Supplemental Figure I
|
|
|
- Lorin Roberts
- 6 years ago
- Views:
Transcription
1 Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries (M) (). n = 7 animals per group. Results are expressed as means±sem.
2 Supplemental Figure II orta 9 7 SNP (- log mol/l) M 9 7 SNP (- log mol/l) - D NS119 (- log mol/l) 1 7 NS119 (- log mol/l) E - F - 1 (n=) (n=) (n=) (n=) (n=) (n=) 7 3 Supplemental Figure II. Endothelium-independent relaxations. -F, Endothelium-independent relaxations of aorta (, and E) and mesenteric arteries (M) (, D and F) to sodium nitroprusside (SNP) ( and ), NS-119 ( and D) and hydrogen peroxide (H O ) (E and F) are shown. n = -7 animals per group. The responses to H O were examined in the presence of indomethacin (1 - mol/l) and N -nitro-l-arginine (L-NN; 1 - mol/l). Values are expressed as means±sem. P<., P<.1 vs..
3 Supplemental Figure III orta M control ODQ control ODQ D - E 1 - control ODQ 7 3 F 1 - control ODQ 7 3 control control 1 ODQ ODQ 7 3 Supplemental Figure III. Effects of sg inhibition on H O -induced relaxations. -F, The responses of the aorta (, and E) and mesenteric arteires (M) (, D and F) to exogenous hydrogen peroxide (H O ) were examined in the presence or absence of a soluble guanylate cyclase (sg) inhibitor 1H-[1,,]oxadiazolo[,3-a]quinoxalin-1-one (ODQ, mol/l). n = 7 animals per group. Values are expressed as means±sem. P<., P<.1 vs. control.
4 Supplemental Figure IV Tie promotor anine av-1 cdn Poly -enhancer NotI KpnI XmaI SalI Endothelium-specific av-1-tg +/- av-1 -/- Endothelium-specific av-1-tg +/-, av-1 +/- av-1 -/- Endothelium-specific av-1-tg +/-, av-1 -/- (av-1-r) av-1-r av-1 D31 av-1-r av-1 D31 Supplemental Figure IV. Endothelium-specific av-1 reconstitution on background., The construct used to generate endothelium-specific av-1 transgenic mice. The canine av-1 cdn (37 bp) was driven under the endothelium-specific promotor, murine Tie promotor. Endothelium-specific av-1-reconstituted (av-1-r) mice were generated by crossing endothelium-specific av-1 transgenic mice with mice. and, Immunostaining images for av-1 and D31 (an endothelial cell marker) of the aorta () and mesenteric arteries (). Scale bars = m.
5 Supplemental Figure V - orta (n=) - M (n=) E (n=) av-1-r (n=) 9 7 SNP (- log mol/l) (n=) (n=) av-1-r (n=) 7 NS119 (- log mol/l) (n=) (n=) av-1-r (n=) D F SNP (- log mol/l) (n=) (n=) av-1-r (n=) 7 NS119 (- log mol/l) (n=) (n=) av-1-r (n=) (n=) av-1-r (n=) Supplemental Figure V. Endothelium-independent relaxations. -F, Endothelium-independent relaxations of the aorta (, and E) and mesenteric arteries (M) (, D and F) to sodium nitroprusside (SNP) ( and ), NS-119 ( and D) and hydrogen peroxide (H O ) (E and F) are shown. n = animals per group. The responses to H O were examined in the presence of indomethacin (1 - mol/l) and N w -nitro-l-arginine (L-NN; 1 - mol/l). Values are expressed as means±sem. P<., P<.1 vs..
6 Supplemental Figure VI (mn) PE L-NN Force ( mn) Force (mn) 1 PE L-NN Time (min) Force D ( mn) Force Time (min) Supplemental Figure VI. asal NO release. -D, Representative traces and quantitative analysis of contractile responses evoked by L- NN (1 - mol/l) in rings precontracted with a submaximal dose of phenylephrine (PE; 1-7 mol/l) from aorta ( and ) and mesenteric arteries ( and D). n = 7 animals per group. Values are expressed as means±sem. P<., P<.1.
7 Supplemental Figure VII (mg/g) 1 Heart weight/body weight (n=) (n=) (n=) (mmhg) 1 1 week weeks Systolic blood pressure weeks (bpm) Heart rate (n=1) (n=1) (n=11) sham (n=) sham (n=) sham (n=) Time (weeks) Time (weeks) Supplemental Figure VII. Effects of cardiac pressure-overload on survival and hemodynamic parameters. -, Time course of heart weight/body weight changes (n = per group) (), systolic blood pressure () and heart rate () (n = 11-1 animals per -group, n = animals per sham-group) after transverse aortic constriction () or sham operations. Values are expressed as means±sem. P<., P<.1 vs. at each time point, P<., P<.1 vs. sham.
