kg).

6 Supplementary Figure 4. Global gene expression in liver by microarray and candidate gene validation by quantitative real-time PCR. A. Reconstructed gene network and biological. Hepatic genes corrected by the JCU treatment in ZDF rats were annotated by GeneSpring GX software version (solid lines) or literature (dashed lines) for gene network construction. B. Quantitative expression of IGFBP1 and CYP7a1 genes in the liver. Fresh liver specimens were obtained from male Zucker normal rats (ZN, n=3) and male ZDF rats at the end of the 2-month observation period after discontinuing the 2-week treatment with JCU (ZDF-JCU, n=3) or vehicle (ZDF-V, n=3). The Y-axis is the relative expression level normalized against the mean expression level in ZDF-V rats.

Sustained antidiabetic effects of a berberine-containing Chinese herbal medicine through regulation of hepatic gene expression

Sustained antidiabetic effects of a berberine-containing Chinese herbal medicine through regulation of hepatic gene expression Sustained antidiabetic effects of a berberine-containing Chinese herbal medicine through regulation of hepatic gene expression Hai-Lu Zhao 1,2*, Yi Sui 1,3*, Chun-Feng Qiao 4+, Kevin Y Yip 5,6, Ross KK

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

SUPPLEMENTARY DATA. 1. Characteristics of individual studies

SUPPLEMENTARY DATA. 1. Characteristics of individual studies 1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

(a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. H 2n O 2

(a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. H 2n O 2 1 Triglycerides, amylose and glycogen are used to store energy in many living organisms. (a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. The formula for a

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,

More information

Cohort 2. Age, years 41.0 (10.2) Diabetes duration, years 26.5 (15.8)

Cohort 2. Age, years 41.0 (10.2) Diabetes duration, years 26.5 (15.8) Supplementary Table. Participant characteristics in cohort Cohort Number Sex, Male Female Age, years. (.) Diabetes duration, years.5 (5.) BMI, kg.m. (3.) HbA c, % mmol.mol. (.7) () C-peptide, nmol.l.3

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BM18106)

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BM18106) An ANCOVA was used to calculate least squares means of the difference from baseline and 95% confidence intervals at each timepoint. The placebo-corrected difference from baseline at Week 16 was also calculated.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supporting information

Supporting information Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes

Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes 30 The Open Diabetes Journal, 2011, 4, 30-36 Open Access Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes Sumiaki Fukuda, Katsuhiro Miyajima, Tomohiko Sasase

More information

Sponsor Novartis. Generic Drug Name Vildagliptin/Metformin. Therapeutic Area of Trial Type 2 diabetes. Approved Indication Type 2 diabetes

Sponsor Novartis. Generic Drug Name Vildagliptin/Metformin. Therapeutic Area of Trial Type 2 diabetes. Approved Indication Type 2 diabetes Clinical Trial Results Database Page 1 Sponsor Novartis Generic Drug Name Vildagliptin/Metformin Therapeutic Area of Trial Type 2 diabetes Approved Indication Type 2 diabetes Study Number CLMF237A2309

More information

ALKA VITA DIABETES TEST

ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

DEVELOPMENT OF NEW ANIMAL MODELS FOR TYPE 2 DIABETES MELLITUS AND PHARMACOLOGICAL SCREENING

DEVELOPMENT OF NEW ANIMAL MODELS FOR TYPE 2 DIABETES MELLITUS AND PHARMACOLOGICAL SCREENING 2) LITERATURE REVIEW 1. Srinivasan et al., (2005) developed a new rat model that replicates the natural history and metabolic characteristics of human type 2 diabetes and is also suitable for pharmacological

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

PDF hosted at the Radboud Repository of the Radboud University Nijmegen

PDF hosted at the Radboud Repository of the Radboud University Nijmegen PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/156941

More information

1.3.1 Function of Food. Why do we need food?

1.3.1 Function of Food. Why do we need food? 1.3.1 Function of Food Why do we need food? Need to know The Function of Food Three reasons for requiring food 2 Food is needed for: 1.Energy 2.Growth of new cells and Repair of existing cells, tissues,

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

NYSE AMER: MTNB. MAT9001 OVERVIEW. September 2018

NYSE AMER: MTNB.   MAT9001 OVERVIEW. September 2018 NYSE AMER: MTNB www.matinasbiopharma.com MAT9001 OVERVIEW September 2018 1 Forward Looking Statement This presentation contains "forward-looking statements" within the meaning of the Private Securities

