MCD-microRNA. WU Hong-quan, LIU Di-chuan *, TONG Xin, CAI Min, HUANG Jing. (LVIDd) A [ ] (2012)

Transcription

1 MCD-microRNA [ ] A (MCD)-microRNA MCD MCD 4 MCD-microRNA HEK293 PCR MCD mrna ( ) 7 7 ( + ) MCD-microRNA 4 4d 1 28d (LVEF) (FS) (LVIDd)A PCR 1 MCD mrna82% LVEF FS (P 0.05) (P 0.05) (P 0.05) (P 0.05) A (P 0.05) LVIDd (P>0.05) (P 0.05) MCDmicroRNA A [ ] RNAs RNA [ ] [ ] A [ ] (2012) WU Hong-quan, LIU Di-chuan *, TONG Xin, CAI Min, HUANG Jing Department of Cardiology, Second Affiliated Hospital of Chongqing Medical University, Chongqing , China * Corresponding author, ldc670220@163. com This work was supported by the National Natural Science Foundation of China( ) [Abstract] Objective To evaluate the effect of the targeted inhibition of myocardial malonyl-coa decarboxylase (MCD) by ultrasound microbubble mediated MCD-microRNA interference plasmids on cardiac function in rats with myocardial infarction (MI) and its possible mechanism. Methods The MCD expression plasmid and four MCD-microRNA interference plasmids to be screened were co-transfected into HEK293 cells. The levels of MCD mrna were determined by real-time fluorescence quantitative PCR, and interference sequence with the highest rate of suppression was selected. MI model was reproduced by ligating the left anterior descending coronary artery. The 28 rats with myocardial infarction were randomly assigned into four experimental groups: MI + saline (group 1), MI + plasmid (group 2), MI + ultrasound + plasmid (group 3), MI + ultrasound + microbubble + plasmid (group 4), 7 rats in each group. An alternative group of sham-operated + saline served as control. The mixture of the selected interference plasmids and lipid microbubbles were co-transfected once every four days into rats with MI for 4 weeks mediated by ultrasound. After transfection for 28 days, the changes in left ventricular ejection fraction (LVEF), short axis fractional shortening (FS), left ventricular end-diastolic diameter (LVIDd) were examined by echocardiography, and MCD and lactic acid levels were determined by high-performance liquid chromatography method and enzyme-linked immunosorbent assay respectively. Results One MCD-microRNA interference plasmid with the highest inhibition rate, which was 82%, was selected according to the result of real-time fluorescence quantitative PCR. In animal experiments, the levels of LVEF and FS in the group 4 were both higher than those [ ] ( ) [ ] [ ] ( ) [ ] ldc670220@163.com