8 Supplemental Figure VIII (n=-) (n=-) (n=-) ( m ) Myocyte cross-sectional area week weeks weeks D (%) Perivascular fibrosis week weeks weeks E F (%) 1 Interstitial fibrosis 1 week weeks weeks
9 Supplemental Figure VIII Supplemental Figure VIII. Histological analysis of cardiac hypertrophy and fibrosis., Representative images of hematoxylin-eosin staining of the myocardium weeks after or sham operations., Quantitative analysis of cross-sectional area of cardiomyocytes. and E, Representative images of Masson-trichrome staining for evaluation of perivascular () and interstitial (E) fibrosis in the hearts after weeks of or sham operations. D and F, Quantitative analysis of perivascular (D) and interstitial (F) fibrosis. n = - animals per group. Scale bars = 1 m. Values are expressed as means±sem. P<., P<.1 vs. at each time point, P<., P<.1 vs. sham.
10 aveolin-1 enos aveola O L-rg L-it O - O gonist R a + /am O O - a + /am enos L-it gonist R O L-rg Supplemental Figure IX aveolin-1 enos O O - O L-rg L-it gonist R a + /am enos L-it O L-rg u,zn-sod H O NO NO H O H O NO Endothelium K + K a sg sg PKG1 dimerization Hyperpolarization cgmp Relaxation Tolerance cgmp LV pressure overload VSM LV systolic function, FR, Myocardial hypoxia Supplemental Figure IX. Summary of the present study. Summary of endothelium-dependent and -independent relaxations of small mesenteric arteries and coronary microvessels (upper panel) and the effects of cardiac pressure-overload (lower panel) are illustrated. oth av-1 deficiency and enos overexpression lead to over-activation of enos and excessive production of NO, causing disruption of the physiological balance between NO and EDH in microcirculations. s compared with mice, both and mice showed reduced survival after chronic cardiac pressure-overload induced by, associated with accelerated left ventricular systolic dysfunction, reduced coronary flow reserve and enhanced myocardial hypoxia. a + /am denotes calcium/calmodulin; FR, coronary flow reserve; u,zn-sod, copper, zinc-superoxide dismutase; K a, calcium-activated potassium channels; L-rg, L-arginine; L-it, L-citrulline; LV, left ventricular; PKG1a, protein kinase G1a; R, receptor; sg, soluble guanylate cyclase; VSM, vascular smooth muscle cell.
11 Godo et al., Page 11 Supplemental Tables Supplemental Table I. aseline haracteristics and Echocardiographic Parameters. (n) (n) (n) aseline characteristics ge, week-old 1.±.7 (17) 1.3±.7 (17) 1.9±.7 (17) ody weight, g 7.±. (17).±.7 (17) 7.1±. (17) Heart weight, mg 1±3 (17) 1± (17) 1±3 (17) Heart weight/body weight, mg/g.±.3 (17).±. (17).±. (17) Systolic blood pressure, mmhg 11±3 () 1±3 () 3±1 () Heart rate, bpm 73±9 () 9±3 () 9±1 () Plasma nitrite/nitrate, mol/l.3±7.9 (17) 19.7±17.9 (17) 1.±17.9 (17) Echocardiography Heart rate, bpm# 73± (1) 9±7 (1) 9±9 (1) LVDd, mm 3.7±. (1) 3.±.7 (1) 3.3±. (1) LVDs, mm.3±. (1).17±. (1).3±. (1) LVFS, % 37.±1. (1) 3.9±1. (1) 3.±1. (1) IVST, mm.79±. (1).9±. (1).7±.3 (1) P, mm.73±.1 (1).7±. (1).77±. (1) Results are expressed as means±sem. bpm denotes beats per minute;, caveolin-1-knockout mice;, endothelium-specific endothelial nitric oxide synthase transgenic mice; IVST, interventricular septal thickness; LVDd, left ventricular (LV) end-diastolic diameter; LVDs, LV end-systolic diameter; LVFS, LV fractional shortening; P, posterior wall thickness;, wild-type mice. P<., P<.1 vs.. Under conscious conditions. #Under light anesthesia with.-.% isoflurane.