More information

BCH 447. Triglyceride Determination in Serum

BCH 447. Triglyceride Determination in Serum BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2

Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)

More information

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779) TITLE OF THE STUDY / REPORT No. / DATE OF REPORT INVESTIGATORS / CENTERS AND COUNTRIES Clinical Study Report Protocol BC20779: Multicenter, double-blind, randomized, placebo-controlled, dose ranging phase

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Anagnostou E, Aman MG, Handen BL, et al. Metformin for treatment of overweight induced by atypical antipsychotic medication in young people with autistic spectrum disorder:

More information

The uses of animal models in the evaluation of functional foods

The uses of animal models in the evaluation of functional foods The uses of animal models in the evaluation of functional foods Jane Chao, Ph.D. Taipei Medical University School of Nutrition and Health Sciences November 30, 2006 1 Content Assessments for health claims

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Osteoblasts mediate the adverse effects of glucocorticoids on fuel metabolism

Osteoblasts mediate the adverse effects of glucocorticoids on fuel metabolism Research article Related Commentary, page 3854 Osteoblasts mediate the adverse effects of glucocorticoids on fuel metabolism Tara C. Brennan-Speranza, 1 Holger Henneicke, 1,2 Sylvia J. Gasparini, 1 Katharina

More information

Importance of Nutrition

Importance of Nutrition The EAT WELL Plate Canada s food guide Food pyramid Importance of Nutrition Energy for body metabolism (nerve impulses, contraction of muscles, repair and replacement of cells Raw materials for building

More information

Determination of Cannabis Extract Potency Degradation Mechanism and Rate by Infrared Spectroscopy

Determination of Cannabis Extract Potency Degradation Mechanism and Rate by Infrared Spectroscopy 1 Brian C. Smith, Ph.D., Big Sur Scientific, Capitola CA, brian@bigsurscientific.com, (508) 579-6514. Determination of Cannabis Extract Potency Degradation Mechanism and Rate by Infrared Spectroscopy Cannabis

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse

Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse National Institute of Diabetes and Digestive and Kidney Diseases NATIONAL INSTITUTES OF HEALTH Nonalcoholic steatohepatitis

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Number of patients: Planned: 403 Randomized: 391 Treated: 390 Efficacy: 363 (Full analysis set) 356 (Per-protocol set)

Number of patients: Planned: 403 Randomized: 391 Treated: 390 Efficacy: 363 (Full analysis set) 356 (Per-protocol set) These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company : sanofi-aventis

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Metabolic Syndrome.

Metabolic Syndrome. www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present

More information

STATE OF THE STATE: TYPE II DIABETES

STATE OF THE STATE: TYPE II DIABETES STATE OF THE STATE: TYPE II DIABETES HENRY DRISCOLL, MD, CHIEF of ENDOCRINOLOGY MARSHALL U, CHERTOW DIABETES CENTER, HUNTINGTON VAMC HEATHER VENOY, RD, LD, CDE DIETITIAN, DIABETES EDUCATOR, CHERTOW DIABETES

More information

Supplemental Figures

Supplemental Figures Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)

More information

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Research Article The Characterization of High-Fat Diet and Multiple Low-Dose Streptozotocin Induced Type 2 Diabetes Rat Model

Research Article The Characterization of High-Fat Diet and Multiple Low-Dose Streptozotocin Induced Type 2 Diabetes Rat Model Experimental Diabetes Research Volume 28, Article ID 7445, 9 pages doi:1.1155/28/7445 Research Article The Characterization of High-Fat Diet and Multiple Low-Dose Streptozotocin Induced Type 2 Diabetes

More information

A M Metabolics. inventing the future of healthcare

A M Metabolics. inventing the future of healthcare A M Metabolics inventing the future of healthcare Metabolic Disease Control Flavonoid-Based Amelioration of Carbohydrate Dysfunctional Metabolism December 2013 Daryl L. Thompson and M. Joseph Ahrens 2002

More information

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

*corresponding author; Tel: 1 (403)

*corresponding author;   Tel: 1 (403) Supplementary Information for Manuscript: Diet-induced changes in maternal gut microbiota and metabolomic profiles influence programming of offspring obesity risk in rats Authors: Heather A. Paul, Marc