2 in other MI intervention groups (P<0.05), but significantly lower than those in the control group (P<0.05). The lactic acid level was lower in group 4 than in other MI-intervention groups (all P <0.05), but significantly higher than that in the control group (P<0.05). There was no significant difference in LVIDd level between the intervention groups (P>0.05), but it was significantly lower than that in the control group (P<0.05). Conclusion That MCD-microRNA interference plasmids were targetedly transfected into infarcted myocardium as mediated by ultrasound microbubble, and they are able to increase malonyl CoA level, reduce lactic acid content, and delay the deterioration of cardiac function, although it has no effect to prevent ventricular dilatation. [Key words] myocardial infarction; mirornas; RNA interference A(malonyl-CoA) -1(CPT-1) [1] A (MCD) A [2-3] MCD [4] MCD MCD-microRNA MCD Wistar 200~250g HEK293 Polyjet TM SignaGen RNA SYBR PrimeScript RT Master Mix TaKaRa DMEM Hyclone A 1 4- (DTE) Sigma pires2-dsred-mcd MCD-microRNA Invitrogen HEK293 pires2-dsred-mcd pires2-dsred-mcd (MCDmicroRNA-Negative control) 1 4 pires2-dsred-mcd 4 MCD-microRNA MCD-microRNA-1 MCD-microRNA-2 MCD-microRNA-3 MCD-microRNA-4 microrna microrna-1 5'-TGCTGAGTAGAAGACAGCAGCAGCGAGT TTTGGCCACTGACTGACTCGCTGCTTGTCTTCT ACT-3' 5'-CCTGAGTAGAAGACAAGCAGCG AGTCAGTCAGTGGCCAAAACTCGCTGCTGCTGT CTTCTACTC-3' microrna-2 5'-TGCTGTTCT GAAGCACCTCACAGGGCGTTTTGGCCACTGAC TGACGCCCTGTGGTGCTTCAGAA-3' 5'-CC TGTTCTGAAGCACCACAGGGCGTCAGTCAGTGG CCAAAACGCCCTGTGAGGTGCTTCAGAAC-3' microrna-3 5'-TGCTGAGACTTCGCCCACTCA CCACTGTTTTGGCCACTGACTGACAGTGGTGAG GGCGAAGTCT-3' 5'-CCTGAGACTTCGCCC TCACCACTGTCAGTCAGTGGCCAAAACAGTGGT GAGTGGGCGAAGTCTC-3' microrna-4 5'-TG CTGTTGACCATGAGGCCGCACGAGGTTTTGGC CACTGACTGACCTCGTGCGCTCATGGTCAA-3' 5'-CCTGTTGACCATGAGCGCACGAGGTCAGT CAGTGGCCAAAACCTCGTGCGGCCTCATGGTCA AC-3' 5'-TGCTGAAATGTACTGCGC GTGGAGACGTTTTGGCCACTGACTGACGTCTCC ACGCAGTACATTT-3' 5'-CCTGAAATGTACT GCGTGGAGACGTCAGTCAGTGGCCAAAACGTCT CCACGCGCAGTACATTTC-3' 6 Polyjet TM 1 g:3 l 48h MCD MCD-microRNA MCD-microRNA 48h 1ml TRIpure RNA ( RP2402) RNA cdna 37 15min 85 5s 4 MCD GAPDH TaK ar a MCD 5'-TACTTCTTCTCCCACTGCTCCAC-3' 5'-CTCGTTCCTCCCATACTCCTTTC-3' 5'-GAAGGTGAAGGTCGGAGTC-3' 5'-GAAGATGGTGATGGGATTTC-3' PCR SYBR Premix Ex Taq TMII 10 l

3 0.8 l(0.4mmol/l) ROX Reference Dye(50 ) 0.4 l(0.2mmol/l) cdna 2 l dh 2 O 6 l 20 l 95 30s 95 5s 60 31s 40 Ct 2 Ct mg MCD-microRNA 1.5ml 37 30min 50s PBS 4 10% (300mg/kg) 1.3ml ( 2mg) ie33 1.6MHz 3.2MHz 1.3 4~8 1 28d 4d ~250g Wistar 28 10% (300mg/kg) 70 /min 1:1 10~13ml ml - + MCD-microRNA + + MCD-microRNA ml MCD-microRNA 7 Wista [5] 1.5ml PCR MCD-mRNA 200mg RNA RNA cdna PCR 2 Ct A 5% 50 mol/l DTE ( 1mg:9 l) g 10min 0.22 m A [6] 200mg 1.8ml PBS g 15min 530nm (LVEF) (fractional shortening FS) (LVIDd) 1.3 SPSS 17.0 x±s P PCR MCD-microRNA 48h HEK293 80% ( 1) 1 HEK293 ( 200) Fig.1 Transfected HEK293 cells (Inverted fluorescence microscopy 200) A. Positive control B. Cells transfected with MCD-miroRNA interfering plasmid 2.2 PCR HEK293 MCD mrna HEK293 4 MCD mrna (P 0.05) 1 MCD mrna 82% (P 0.05) MCD-mRNA MCD mrna (P 0.05) 55% LVEF 51.1% 3.7% + (45.7% 2.6%) + (46.3% 2.5%) + + (47.2% 3.0%) (85.5% 3.1% P 0.05) FS 23.7% 1.2% + (21.0% 1.4%) + (21.3% 1.4%) + + (21.4% 1.7%) (50.8% 3.4% P 0.05) LVIDd cm + ( cm) + ( cm) + + ( cm)