12 Godo et al., Page 1 Supplemental Table II. Precontraction Forces, E Values and Maximal Relaxations of orta and Mesenteric rteries gonist Precon. Vessel (mn) (n) SNP E Max. Precon. E (-log mol/l) Relax. (mn) (-log mol/l) (%) Max. Precon. Relax. (mn) (%) E Max. (-log mol/l) Relax. (%) orta (7).±..±.1 97.±1. 7.±.3.1±. 93.±.9.7±. 7.3±. 7.±. M (7) 7.±.3 7.±. 97.±.3 7.7±..1± ±..3±..7±. 79.±. NS-119 orta (7).±..±..±. 7.±..±.1 9.3±1.9.±.1.±.1.±1. M (7).±..±.1 9.±. 7.±.9.3±.1 9.3±..9±..±.1 9.±. H O orta () 11.±..±.1 7.±. 1.9±.7.±.1.3±1. 1.9±..3±.1 73.±.1 M () 7.±.7.±.1 9.1±..1±.9.±.1 9.3±3. 7.±..±.1 9.±1.1 Results are expressed as means±sem. indicates caveolin-1-knockout mice;, endothelium-specific endothelial nitric oxide synthase transgenic mice; E, half-maximal effective concentration; HO, hydrogen peroxide; M, mesenteric artery; Max. Relax., maximal relaxation; Precon., precontraction force to phenylephrine (1 - mol/l); SNP, sodium nitroprusside;, wild-type mice. P<., P<.1 vs.. In the presence indomethacin (1 - mol/l) and L-NN (1 - mol/l).
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Exercise in Adverse Cardiac Remodeling: of Mice and Men
Exercise in Adverse Cardiac Remodeling: of Mice and Men 17-01-2013 Dirk J Duncker Experimental Cardiology, Cardiology, Thoraxcenter Cardiovascular Research Institute COEUR Erasmus MC, University Medical
Supplemental Table 1. Echocardiography Control (n=4)
Supplemental Table 1. Echocardiography (n=4) Mlc2v cre/+ ; DNMAML (n=4) LVIDd, mm 3.9±0.3 4.3±0.3 LVIDs, mm 2.6±0.4 2.9±0.2 d, mm 0.72±0.06 0.75±0.1 LVPWd, mm 0.72±0.06 0.77±0.11 FS, % 33±6 33±1 EF, %
In the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
Appendix II: ECHOCARDIOGRAPHY ANALYSIS
Appendix II: ECHOCARDIOGRAPHY ANALYSIS Two-Dimensional (2D) imaging was performed using the Vivid 7 Advantage cardiovascular ultrasound system (GE Medical Systems, Milwaukee) with a frame rate of 400 frames
Chapter 9. Body Fluid Compartments. Body Fluid Compartments. Blood Volume. Blood Volume. Viscosity. Circulatory Adaptations to Exercise Part 4
Body Fluid Compartments Chapter 9 Circulatory Adaptations to Exercise Part 4 Total body fluids (40 L) Intracellular fluid (ICF) 25 L Fluid of each cell (75 trillion) Constituents inside cell vary Extracellular
BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
Fetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.
3562-RG-1 Supplementary Figure 1 Fetal gene upregulation by 1-wk is significantly increased in mice lacking RGS2. ANP(Nppa) /BNP(Nppb) A-type and B-type natriuretic peptide; β-mhc (Myh7) beta myosin heavy
PCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure
PCTH 400 LAST LECTURE Endothelial dysfunction and cardiovascular diseases. Classic Vascular pharmacology -chronic -systemic Local Vascular pharmacology -acute -targeted High blood pressure Blood pressure
ino in neonates with cardiac disorders
ino in neonates with cardiac disorders Duncan Macrae Paediatric Critical Care Terminology PAP Pulmonary artery pressure PVR Pulmonary vascular resistance PHT Pulmonary hypertension - PAP > 25, PVR >3,
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
CARDIOVASCULAR SYSTEM
CARDIOVASCULAR SYSTEM 1. Resting membrane potential of the ventricular myocardium is: A. -55 to-65mv B. --65 to-75mv C. -75 to-85mv D. -85 to-95 mv E. -95 to-105mv 2. Regarding myocardial contraction:
Moore-Morris et al. Supplemental Table 1.