More information

EFFECT OF A SERIES OF NOVEL SULPHONYLTHIOUREAS ON GLUCOSE TOLERANCE IN THE OBESE fa/fa ZUCKER RAT

EFFECT OF A SERIES OF NOVEL SULPHONYLTHIOUREAS ON GLUCOSE TOLERANCE IN THE OBESE fa/fa ZUCKER RAT Clinical and Experimental Pharmacology and Physiology (2001) 28, 386 391 EFFECT OF A SERIES OF NOVEL SULPHONYLTHIOUREAS ON GLUCOSE TOLERANCE IN THE OBESE fa/fa ZUCKER RAT Nicole S Farrar, Noel J Chambers,

More information

Treating Type 2 Diabetes by Treating Obesity. Vijaya Surampudi, MD, MS Assistant Professor of Medicine Center for Human Nutrition

Treating Type 2 Diabetes by Treating Obesity. Vijaya Surampudi, MD, MS Assistant Professor of Medicine Center for Human Nutrition Treating Type 2 Diabetes by Treating Obesity Vijaya Surampudi, MD, MS Assistant Professor of Medicine Center for Human Nutrition 2 Center Stage Obesity is currently an epidemic in the United States, with

More information

Journal of Chemical and Pharmaceutical Research

Journal of Chemical and Pharmaceutical Research Available on line www.jocpr.com Journal of Chemical and Pharmaceutical Research ISSN No: 0975-7384 CODEN(USA): JCPRC5 J. Chem. Pharm. Res., 2011, 3(1):452-456 Evaluation of anti hyperglycaemic activity

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction: Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Understanding the metabolic syndrome

Understanding the metabolic syndrome Understanding the metabolic syndrome Understanding the metabolic system Metabolic syndrome is the clustering together of a number of risk factors for heart disease, stroke and diabetes. Having one of these

More information

The York Diabetes Care Model

The York Diabetes Care Model This Session The York Diabetes Care Model The annual review what s it for and how to do it How to make the diagnosis of diabetes and who to test Categorisation of diabetes at diagnosis Basics of Insulin

More information

Energy Balance Equation

Energy Balance Equation Energy Balance Equation Intake Expenditure Hunger Satiety Nutrient Absorption Metabolic Rate Thermogenesis Activity Eat to Live! Live to Eat! EAT TO LIVE Intake = Expenditure Weight Stable LIVE TO EAT

More information

Urine glucose levels are disordered before blood glucose levels increase in Zucker diabetic. fatty rats

Urine glucose levels are disordered before blood glucose levels increase in Zucker diabetic. fatty rats Urine glucose levels are disordered before blood glucose levels increase in Zucker diabetic fatty rats Wei Yin 1 Weiwei Qin 2 Youhe Gao 1,2* 1. Department of Pathophysiology, Institute of Basic Medical

More information

Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction

Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Jiang, C., Xie, C., Lv, Y., Li, J., Krausz, K. W., Shi, J.,... & Gonzalez, F. J. (215). Intestine-selective

More information

New therapeutic targets for T2DM

New therapeutic targets for T2DM New therapeutic targets for T2DM Targeting inflammation: NF- B, salsalate Gwanpyo Koh Department of Internal Medicine Jeju National University School of Medicine Introduction Obesity is occurring at epidemic

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and

More information

Chemical Formulas. Chemical Formula CH 3 COCHCHOCHClCHNH Lewis Dot Structure

Chemical Formulas. Chemical Formula CH 3 COCHCHOCHClCHNH Lewis Dot Structure Biochemistry . Chemical Formulas A chemical formula represents the chemical makeup of a compound. It shows the numbers and kinds of atoms present in a compound. It is a kind of shorthand that scientists

More information

Medical BCNS-CNS. Board Certified Nutrition Specialis.

Medical BCNS-CNS. Board Certified Nutrition Specialis. Medical BCNS-CNS Board Certified Nutrition Specialis http://killexams.com/exam-detail/bcns-cns Question: 45 The following nutrition diagnosis is written in what type of format: Poor glycemic control is

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

Report Reference Guide. THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1

Report Reference Guide. THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1 Report Reference Guide THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1 How to use this guide Each type of CareLink report and its components are described in the following sections.

