New Frontiers in Atherosclerotic Disease and Myocardial Infarction: From local inflammation to systemic stem and progenitor cell reaction

HARVARD MEDICAL SCHOOL

The Role of the Various Monocyte Types in Atherothrombotic Disease Protective vs. Detrimental Effects and Therapeutic Implications Matthias Nahrendorf MGH Center for Systems Biology http://csb.mgh.harvard.edu/investigator/matthias_nahrendorf

Chronic variable stress activates hematopoietic stem cells

SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur

Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells

Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells Gabriel Courties*, Fanny Herisson*, Hendrik B. Sager, Timo Heidt, Yuxiang Ye, Ying Wei, Yuan Sun, Nicolas Severe, Partha Dutta, Jennifer Scharff,

Myocardial Infarction Accelerates Atherosclerosis

Myocardial Infarction Accelerates Atherosclerosis The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version

In Vivo Silencing of the Transcription Factor IRF5 Reprograms the Macrophage Phenotype and Improves Infarct Healing

In Vivo Silencing of the Transcription Factor IRF5 Reprograms the Macrophage Phenotype and Improves Infarct Healing The MIT Faculty has made this article openly available. Please share how this access

Targeting Interleukin-1β Reduces Leukocyte Production After Acute Myocardial Infarction

Targeting Interleukin-1β Reduces Leukocyte Production After Acute Myocardial Infarction The Harvard community has made this article openly available. Please share how this access benefits you. Your story

Fight-or-Flight: Understanding Our Body's Response to Adrenaline

Transcript Details This is a transcript of an educational program accessible on the ReachMD network. Details about the program and additional media formats for the program are accessible by visiting: https://reachmd.com/programs/primary-care-today/fight-or-flight-understanding-our-bodys-response-toadrenaline/10349/

Depression and Subclinical Vascular Diseases in Psoriasis

Depression and Subclinical Vascular Diseases in Psoriasis Nehal N. Mehta, MD MSCE FAHA Section Chief, Inflammation and Cardiometabolic Diseases National Heart, Lung, and Blood Institute, USA Lasker Clinical

Myocardial infarction (MI) inflicts a sterile cardiac wound

Targeting Interleukin-1β Reduces Leukocyte Production After Acute Myocardial Infarction Hendrik B. Sager, MD*; Timo Heidt, MD*; Maarten Hulsmans, PhD; Partha Dutta, DVM, PhD; Gabriel Courties, PhD; Matthew

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the

The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the limbs and major organs. A range of important pathologies

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN

Innate Immunity in Atherosclerosis

Innate Immunity in Atherosclerosis Peter Libby Brigham & Women s Hospital Harvard Medical School IAS Amsterdam May 26, 2015 ACS Stable demand angina Characteristics of Atherosclerotic Plaques Associated

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest

DECLARATION OF CONFLICT OF INTEREST No conflicts of interest University Heart Centre Tübingen Angiogenic actions of platelets Meinrad Gawaz, MD, FESC Tübingen, Germany ESC 2011 Paris GPIb GPIb GPVI TxA2

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

Multi-Modality Imaging of Atherosclerosis in HIV Ahmed Tawakol, MD

Multi-Modality Imaging of Atherosclerosis in HIV Ahmed Tawakol, MD Director, Integrative Bio-Imaging Trials Program Co-Director Cardiac MR PET CT Program Massachusetts General Hospital Harvard Medical

Cellular Biology. Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells

Cellular Biology Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells Gabriel Courties,* Fanny Herisson,* Hendrik B. Sager, Timo Heidt, Yuxiang Ye, Ying Wei, Yuan Sun, Nicolas Severe, Partha

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

Modifying atherosclerosis in cardiometabolic disease: targeting inflammation!

Modifying atherosclerosis in cardiometabolic disease: targeting inflammation Peter Libby Brigham & Women s Hospital Harvard Medical School Primary Care Congress for Cardiometabolic Health Boston April

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

The Role of Rac Signaling in The Perivascular Niche

The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

Hans Strijdom SA Heart Meeting November 2017

Hans Strijdom SA Heart Meeting November 2017 HIV-infection and ART, but not high sensitivity CRP, are associated with markers of vascular function: Results from the Western Cape cohort of the EndoAfrica

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation

NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang

NEUTROPHIL-PLATELET INTERACTION

NEUTROPHIL-PLATELET INTERACTION Johnny Nijm, MD; PhD Specialist in Internal medicine, Cardiology & Clinical Physiology Department of Medicine Diagnostic, Division of Clinical Physiology, County Hospital

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

Liver-Resident Macrophage Necroptosis Orchestrates Type 1 Microbicidal Inflammation and Type-2- Mediated Tissue Repair during Bacterial Infection

Liver-Resident Macrophage Necroptosis Orchestrates Type 1 Microbicidal Inflammation and Type-2- Mediated Tissue Repair during Bacterial Infection Camille Blériot, Théo Dupuis, Grégory Jouvion, Gérard Eberl,