Moore-Morris et al. Supplemental Table. In vivo echocardiographic assessment of cardiac size and function following transaortic constriction (T) at 7d and 8d. SHM 7d N=6 T 7d N=5 SHM 8d N= T 8d N=6 W,
PHYSIOLOGY MeQ'S (Morgan) All the following statements related to blood volume are correct except for: 5 A. Blood volume is about 5 litres. B.
PHYSIOLOGY MeQ'S (Morgan) Chapter 5 All the following statements related to capillary Starling's forces are correct except for: 1 A. Hydrostatic pressure at arterial end is greater than at venous end.
Mechanisms of simvastatin-induced vasodilatation of rat superior mesenteric arteries
BIOMEDICAL REPORTS 5: 491-496, 2016 Mechanisms of simvastatin-induced vasodilatation of rat superior mesenteric arteries YULONG CHEN 1,2*, HONGMEI ZHANG 3*, HUANHUAN LIU 2 and AILAN CAO 1,4 1 Shaanxi Pharmaceutical
Chapter 9, Part 2. Cardiocirculatory Adjustments to Exercise
Chapter 9, Part 2 Cardiocirculatory Adjustments to Exercise Electrical Activity of the Heart Contraction of the heart depends on electrical stimulation of the myocardium Impulse is initiated in the right
Prenatal hypoxia causes long-term alterations in vascular endothelin-1 function in aged male but not female offspring
1 2 3 4 5 6 7 8 9 1 11 12 13 14 Supplementary information for: Prenatal hypoxia causes long-term alterations in vascular endothelin-1 function in aged male but not female offspring Stephane L Bourque,
Myocardial fibrosis is a pathological feature associated
Angiotensin II Type 2 Receptor Is Essential for Left Ventricular Hypertrophy and Cardiac Fibrosis in Chronic Angiotensin II Induced Hypertension Sahoko Ichihara, MD; Takaaki Senbonmatsu, MD, PhD; Edward
Disruption of Physiological Balance Between Nitric Oxide and Endothelium-Dependent Hyperpolarization Impairs Cardiovascular Homeostasis in Mice
isruption of Physiological alance etween Nitric Oxide and Endothelium-ependent Hyperpolarization Impairs ardiovascular Homeostasis in Mice Shigeo Godo, yuko Sawada, Hiroki Saito, Shohei Ikeda, udbazar
MECHANISMS OF VASCULAR ADAPTATION TO OBESITY
MECHANISMS OF VASCULAR ADAPTATION TO OBESITY EVA JEBELOVSZKI, MD Ph.D. THESIS 2 nd Department of Medicine and Cardiology Centre, Albert Szent-Györgyi Clinical Centre, University of Szeged Institute of
Reversal by L-arginine of a dysfunctional arginine/nitric oxide pathway in the endothelium of the genetic diabetic BB rat
Diabetologia (1997) : 91 915 Springer-Verlag 1997 Reversal by L-arginine of a dysfunctional arginine/nitric oxide pathway in the endothelium of the genetic diabetic BB rat G.M. Pieper, W. Siebeneich, G.
E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
The circulatory system
Introduction to Physiology (Course # 72336) 1 הלב עקרונות בסיסיים (הכנה למעבדת לב) Adi Mizrahi mizrahia@cc.huji.ac.il Textbook Chapter 12 2 The circulatory system To the heart Away from the heart 3 L 2.5
Treatment with Hydralazine and Nitrates Uri Elkayam, MD
Treatment with Hydralazine and Nitrates Uri Elkayam, MD Professor of Medicine University of Southern California School of Medicine Los Angeles, California elkayam@usc.edu Hydralazine and Isosorbide Dinitrate
CHRONIC HYPOXIA MODULATES ENDOTHELIUM- DEPENDENT VASORELAXATION THROUGH MULTIPLE INDEPENDENT MECHANISMS IN OVINE CRANIAL ARTERIES
CHRONIC HYPOXIA MODULATES ENDOTHELIUM- DEPENDENT VASORELAXATION THROUGH MULTIPLE INDEPENDENT MECHANISMS IN OVINE CRANIAL ARTERIES William J. Pearce, James M. Williams, Mohammad W. Hamade, Melody M. Chang,
Introduction to Physiology (Course # 72336) 1. Adi Mizrahi Textbook Chapter 12
Introduction to Physiology (Course # 72336) 1 עקרונות בסיסיים (הכנה למעבדת לב) הלב Adi Mizrahi mizrahia@cc.huji.ac.il Textbook Chapter 12 2 The circulatory system To the heart Away from the heart 3 L 2.5
Anatomy Review: The Heart Graphics are used with permission of A.D.A.M. Software, Inc. and Benjamin/Cummings Publishing Co.
