ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
|
|
|
- Darcy Fletcher
- 6 years ago
- Views:
Transcription
1 ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina Bürger 1, Petteri Rinne 1, Linda Beckers 2, Angelika Dandl 1, Sigrid Reim 1, Maiwand Ahmadsei 1, Jan Van den Bossche 2, Lesca M. Holdt 7, Remco T.A. Megens 1,3, Martin M. Schmitt 1, Menno de Winther 1,2, Eric A. Biessen 3,, Jannie Borst 4, Alexander Faussner 1, Christian Weber 1,3,6, Esther Lutgens #1,2, Norbert Gerdes #1,2 *, # These authors contributed equally. 1. Institute for Cardiovascular Prevention (IPEK), LMU Munich, Munich, Germany 2. Department of Medical Biochemistry, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, The Netherlands 3. Cardiovascular Research Institute Maastricht (CARIM), University of Maastricht, The Netherlands 4. Division of Immunology, The Netherlands Cancer Institute, Amsterdam, The Netherlands.. Institute for Molecular Cardiovascular Research (IMCAR), RWTH Aachen, Germany 6. DZHK (German Centre for Cardiovascular Research), partner site Munich Heart Alliance, Munich, Germany 7. Department of Laboratory Medicine, LMU Munich, Munich, Germany Short title: Winkels, CD7 in atherosclerosis 1
2 A B αβt cells γδt cells myeloid cells Macrophages CD7 expression [MFI] C 3 CD7 D 2 3 αβt cells γδt cells myeloid cells Macrophages CD7 expression [MFI] 2 1 CD7 expression [MFI] 2 1 nonmyeloid cells CD11b Ly6G CD11b Ly6G hi Ly6C CD11b Ly6G lo Ly6C CD11b Ly6G nonmyeloid cells CD11b Ly6G CD11b Ly6G hi Ly6C CD11b Ly6G lo Ly6C CD11b Ly6G Supplement Figure I CD7 is expressed on myeloid cells and macrophages. (A) Representative histograms displaying CD7 expression determined by flow cytometry on splenic leukocyte subsets of a 28week old hyperlipidemic mouse. (BC) Quantification of CD7 expression of leukocyte subsets in the (B) spleen, (C) blood, and (D) bone marrow of hyperlipidemic mice (age=28 weeks; n=3). Myeloid cells are all CD11b cells of living leukocytes. Macrophages are CD11b F4/8 cells of living leukocytes. MFI, mean fluorescence intensity.
3 [% of F4/8 ] CD64 Cd7 / Cd7 / Supplement Figure II CD7deficiency does not alter M, M1, and M2 abundance in untreated BMDM cultures. Bone marrowderived macrophages (BMDMs) from Cd7 / or Cd7 / mice were analyzed by flow cytometry for CD64 and CD31 as M1 and M2 marker, respectively. Data is presented as mean±sem (n=3). CD64 CD31 CD31
4 IL12p7 [pg/ml] IL6 [pg/ml] TNFα [pg/ml] Cd7 / Cd7 / n.d. n.d. M M1 M2 M M1 M2 M M1 M2 Supplement Figure III CD7deficiency does change IL12p7, IL6, and TNFa secretion by untreated or polarized macrophages. The supernatant of bone marrowderived macrophages (BMDMs) from Cd7 / or Cd7 / mice left untreated or polarized with LPS or IL4 to generate M1 or M2 macrophages respectively, was assayed by ELISA for concentrations of IL12p7, IL6, and TNFα, n.d. abbreviates not detectable. Data is presented as mean±sem (n=3).
![Collagen [SR area % of plaque area] A B C 1 1 Cd7 / Cd7 / Smooth muscle cells [ASMA area % of plaque area 1 1 Cd7 / Cd7 / D E F CD4 [cells/mm²] 2 2 1 1 Cd7 / Cd7 / G Cd7 / Cd7 / CD4 DAPI H CD4 DAPI](/docs-images/72/66719477/images/5-0.jpg "ICAM area [µm²]/ Plaque endothelial length [µm] 3 2 1 Cd7 / Cd7 / VCAM area [µm²]/ Plaque endothelial length [µm] 4 3 2 1 Cd7 / Cd7 / Collagen [SR area % of plaque area] 4 3 2 1 Smooth muscle cells")
![[ASMA area % of plaque area] 2 1 1 Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / CD4 [cells/mm²] 3 2 1 Supplement Figure IV Lack of CD7 does not change collagen, smooth muscle cell, or CD4 cell content or](/docs-images/72/66719477/images/5-1.jpg "adhesion molecule expression. (AE) Irradiated mice were reconstituted with Cd7 / or Cd7 / bone marrow (n=114 (: Cd7 / ), n=121 (: Cd7 / )).")