Leukocytes Link Local and Systemic Inflammation in Ischemic Cardiovascular Disease

Leukocytes Link Local and Systemic Inflammation in Ischemic Cardiovascular Disease The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

DECLARATION OF CONFLICT OF INTEREST. No disclosures

DECLARATION OF CONFLICT OF INTEREST No disclosures micrornas: Role in progression of atherosclerosis Christian Weber Institute for Cardiovascular Prevention (IPEK) Ludwig-Maximilians-University Munich

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

Pathology of Coronary Artery Disease

Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology

Arteriosclerosis & Atherosclerosis

Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

Myocardial infarction

NEW CARDIAC MARKERS AND CARDIAC REGENERATION Päivi Lakkisto, MD, PhD Specialist in Clinical Chemistry Clinical lecturer University of Helsinki and HUSLAB Minerva Institute for Medical Research Myocardial

Biomarkers of immunity and inflammation for use in nutrition interventions: ILSI Europe work on selection criteria and interpretation

NIHR Southampton Biomedical Research Centre in nutrition Biomarkers of immunity and inflammation for use in nutrition interventions: ILSI Europe work on selection criteria and interpretation Philip C.

A real life example In human studies, we quantify ~120 plasma related proteins Monocytes MMP9 Macrophages TNFα IL1ß platelet derived growth factor IFNγ MMP1 MMP8 MMP13 Myeloid Related Protein14 CD40

Haematopoietic stem cells

Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An

Supporting Information

Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

Nature Medicine doi: /nm.3150

Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

Innovation Interlude: Molecular Imaging in Cardiology. Celestial Doppelgangers and Relativity

Innovation Interlude: Molecular Imaging in Cardiology Jonathan R. Lindner, M.D. M. Lowell Edwards Professor of Cardiology Knight Cardiovascular Institute Oregon National Primate Research Center Oregon

Peter Libby Brigham & Women s Hospital Harvard Medical School

Circulating and imaging biomarkers of atherosclerosis and prospects of precision management and personalized approach of cardiovascular disease Peter Libby Brigham & Women s Hospital Harvard Medical School

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

Η Πυρηνική Καρδιολογία Το 2017 ΟΜΑΔΑ ΕΡΓΑΣΙΑΣ ΑΠΕΙΚΟΝΙΣΤΙΚΩΝ ΤΕΧΝΙΚΩΝ

Η Πυρηνική Καρδιολογία Το 2017 ΟΜΑΔΑ ΕΡΓΑΣΙΑΣ ΑΠΕΙΚΟΝΙΣΤΙΚΩΝ ΤΕΧΝΙΚΩΝ huma human n Setting diagnosis of the early stages of chronic diseases (i.e cancer, neuropsychiatric, cardiovascular disorders), in

DISCLOSURE. I have the following financial relationships:

DISCLOSURE I have the following financial relationships: Consultant for: Fate Therapeutics, GlaxoSmithKline, Bone Therapeutics, G1 Therapeutics Contracted Research for: GlaxoSmithKline Royalties from:

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature19814 Figure 3e - - - Beads: Hep SA Sup Hep SA Sup Hep - SA - Sup 150 102 76 102 76 Blot: NP-1 Blot: MECA-32 Blot: VEGF Figure 3f Rbt IgG ctrl IP VEGF IP Extended

Ground-breaking advances in atherosclerosis and heart

Reviews Molecular Imaging of Coronary Atherosclerosis and Myocardial Infarction Considerations for the Bench and Perspectives for the Clinic Florian Leuschner, Matthias Nahrendorf Abstract: Motivated by

Aneurysms & a Brief Discussion on Embolism

Aneurysms & a Brief Discussion on Embolism Aneurysms, overview = congenital or acquired dilations of blood vessels or the heart True aneurysms -involve all three layers of the artery (intima, media, and

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

The 10 th International & 15 th National Congress on Quality Improvement in Clinical Laboratories

The 10 th International & 15 th National Congress on Quality Improvement in Clinical Laboratories Cardiac biomarkers in atherosclerosis Najma Asadi MD-APCP Ross and Colleagues in 1973: Response to Injury

Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson

Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson Center for Molecular Medicine Karolinska Institute Stockholm, Sweden DECLARATION OF CONFLICT OF INTEREST Goran Hansson

Nanobiologics Promotes Organ Transplant Acceptance

Immunity, Volume 49 Supplemental Information Inhibiting Inflammation with Myeloid Cell-Specific Nanobiologics Promotes Organ Transplant Acceptance Mounia S. Braza, Mandy M.T. van Leent, Marnix Lameijer,

Monocytes and macrophages in abdominal aortic aneurysm

Monocytes and macrophages in abdominal aortic aneurysm Juliette Raffort 1, 2, 3, 4, Fabien Lareyre 1, 4, 5, Marc Clément 1, Réda Hassen-Khodja 4,5, Giulia Chinetti 3, 4, Ziad Mallat 1, 2 1 Division of

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret

ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was

Obesity is related to a higher inflammatory responsive state of circulating cells after stimulation of toll like receptor 2 and 4.