Anatomy Review: The Heart Graphics are used with permission of A.D.A.M. Software, Inc. and Benjamin/Cummings Publishing Co. Anatomy Views Label the diagrams of the heart below: Interactive Physiology Study
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
Control of Myocardial Blood Flow
Control of Myocardial Blood Flow Blood goes where it is needed John Hunter, 1794 Cited by Dunker DJ and Bache RJ Physiol Rev, 2008 Bernard De Bruyne, MD, PhD Cardiovascular Center Aalst OLV-Clinic Aalst,
SymBioSys Exercise 2 Cardiac Function Revised and reformatted by C. S. Tritt, Ph.D. Last updated March 20, 2006
SymBioSys Exercise 2 Cardiac Function Revised and reformatted by C. S. Tritt, Ph.D. Last updated March 20, 2006 The goal of this exercise to explore the behavior of the heart as a mechanical pump. For
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
The Heart. Happy Friday! #takeoutyournotes #testnotgradedyet
The Heart Happy Friday! #takeoutyournotes #testnotgradedyet Introduction Cardiovascular system distributes blood Pump (heart) Distribution areas (capillaries) Heart has 4 compartments 2 receive blood (atria)
C57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment
Original Article C57BL/6 Mice are More Appropriate Acta Cardiol Sin 2012;28:236 240 Heart Failure & Cardiomyopathy C57BL/6 Mice are More Appropriate than BALB/C Mice in Inducing Dilated Cardiomyopathy
IB TOPIC 6.2 THE BLOOD SYSTEM
IB TOPIC 6.2 THE BLOOD SYSTEM THE BLOOD SYSTEM TERMS TO KNOW circulation ventricle artery vein 6.2.U1 - Arteries convey blood at high pressure from the ventricles to the tissues of the body Circulation
Supplementary Material
Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.
Managing Hypertrophic Cardiomyopathy with Imaging. Gisela C. Mueller University of Michigan Department of Radiology
Managing Hypertrophic Cardiomyopathy with Imaging Gisela C. Mueller University of Michigan Department of Radiology Disclosures Gadolinium contrast material for cardiac MRI Acronyms Afib CAD Atrial fibrillation
Mechanisms of False Positive Exercise Electrocardiography: Is False Positive Test Truly False?
Mechanisms of False Positive Exercise Electrocardiography: Is False Positive Test Truly False? Masaki Izumo a, Kengo Suzuki b, Hidekazu Kikuchi b, Seisyo Kou b, Keisuke Kida b, Yu Eguchi b, Nobuyuki Azuma
Ch.15 Cardiovascular System Pgs {15-12} {15-13}
Ch.15 Cardiovascular System Pgs {15-12} {15-13} E. Skeleton of the Heart 1. The skeleton of the heart is composed of rings of dense connective tissue and other masses of connective tissue in the interventricular
LV geometric and functional changes in VHD: How to assess? Mi-Seung Shin M.D., Ph.D. Gachon University Gil Hospital
LV geometric and functional changes in VHD: How to assess? Mi-Seung Shin M.D., Ph.D. Gachon University Gil Hospital LV inflow across MV LV LV outflow across AV LV LV geometric changes Pressure overload
Chapter 20: Cardiovascular System: The Heart
Chapter 20: Cardiovascular System: The Heart I. Functions of the Heart A. List and describe the four functions of the heart: 1. 2. 3. 4. II. Size, Shape, and Location of the Heart A. Size and Shape 1.
VASCULAR DYSFUNCTION IN THE -GALACTOSIDASE A-KNOCKOUT MOUSE IS AN ENDOTHELIAL CELL-, PLASMA MEMBRANE-BASED DEFECT
Clinical and Experimental Pharmacology and Physiology (2008) 35, 1156 1163 doi: 10.1111/j.1440-1681.2008.04984.x Blackwell Endothelial-based JL Park et Publishing al. defect Asiain Fabry disease VASCULAR
Circulation. Blood Pressure and Antihypertensive Medications. Venous Return. Arterial flow. Regulation of Cardiac Output.