5 Collagen [SR area % of plaque area] A B C 1 1 Cd7 / Cd7 / Smooth muscle cells [ASMA area % of plaque area 1 1 Cd7 / Cd7 / D E F CD4 [cells/mm²] Cd7 / Cd7 / G Cd7 / Cd7 / CD4 DAPI H CD4 DAPI ICAM area [µm²]/ Plaque endothelial length [µm] Cd7 / Cd7 / VCAM area [µm²]/ Plaque endothelial length [µm] Cd7 / Cd7 / Collagen [SR area % of plaque area] Smooth muscle cells [ASMA area % of plaque area] Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / CD4 [cells/mm²] Supplement Figure IV Lack of CD7 does not change collagen, smooth muscle cell, or CD4 cell content or adhesion molecule expression. (AE) Irradiated mice were reconstituted with Cd7 / or Cd7 / bone marrow (n=114 (: Cd7 / ), n=121 (: Cd7 / )). (A) Percentage of sirius red positive stained area in lesions of the ascending aorta. (BE) Immunofluorescent stainings were analyzed for (B) alpha smooth muscle actin, (C) CD4, representative photomicrographs (right) are displayed (Scale bar = 1 µm), (D) ICAM1, and (E) VCAM1 in crosssections of the ascending aorta. (D,E) ICAM1 and VCAM1 area was quantified on the lesions endothelial area and further correlated to endothelial length. (FH) Quantifications of stainings in crosssections of the ascending aorta of 18week old Cd7 / or Cd7 / mice (n=121). (F) Percentage of sirius red positive stained area in aortic lesions. Immunofluorescent stainings were analyzed for (G) alpha smooth muscle actin and (H) CD4 in crosssections of the ascending aorta.
6 A CD11b Ly6G [% of CD4 ] Cd7 / Cd7 / Ly6C hi [% of CD11b Ly6G ] Ly6C lo [% of CD11b Ly6G ] D CD11b Ly6G [% of CD4 ] Ly6C hi [% of CD11b Ly6G ] Ly6C lo [% of CD11b Ly6G ] G CD11b Ly6G [% of CD4 ] 1 1 Ly6C hi [% of CD11b Ly6G ] Ly6C lo [% of CD11b Ly6G ] B Annexin V LD [% of Ly6C hi ] % 69.3% Cd7 / 1.86% 24.9% 6.27% 66.% Cd7 / 3.2%.7% E Annexin V LD [% of Ly6C hi ] Cd7 / Cd7 / 16.2% 8.66% 17.1% 7.9% 4.19% 73.2% 7.92% 1.74% H Annexin V LD [% of Ly6C hi ] Cd7 / Cd7 / 6.28%.11% 1.6% 84.7% 3.96% 82.3%.4% 2.11% C Annexin V LD [% of Ly6C lo ] Cd7 / Cd7 / 9.67%.43% 1.9% 89.6%.26% 86.9%.64% 1.4% F Annexin Annexin V LD [% of Ly6C lo ] Cd7 / Cd7 / 16.9% 8.69% 14.7% 73.7%.62% 74.7% 9.82%.74% I Annexin V LD [% of Ly6C lo ] Cd7 / Cd7 / 16.4% 6.47% 13.4% 76.7%.46% 82.2% 3.72%.66% LD Supplement Figure V CD7 deficiency does not influence abundance and apoptosis of total monocytes and Ly6C hi and Ly6C lo subsets. Flow cytometric analysis of (AC) blood, (DF) splenic, and (GI) bone marrow suspensions for distribution of total monocytes, Ly6C hi monocytes, and Ly6C lo monocytes from 18 weekold male Cd7 / or Cd7 /. Cell viability assayed by AnnexinV and Live/Dead for (B,C) blood, (E,F) splenic, and (H,I) and bone marrow Ly6C hi and Ly6C lo monocytes, respectively. Representative flow cytometric plots are displayed for each genotype and monocyte subset. Data is presented as mean±sem.