Toll Like Receptor Response and traditional risk factors for atherosclerosis: Obesity is related to a higher inflammatory responsive state of circulating cells after stimulation of toll like receptor 2

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.

CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins

Novel Markers of Arterial Dysfunction

혈관연구회창립심포지움, 3 월 3 일, 2005 Novel Markers of Arterial Dysfunction Kwang Kon Koh, MD, FACC, FAHA Cardiology Gachon Medical School Incheon, Korea Atherosclerosis: A progressive process PHASE I: Initiation

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes

Long-term innate immune memory via effects on bone marrow progenitors

Long-term innate immune memory via effects on bone marrow progenitors Helen S Goodridge, PhD helen.goodridge@csmc.edu Regenerative Medicine Institute, Cedars-Sinai Medical Center, Los Angeles, USA Fondation

Keeping the Small Aortic Aneurysm Small

Keeping the Small Aortic Aneurysm Small John A. Curci, MD, FACS Associate Professor of Vascular and Endovascular Surgery Director, Aortic Aneurysm Research Laboratories, Washington University Principal

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were

Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A

Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow

White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

Nature Immunology: doi: /ni.3412

Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues

Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages

NOVEL BIOMARKERS AS RISK FACTORS FOR CARDIOVASCULAR DISEASE

NOVEL BIOMARKERS AS RISK FACTORS FOR CARDIOVASCULAR DISEASE Amy Alman, PhD Assistant Professor of Epidemiology College of Public Health University of South Florida Causation is a concept central to epidemiology

Immunological response to metallic implants

Immunological response to metallic implants Doc. dr. Peter Korošec Head of Laboratory for Clinical Immunology & Molecular Genetics Head of Research & Development Department University Clinic of Respiratory

BCR-ABL - LSK BCR-ABL + LKS - (%)

Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

Vulnerable Plaque. Atherothrombosis

Vulnerable Plaque Nuove acquisizioni sull'aterosclerosi: placca vulnerabile Marina Camera Dip. Scienze Farmacologiche, Facoltà di Farmacia, Università degli Studi di Milano & Laboratorio di Biologia Cellulare

Future Applications of Contrast Echocardiography

Future Applications of Contrast Echocardiography Jonathan R. Lindner, M.D. Knight Cardiovascular Institute Oregon Health & Science University Portland, Oregon, USA Disclosures: Investigator-initiated grant

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

Statins and endothelium function

Statins and endothelium function Matthias Endres Berlin, Germany Klinik und Poliklinik für Neurologie Conflict of interest: research grant from AstraZeneca from prevention to acute therapy... Pleiotropic

Inflammation plays a major role in atherosclerosis, 1 and

Soluble P-Selectin and the Risk of Future Cardiovascular Events Paul M. Ridker, MD; Julie E. Buring, ScD; Nader Rifai, PhD Background P-selectin, a cell-surface adhesion molecule involved in leukocyte

Sleep apnea as a risk factor for cardiovascular disease

Sleep apnea as a risk factor for cardiovascular disease Malcolm Kohler Chair Respiratory Medicine, Clinical Director, Department of Pulmonology, University Hospital Zurich Incidence of fatal cardiovascular

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

Ly-6Chi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata

Ly-6Chi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata The Harvard community has made this article openly available. Please share how this access

Supplemental Table I.

Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

Chronic Skin-Specific Inflammation Promotes Vascular Inflammation and Thrombosis

ORIGINAL ARTICLE Chronic Skin-Specific Inflammation Promotes Vascular Inflammation and Thrombosis Yunmei Wang 1,2, Huiyun Gao 1,2, Candace M. Loyd 3, Wen Fu 3, Doina Diaconu 3, Shijian Liu 1,2, Kevin D.

Classification of Endothelial Dysfunction. Stefano Taddei Department of Internal Medicine University of Pisa, Italy

Classification of Endothelial Dysfunction Stefano Taddei Department of Internal Medicine University of Pisa, Italy Pathogenesis of atherosclerosis from endothelial dysfunction to clinical disease endothelial

SUPPLEMENTARY INFORMATION

doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

Tumor associated macrophages in endocrine-related cancers. Sun Wook Cho, M.D, Ph.D Seoul National University Hospital

Tumor associated macrophages in endocrine-related cancers Sun Wook Cho, M.D, Ph.D Seoul National University Hospital Tumor Microenvironment Fibroblasts Immune cells Angiogenesis Tumor microenvironment=cancer

Immune response to infection

Immune response to infection Dr. Sandra Nitsche (Sandra.Nitsche@rub.de ) 20.06.2018 1 Course of acute infection Typical acute infection that is cleared by an adaptive immune reaction 1. invasion of pathogen

Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell

Abstract Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell niche is a microenvironment of cells that maintain stem cell functionality, and one example is the