Circulation Blood Pressure and Antihypertensive Medications Two systems Pulmonary (low pressure) Systemic (high pressure) Aorta 120 mmhg Large arteries 110 mmhg Arterioles 40 mmhg Arteriolar capillaries
Review Article The Coronary Microcirculation in Health and Disease
ISRN Physiology Volume 2013, Article ID 238979, 24 pages http://dx.doi.org/10.1155/2013/238979 Review Article The Coronary Microcirculation in Health and Disease Judy M. Muller-Delp Department of Physiology
Gene Transfer During LVAD Support. University of Pittsburgh Medical Center Pittsburgh, PA
Gene Transfer During LVAD Support University of Pittsburgh Medical Center Pittsburgh, PA Heart Failure Major cause of morbidity and mortality In the United States each year, more than 1,000,000 hospitalizations
Magnesium is a key ionic modulator of blood vessel
Hypomagnesemia Inhibits Nitric Oxide Release From Coronary Endothelium: Protective Role of Magnesium Infusion After Cardiac Operations Paul J. Pearson, MD, PhD, Paulo R. B. Evora, MD, PhD, John F. Seccombe,
3/27/2014. Introduction.
Introduction. Myocardial perfusion & contractility becomes abnormal immediately after the onset of ischaemia, even before the development of the symptoms & ST segment changes. 1 Myocardial Wall Motion
Mechanisms of heart failure with normal EF Arterial stiffness and ventricular-arterial coupling. What is the pathophysiology at presentation?
Mechanisms of heart failure with normal EF Arterial stiffness and ventricular-arterial coupling What is the pathophysiology at presentation? Ventricular-arterial coupling elastance Central arterial pressure
Lab Activity 23. Cardiac Anatomy. Portland Community College BI 232
Lab Activity 23 Cardiac Anatomy Portland Community College BI 232 Cardiac Muscle Histology Branching cells Intercalated disc: contains many gap junctions connecting the adjacent cell cytoplasm, creates
Cardiology. the Sounds: #7 HCM. LV Outflow Obstruction: Aortic Stenosis. (Coming Soon - HCM)
A Cardiology HCM LV Outflow Obstruction: Aortic Stenosis (Coming Soon - HCM) the Sounds: #7 Howard J. Sachs, MD www.12daysinmarch.com E-mail: Howard@12daysinmarch.com Aortic Valve Disorders Stenosis Regurgitation
Structure and organization of blood vessels
The cardiovascular system Structure of the heart The cardiac cycle Structure and organization of blood vessels What is the cardiovascular system? The heart is a double pump heart arteries arterioles veins
Review of Cardiac Imaging Modalities in the Renal Patient. George Youssef
Review of Cardiac Imaging Modalities in the Renal Patient George Youssef ECHO Left ventricular hypertrophy (LVH) assessment Diastolic dysfunction Stress ECHO Cardiac CT angiography Echocardiography - positives
Index of subjects. effect on ventricular tachycardia 30 treatment with 101, 116 boosterpump 80 Brockenbrough phenomenon 55, 125
145 Index of subjects A accessory pathways 3 amiodarone 4, 5, 6, 23, 30, 97, 102 angina pectoris 4, 24, 1l0, 137, 139, 140 angulation, of cavity 73, 74 aorta aortic flow velocity 2 aortic insufficiency
Intermittent pressure overload triggers hypertrophy-independent cardiac dysfunction and vascular rarefaction
Related Commentary, page 1467 Research article Intermittent pressure overload triggers hypertrophy-independent cardiac dysfunction and vascular rarefaction Cinzia Perrino, 1 Sathyamangla V. Naga Prasad,
10/23/2017. Muscular pump Two atria Two ventricles. In mediastinum of thoracic cavity 2/3 of heart's mass lies left of midline of sternum
It beats over 100,000 times a day to pump over 1,800 gallons of blood per day through over 60,000 miles of blood vessels. During the average lifetime, the heart pumps nearly 3 billion times, delivering
IB TOPIC 6.2 THE BLOOD SYSTEM
IB TOPIC 6.2 THE BLOOD SYSTEM TERMS TO KNOW circulation ventricle artery vein THE BLOOD SYSTEM 6.2.U1 - Arteries convey blood at high pressure from the ventricles to the tissues of the body Circulation
SCPA602 Cardiovascular System
SCPA602 Cardiovascular System Associate Professor Dr. Wannee Jiraungkoorskul Department of Pathobiology, Faculty of Science, Mahidol University Tel: 02-201-5563, E-mail: wannee.jir@mahidol.ac.th 1 Objectives
Heart. Heart 2-Tunica media: middle layer (media ='middle') muscle fibers (smooth or cardiac).