![A C 1 8 6 4 2 MFI Ki67 [of Treg] Foxp3 Treg [% of CD4 ] 1 1 Cd7 / Cd7 / B MFI Ki67 [of Treg] Foxp3 Treg [% of CD4 ] 2 2 1 1 2 2 1 1 Cd7 / * ** Cd7 / Normalized to mode D MFI BCL2 [of Treg] 6 4 3 2 1](/docs-images/72/66719477/images/7-0.jpg "Cd7 / Cd7 / 8 MFI BCL2 [of Treg] 6 4 2 Cd7 / * Cd7 / Normalized to mode Ki67 E Foxp3 [cells/mm²] 1 8 6 4 2 Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Foxp3 DAPI BCL2 Cd7 / Cd7 / Foxp3 DAPI F 2 1 1 Cd7 / *")
7 A C MFI Ki67 [of Treg] Foxp3 Treg [% of CD4 ] 1 1 Cd7 / Cd7 / B MFI Ki67 [of Treg] Foxp3 Treg [% of CD4 ] Cd7 / * ** Cd7 / Normalized to mode D MFI BCL2 [of Treg] Cd7 / Cd7 / 8 MFI BCL2 [of Treg] Cd7 / * Cd7 / Normalized to mode Ki67 E Foxp3 [cells/mm²] Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Foxp3 DAPI BCL2 Cd7 / Cd7 / Foxp3 DAPI F Cd7 / * Cd7 / Supplement Figure VI CD7 deficiency reduces splenic but not aortic Treg abundance. (AE) Irradiated mice were reconstituted with Cd7 / or Cd7 / bone marrow. Flow cytometric analysis of (A) aortic and (B) splenic suspensions for Foxp3 Treg. (C) Ki67 expression of aortic (left) and splenic (middle) Treg. Representative flow cytometric histograms Ki67 expression on splenic Treg (right). (D) BCL2 expression of aortic (left) and splenic (middle) Treg. Representative flow cytometric histograms depicting BCL2 expression on splenic Treg (right). (E) Immunofluorescent stainings for Foxp3 in crosssections of the ascending aorta. Quantifications (left) and representative photomicrographs (right) are displayed. Arrows indicate positive stained cells; Scale bar = 1 µm. (F) Flow cytometric analysis of splenic suspensions of 18 weekold, male Cd7 / or Cd7 / mice for Foxp3 Treg. (n=71). Data is presented as mean±sem. *p <., **p <.1. Foxp3 Treg [% of CD4 ]
8 Cholesterol [mm] 1 1 Cd7 / Cd7 / HDL LDL VLDL Supplement Figure VII CD7 deficiency does not affect plasma lipoprotein cholesterol distribution. Cholesterol distribution in different lipoprotein fractions separated by ultracentrifugation. Plasma from mice reconstituted with Cd7 / or Cd7 / bone marrow (n=4/group) was analyzed. HDL, highdensity lipoprotein; VLDL, very lowdensity lipoprotein LDL, lowdensity lipoprotein. Data is presented as mean±sem. Total
9 Supplement Table I. Distribution of T cell subsets in compound mutant mice. Organ Blood Lymph nodes Spleen Mouse strain Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cd7 / Cell subset Parental Gate n Mean SD n Mean SD p n Mean SD n Mean SD p n Mean SD n Mean SD p CD3 of CD ± ± ± ± ± ± CD4 of CD ± ± ± ± ± ± 4.79 activated CD4 (CD44 CD62L ) not activated CD4 (CD44 CD62L ) of CD ± ± ± ± ± ± 11. of CD ± ± ± ± ± ± 11. Treg (CD4 Foxp3 ) of CD ± ± ± ± 2.1 ** ± ± 1.83 * CD8 of CD ± ± ± ± ± ± 6.21 central memory CD8 (CD44 CD62L ) effector memory CD8 (CD44 CD62L ) naive CD8 (CD44 CD62L ) of CD ± ± ± ± ± ± 6.92 of CD ± ± ± ±.92 *** 7.46 ± ± 3.77 of CD ± ± ± ± ± ± 1.3 Mean ± SD. Statistical significance was calculated for groups pairwise by 2tailed t test. *p <., **p <.1, **p <.1, ***p <.1
10 Supplement Table II. Distribution of T cells subsets in organs of bone marrow chimeric mice. Organ Lymph node Spleen Bone marrow transplanted into recipient Cd7 / Cd7 / Cd7 / Cd7 / Cell subset Parental Gate n Mean SD n Mean SD p n Mean SD n Mean SD p CD3 of CD ± ± 8.9 * ± ± 3.38 n.s. CD4 of CD ± ± 2.27 * ± ± 4.1 n.s. activated CD4 (CD44 CD62L ) not activated CD4 (CD44 CD62L ) of CD ± ± 3.19 n.s ± ± 3. n.s. of CD ± ± 4.73 n.s. 8.4 ± ± 4.22 n.s. Treg (CD4 Foxp3 ) of CD ± ± 1.6 n.s ± ± 1.7 * CD8 of CD ± ± 3.1 n.s ± ± 1.68 n.s. central memory CD8 (CD44 CD62L ) effector memory CD8 (CD44 CD62L ) naive CD8 (CD44 CD62L ) of CD ± ± 4.7 n.s ± ±.1 n.s. of CD ± ± 2.44 n.s ± ± 2.26 * of CD ± ± 3.63 n.s ± ± 7.71 n.s. Mean ± SD. Statistical significance was calculated for groups pairwise by 2tailed t test. *p <.