4 ( P >0.05) ( cm P 0.05) MCD-microRNA MCD 2.4 A A nmol/g + ( nmol/ g) + ( nmol/g) + + ( nmol/g) ( nmol/g P 0.05) MCD A mmol/gprot + ( mmol/gprot) + ( mmol/gprot) + + ( mmol/gprot) ( mmol/gprot P 0.05) MCD 3 MCDmicroRNA MCD MCD-microRNA HEK293 HEK293 MCD-microRNA [7] [8] 8 LVEF FS LVIDd MCD-microRNA MCD FS MCD 28d [9] MCD ATP [2-3, 10] MCD [11] CPT-1 [12] CPT-1 A CPT-1 CPT-1 [13] microrna A MCD [1] Gao S, Keung W, Serra D, et al. Malonyl-CoA mediates leptin hypothalamic control of feeding independent of inhibition of CPT-1a[J]. Am J Physiol Regul Integr Comp Physiol, 2011, 301(1): R209-R217. [2] Bouzakri K, Austin R, Rune A, et al. Malonyl CoenzymeA decarboxylase regulates lipid and glucose metabolism in human skeletal muscle[j]. Diabetes, 2008, 57(6): [3] Ussher JR, Lopaschuk GD. Targeting malonyl CoA inhibition of mitochondrial fatty acid uptake as an approach to treat cardiac ischemia/reperfusion[ J]. Basic Res Cardiol, 2009, 104(2): [4] Ussher JR, Lopaschuk GD. The malonyl CoA axis as a potential target for treating ischaemic heart disease[j]. Cardiovasc Res, 2008, 79(2): [5] Li RJ, He KL, Li X, et al. Changes in the expression of caspase-12 after acute myocardial infarction in rats[j]. Med J Chin PLA, 2011, 36(3): [,,,. caspase-12 [J]., 2011, 36(3): ] [6] Demoz A, Garras A, Asiedu DK, et al. Rapid method for the separation and detection of tissue short-chain coenzyme A esters by reversed-phase high-performance liquid chromatography[j]. J Chromatogr B Biomed Appl, 1995, 667(1): [7] Hernot S, Klibanov AL. Microbubbles in ultrasound-triggered drug and gene delivery[j]. Adv Drug Deliv Rev, 2008, 60(10): [8] Fujii H, Li SH, Wu J, et al. Repeated and targeted transfer of angiogenic plasmids into the infarcted rat heart via ultrasound targeted microbubble destruction enhances cardiac repair[j]. Eur Heart J, 2011, 32(16): [9] Liu Q, Docherty JC, Rendell JC, et al. High levels of fatty acids delay the recovery of intracellular ph and cardiac efficiency in post-ischemic hearts by inhibiting glucose oxidation[j]. J Am Coll Cardiol, 2002, 39(4): [10] Dyck JR, Hopkins TA, Bonnet S, et al. Absence of malonyl coenzyme A decarboxylase in mice increases cardiac glucose oxidation and protects the heart from ischemic injury[j].

5 Circulation, 2006, 114(16): [11] Xin W, Li XY, Lu XC, et al. Cardiac function improved by sarcoplasmic reticulum Ca 2+ -ATPase overexpression in a heart failure model induced by chronic myocardial ischemia[j]. Med J Chin PLA, 2011, 36(4): [,,,. Ca 2+ -ATP [J]., 2011, 36(4): ]. [12] Lionetti V, Linke A, Chandler MP, et al. Carnitine palmitoyl transferase-i inhibition prevents ventricular remodeling and delays decompensation in pacing-induced heart failure[j]. Cardiovasc Res, 2005, 66(3): [13] Schreurs M, Kuipers F, van der Leij FR. Regulatory enzymes of mitochondrial beta-oxidation as targets for treatment of the metabolic syndrome[j]. Obes Rev, 2010, 11(5): ( ) ( )