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML]

Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML] Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML] [Digital] If searching for the book Ragaglitazar lowers glucose,

More information

3 Body Mass Index. 2 Being overweight - a serious problem

3 Body Mass Index. 2 Being overweight - a serious problem 1 International Committee Seafarers on Seafarers Welfare Welfare and Assistance Network 3 Body Mass Index 2 2 Being overweight - a serious problem 2 Guidelines for Overweight Guidelines for Prevention

More information

Intradialytic Parenteral Nutrition in Hemodialysis Patients. Hamdy Amin, Pharm.D., MBA, BCNSP Riyadh, Saudi Arabia

Intradialytic Parenteral Nutrition in Hemodialysis Patients. Hamdy Amin, Pharm.D., MBA, BCNSP Riyadh, Saudi Arabia Intradialytic Parenteral Nutrition in Hemodialysis Patients Hamdy Amin, Pharm.D., MBA, BCNSP Riyadh, Saudi Arabia Disclosure Information Intradialytic Parenteral Nutrition in Hemodialysis Patients Hamdy

More information

MLR-1023: A First-in-Class, Clinical Stage Candidate for Type II diabetes

MLR-1023: A First-in-Class, Clinical Stage Candidate for Type II diabetes MLR-1023: A First-in-Class, Clinical Stage Candidate for Type II diabetes» Next generation insulin sensitizer that does not have PPAR activity» Orally bioavailable small molecule» Weight neutral»!-cell

More information

Digestion and Human Health

Digestion and Human Health Digestion and Human Health The Molecules of Living Systems There are three main fluid components in your body Cytoplasm in your cells Fluid between your cells Fluid in your blood The also contain many

More information

A high-performance liquid chromatography (HPLC) method for determination of chlorogenic acid and emodin in Yinhuang Jiangzhi Tea

A high-performance liquid chromatography (HPLC) method for determination of chlorogenic acid and emodin in Yinhuang Jiangzhi Tea Journal of Hainan Medical University 2016; 22(12): 17-21 17 Journal of Hainan Medical University http://www.jhmuweb.net/ A high-performance liquid chromatography (HPLC) method for determination of chlorogenic

More information

Association between Raised Blood Pressure and Dysglycemia in Hong Kong Chinese

Association between Raised Blood Pressure and Dysglycemia in Hong Kong Chinese Diabetes Care Publish Ahead of Print, published online June 12, 2008 Raised Blood Pressure and Dysglycemia Association between Raised Blood Pressure and Dysglycemia in Hong Kong Chinese Bernard My Cheung,

More information

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119 Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk

More information

Gestational Diabetes in Rural Antenatal Clinics:

Gestational Diabetes in Rural Antenatal Clinics: Gestational Diabetes in Rural Antenatal Clinics: How do we compare? Cook SJ 1,2, Phelps L 1, Kwan M 2 Darling Downs Health and Hospital Service University of Queensland Rural Clinical School Gestational

More information

Supporting Information

Supporting Information Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department

More information

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients).

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Placebo (n=188) 10 mg (n=186) 25 mg (n=189) Total (n=563) Gender, n (%) Male 75 (40) 97 (52) 84 (44) 256 (45)

More information

Specimen Paper. Biology. - Specialists in Science and Maths Education. Paper 2

Specimen Paper. Biology.  - Specialists in Science and Maths Education. Paper 2 www.londonsciencetutors.com - Specialists in Science and Maths Education Specimen Paper Centre Number Candidate Number!"#$%&'()*+#,-$.-+ Surname Other Names %&'()*+#,-$/*)0)'1- Candidate Signature Question

More information

12/09/2013. Andy E Durham. a collection of risk factors which indicate an increased risk of coronary artery disease

12/09/2013. Andy E Durham. a collection of risk factors which indicate an increased risk of coronary artery disease Andy E Durham a collection of risk factors which indicate an increased risk of coronary artery disease 1 a collection of risk factors which indicate an increased risk of laminitis Laminitis = the equine

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Metabolic Disease drug discovery at Evotec

Metabolic Disease drug discovery at Evotec Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific

More information

PREVALENCE OF METABOLİC SYNDROME İN CHİLDREN AND ADOLESCENTS

PREVALENCE OF METABOLİC SYNDROME İN CHİLDREN AND ADOLESCENTS PREVALENCE OF METABOLİC SYNDROME İN CHİLDREN AND ADOLESCENTS Mehmet Emre Atabek,MD,PhD Necmettin Erbakan University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Endocrinology and

More information

Interactions of exercise and diet in health prevention

Interactions of exercise and diet in health prevention Interactions of exercise and diet in health prevention Dr Jason Gill Institute of Cardiovascular and Medical Sciences University of Glasgow Physical activity and health outcomes does one size fit all?

More information

Establishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group

Establishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to

More information