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Chronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
DECLARATION OF CONFLICT OF INTEREST. No disclosures
DECLARATION OF CONFLICT OF INTEREST No disclosures micrornas: Role in progression of atherosclerosis Christian Weber Institute for Cardiovascular Prevention (IPEK) Ludwig-Maximilians-University Munich
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
16 Sep 2016 Postdoctoral fellow at the Division of Inflammation Biology, La Jolla Institute for Allergy and Immunology, (Director: Prof.
Curriculum vitae Name Holger Winkels, Ph.D. Office address Division of Inflammation Biology La Jolla Institute for Allergy & Immunology 9420 Athena Circle Drive, La Jolla, CA, 92037 Email: holger@lji.org
Supplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
Nanobiologics Promotes Organ Transplant Acceptance
Immunity, Volume 49 Supplemental Information Inhibiting Inflammation with Myeloid Cell-Specific Nanobiologics Promotes Organ Transplant Acceptance Mounia S. Braza, Mandy M.T. van Leent, Marnix Lameijer,
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
Fisher et al. Supplemental Figure 1
Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000
A Slfn2 mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence
Supplementary Information A Slfn mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence Michael Berger, Philippe Kres, Karine Crozat, Xiaohong Li, Ben A. Croker, Owen
Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Supporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution
Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Material to Manuscript SREP A
Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Supplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
?Who binds to it. ? Who binds these inflammatory proteins RAGE SUGAR-FREE GLYCOBIOLOGY INFLAMMATION. BASIC SCIENCE?sugar chain structure
SUGAR-FREE GLYCOBIOLOGY BASIC SCIENCE?sugar chain structure Unusual Sugar Chain It -- is a carboxylate Make lots of It Make an It antibody Inflammatory proteins?who binds to it? Who binds these inflammatory
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
SUPPLEMENTAL MATERIAL. Number of patients 14
SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%)
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Transcription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
SUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
Liver-Resident Macrophage Necroptosis Orchestrates Type 1 Microbicidal Inflammation and Type-2- Mediated Tissue Repair during Bacterial Infection
Liver-Resident Macrophage Necroptosis Orchestrates Type 1 Microbicidal Inflammation and Type-2- Mediated Tissue Repair during Bacterial Infection Camille Blériot, Théo Dupuis, Grégory Jouvion, Gérard Eberl,
Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
Nature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson
Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson Center for Molecular Medicine Karolinska Institute Stockholm, Sweden DECLARATION OF CONFLICT OF INTEREST Goran Hansson
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
Apolipoprotein AI prevents regulatory to follicular helper T cell switching during atherosclerosis
ARTICLE DOI: 1.138/s41467-18-3493- OPEN Apolipoprotein AI prevents regulatory to follicular helper T cell switching during atherosclerosis Dalia E. Gaddis 1, Lindsey E. Padgett 1, Runpei Wu 1, Chantel
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Imtiyaz et al., Fig. S1
. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Information
Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1
Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe / mice during disease regression
Research article Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe / mice during disease regression Stephane Potteaux, 1 Emmanuel L. Gautier, 1 Susan B. Hutchison,
Supplementary information
Supplementary information Intrahepatic myeloid cell-aggregates enable local CD8 + T cell expansion and successful immunotherapy against chronic viral liver infection Li- Rung Huang, Dirk Wohlleber, Florian
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplemental Information. Tissue-Resident Macrophages in Pancreatic. Ductal Adenocarcinoma Originate from Embryonic
Immunity, Volume 7 Supplemental Information Tissue-Resident Macrophages in Pancreatic Ductal Adenocarcinoma Originate from Embryonic Hematopoiesis and Promote Tumor Progression Yu Zhu, John M. Herndon,
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)