t. innermost lumenal General Circulatory system heart and blood vessels walls have 3 layers (inside to outside) 1-Tunica interna: aka tunica intima layer--lumenal layer epithelium--endothelium simple squamous
11/10/2014. Muscular pump Two atria Two ventricles. In mediastinum of thoracic cavity 2/3 of heart's mass lies left of midline of sternum
It beats over 100,000 times a day to pump over 1,800 gallons of blood per day through over 60,000 miles of blood vessels. During the average lifetime, the heart pumps nearly 3 billion times, delivering
RV dysfunction and failure PATHOPHYSIOLOGY. Adam Torbicki MD, Dept Chest Medicine Institute of Tuberculosis and Lung Diseases Warszawa, Poland
RV dysfunction and failure PATHOPHYSIOLOGY Adam Torbicki MD, Dept Chest Medicine Institute of Tuberculosis and Lung Diseases Warszawa, Poland Normal Right Ventricle (RV) Thinner wall Weaker myocytes Differences
Lab 16. The Cardiovascular System Heart and Blood Vessels. Laboratory Objectives
Lab 16 The Cardiovascular System Heart and Blood Vessels Laboratory Objectives Describe the anatomical structures of the heart to include the pericardium, chambers, valves, and major vessels. Describe
Effects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
Index. A Action potential duration, increased, by decreases in sodium current,
Heart Failure Clin 1 (2005) 313 319 Index Note: Page numbers of article titles are in boldface type. A Action potential duration, increased, by decreases in sodium current, 201 202 Adenylyl cyclase, overexpression
In Vivo Animal Models of Heart Disease. Why Animal Models of Disease? Timothy A Hacker, PhD Department of Medicine University of Wisconsin-Madison
In Vivo Animal Models of Heart Disease Timothy A Hacker, PhD Department of Medicine University of Wisconsin-Madison Why Animal Models of Disease? Heart Failure (HF) Leading cause of morbidity and mortality
Declaration of conflict of interest
Declaration of conflict of interest There is no any potential conflict of interest. There is not any financial commitments or funds from private companies. Roles of heat shock transcription factor 1 gene
Treatment with Hydralazine and Nitrates Uri Elkayam, MD
Treatment with Hydralazine and Nitrates Uri Elkayam, MD Professor of Medicine University of Southern California School of Medicine Los Angeles, California elkayam@usc.edu Hydralazine and Isosorbide Dinitrate
Age-related changes in cardiovascular system. Dr. Rehab Gwada
Age-related changes in cardiovascular system Dr. Rehab Gwada Objectives explain the main structural and functional changes in cardiovascular system associated with normal aging Introduction aging results
Extra notes for lab- 1 histology. Slide 1 : cross section in the elastic artery ( aortic arch, ascending aorta, descending aorta )
Extra notes for lab- 1 histology Slide 1 : cross section in the elastic artery ( aortic arch, ascending aorta, descending aorta ) - twin of ascending aorta is the pulmonary trunk. Ascending aorta represents
PRESENTER DISCLOSURE INFORMATION. There are no potential conflicts of interest regarding current presentation
PRESENTER DISCLOSURE INFORMATION There are no potential conflicts of interest regarding current presentation Better synchrony and diastolic function for septal versus apical right ventricular permanent
Conflict of Interest Slide
Comparison of six- month clinical outcomes, event free survival rates of patients undergoing enhanced external counterpulsation (EECP) for coronary artery disease in the United States and Europe Ozlem
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal
Identifying Changes in Myocardial Microstructure via a Novel Sonographic Imaging Algorithm
Identifying Changes in Myocardial Microstructure via a Novel Sonographic Imaging Algorithm The Harvard community has made this article openly available. Please share how this access benefits you. Your
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Table S1: Number and percentage of patients by age category Distribution of age Age
Cardiac Output MCQ. Professor of Cardiovascular Physiology. Cairo University 2007
Cardiac Output MCQ Abdel Moniem Ibrahim Ahmed, MD Professor of Cardiovascular Physiology Cairo University 2007 90- Guided by Ohm's law when : a- Cardiac output = 5.6 L/min. b- Systolic and diastolic BP
Diastology State of The Art Assessment
Diastology State of The Art Assessment Dr. Mohammad AlGhamdi Assistant professor, KSAU-HS Consultant Cardiologist King AbdulAziz Cardiac Center Ministry of National Guard Health Affairs Diagnostic Clinical
Cardiovascular Physiology. Heart Physiology. Introduction. The heart. Electrophysiology of the heart
Cardiovascular Physiology Heart Physiology Introduction The cardiovascular system consists of the heart and two vascular systems, the systemic and pulmonary circulations. The heart pumps blood through
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
SUPPLEMENTARY DATA. Short title: Adipocyte MR induces vascular dysfunction.
Adipocyte-specific mineralocorticoid receptor overexpression in mice is associated with metabolic syndrome and vascular dysfunction - role of redox-sensitive PKG-1 and Rho kinase. Aurelie NGUYEN DINH CAT
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
Gender differences in cardiac left ventricular mass and function: Clinical and experimental observations
ORIGINAL ARTICLE Cardiology Journal 2014, Vol. 21, No. 1, pp. 53 59 DOI: 10.5603/CJ.a2013.0105 Copyright 2014 Via Medica ISSN 1897 5593 Gender differences in cardiac left ventricular mass and function:
Left ventricular hypertrophy: why does it happen?
Nephrol Dial Transplant (2003) 18 [Suppl 8]: viii2 viii6 DOI: 10.1093/ndt/gfg1083 Left ventricular hypertrophy: why does it happen? Gerard M. London Department of Nephrology and Dialysis, Manhes Hospital,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
Echocardiographic and Doppler Assessment of Cardiac Functions in Patients of Non-Insulin Dependent Diabetes Mellitus
ORIGINAL ARTICLE JIACM 2002; 3(2): 164-8 Echocardiographic and Doppler Assessment of Cardiac Functions in Patients of Non-Insulin Dependent Diabetes Mellitus Rajesh Rajput*, Jagdish**, SB Siwach***, A
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
LV FUNCTION ASSESSMENT: WHAT IS BEYOND EJECTION FRACTION
LV FUNCTION ASSESSMENT: WHAT IS BEYOND EJECTION FRACTION Jamilah S AlRahimi Assistant Professor, KSU-HS Consultant Noninvasive Cardiology KFCC, MNGHA-WR Introduction LV function assessment in Heart Failure:
Heart. Structure Physiology of blood pressure and heartbeat
Heart Structure Physiology of blood pressure and heartbeat Location and Anatomy Location and Anatomy Pericardial cavity: surrounds, isolates, and anchors heart Parietal pericardium lined with serous membrane
The cardiovascular system is composed of a pump the heart and blood
5 E X E R C I S E Cardiovascular Dynamics O B J E C T I V E S 1. To understand the relationships among blood flow, pressure gradient, and resistance 2. To define resistance and describe the main factors
10. Thick deposits of lipids on the walls of blood vessels, called, can lead to serious circulatory issues. A. aneurysm B. atherosclerosis C.
Heart Student: 1. carry blood away from the heart. A. Arteries B. Veins C. Capillaries 2. What is the leading cause of heart attack and stroke in North America? A. alcohol B. smoking C. arteriosclerosis
HYPERTENSION: Sustained elevation of arterial blood pressure above normal o Systolic 140 mm Hg and/or o Diastolic 90 mm Hg
Lecture 39 Anti-Hypertensives B-Rod BLOOD PRESSURE: Systolic / Diastolic NORMAL: 120/80 Systolic = measure of pressure as heart is beating Diastolic = measure of pressure while heart is at rest between
REGULATION OF CARDIOVASCULAR SYSTEM
REGULATION OF CARDIOVASCULAR SYSTEM Jonas Addae Medical Sciences, UWI REGULATION OF CARDIOVASCULAR SYSTEM Intrinsic Coupling of cardiac and vascular functions - Autoregulation of vessel diameter Extrinsic
Cardiovascular System. Heart Anatomy
Cardiovascular System Heart Anatomy 1 The Heart Location & general description: Atria vs. ventricles Pulmonary vs. systemic circulation Coverings Walls The heart is found in the mediastinum, the medial
Ventricular Interactions in the Normal and Failing Heart
Ventricular Interactions in the Normal and Failing Heart Congenital Cardiac Anesthesia Society 2015 Pressure-volume relations Matched Left ventricle to low hydraulic impedance Maximal stroke work limited
Coronary Circulation Under normal conditions cardiac muscle metabolism is almost exclusively aerobic depending on oxidative phosorylation to
Coronary Circulation Under normal conditions cardiac muscle metabolism is almost exclusively aerobic depending on oxidative phosorylation to resynthesis the ATP continuously utilized by repetitive, excitation,
Cardiac Conduction System
Cardiac Conduction System What causes the Heart to Beat? Heart contracts by electrical signals! Cardiac muscle tissue contracts on its own an electrical signal is sent out by the heart so that all cells