Vitamin D receptor gene polymorphism and serum levels of Fetuin-A, Vitamin D and ipth in the hemodialysis patients

Transcription

1 In The Name of GOD Vitamin D receptor gene polymorphism and serum levels of Fetuin-A, Vitamin D and ipth in the hemodialysis patients Authors & Affiliations: 1-jamal hallajzadeh; Maraghe University of Medical Sciences, Maraghe, Iran 2- Amir Ghorbanihaghjo; Biotechnology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran 3-Mohammad Ahmadpour; Maraghe University of Medical Sciences, Maraghe, Iran

2 Introduction: Cardiovascular events rate are markedly increasing in hemodialysis (HD) patients. Approximately 50% of deaths in patients with end stage renal disease (ESRD) originate from cardiovascular diseases Vascular calcification is common among patients undergoing dialysis and is associated with high mortality. Traditional cardiovascular risk factors including aging, diabetes, hypertension and dyslipidemia are common among CKD patients. However the high prevalence of atherosclerosis and arterial calcification in CKD is far beyond the explanation by common cardiovascular risk factors. Reduced concentrations or abnormal metabolism of naturally occurring calcification inhibitors including fetuin A, inorganic pyrophosphate, matrix Gla protein and Osteoprotegerin also contribute to the severity of vascular calcification in CKD. Fetuin-A, also known as α2-heremans Schmid glycoprotein (AHSG), is a glycoprotein encoded by the AHSG gene predominantly expressed in the liver and inhibits ectopic calcium-phosphate precipitation and vascular calcification. Studies in laboratory animals have shown that PTH administration may induce calcific arteriosclerosis and myocardial hypertrophy and hyperparathyroidism considers as a cardiovascular risk factor in CKD. Active vitamin D deficiency is the most common cause of secondary Hyperparathyroidism (shpt) in CKD patients, because failed kidney is not capable to convert precursor of Vitamin D to its active form efficiently. Amongst many investigations of vascular calcification risk factors, genetic studies revealed that allelic polymorphisms of the gene coding for the Vitamin D receptor (VDR) influence morbidity and mortality risk in HD Patients. Furthermore, evidences exist to hypothesize that lower levels of Fetuin-A and vitamin D or variations in VDR function induced by polymorphisms at the 3' and 5' regions of the VDR gene may affect on mortality rate of these patients. In the present study, we evaluated the VDR gene BsmI and TaqI polymorphisms and to find any association between this polymorphism and the serum levels of Fetuin-A,Vitamin D and intact PTH (ipth).

3 Method & Materials: Patients' selection Our study group comprised forty three controls (20 males and 23females) and 46 patients with HD (28 males and 18 females). Those who agreed to participate in the study and who gave their written informed consent were included, unless they had any exclusioncriteriasuchashistoryofwithvitamindtherapy,hormonetherapywithpth, any active infection, malignancy, viral hepatitis, or chronic inflammatory diseases. The causes of renal failure in the patients were diabetic nephropathy (41.3%), chronic glomerulonephritis (8.6%), polycystic kidney disease (10.8%), hypertensive ischemic nephropathy (19.5%), obstructive nephropathy (15.2%) and unknown etiology (4.3%). All of the patients were stable and were under regular hemodialysis for at least six months (6 84 months) 3 4 h/week by Fresenius 2008B hemodialyser. Ethics The protocol of this study was revised and approved by the Ethical Committee of the Medical Faculty, Tabriz University of Medical Science, Tabriz, Iran. Informed consent was obtained from all of the patients.

4 Method & Materials: Analytical lmethods Blood samples for biochemical evaluations were drawn prior to a dialysis session (after 12 h of overnight Fasting). Subsequent plasma and serums were separated within 30 min and samples were kept frozen at 70 C until assays were carried out. The following parameters were measured: serum total Calcium (Ca), Phosphorus (P), Alkaline phosphatase (Alk), Albumin (Alb), Cholesterol (Cho), Triglycerides (TG), Urea, Creatinine (Cr) and hs CRP. Biochemical parameters were measured by enzymatic colorimetric method with an automated chemical analyzer (Abbott analyzer, Abbott laboratories, Abbott Park, North Chicago, IL). Total calcium was corrected for serum albumin by the following equation: corrected Calcium = Ca [4.0 albumin( g/dl)]. Serum concentration of Fetuin A was measured by using of Human Fetuin A ELISAkitin an ELISA plate reader (STATFAX2100, Multi detection Multi Plate Reader. USA).The analytical limit detection of the assay was 0.35 ng/ml, with inter assay coefficient of variation (CV) of 6.5% and intra assay CV of 5.1% (BioVendor Laboratory Medicine Inc, Brno, Czech Republic). ipth level was measured by two site ELISA method [Enzyme Linked Immunosorbent Assay] (Immunodiagnostic System, Bolden, UK), with the sensitivity of 1.57 pg/ml. To the quantitation of 25 OH Vitamin D in serum, we used The IDS 25 Hydroxy Vitamin D EIA kit (Immunodiagnostic Systems Ltd, Cat No: AC 57F1, Germany).

5 Method & Materials: Determination of the VDR Genotype VDR BsmI Polymorphism All patients were informed as to the blood sample drawn for DNA analysis.dna was extracted from peripheral leukocytes with standard techniques. 1UL Forward primer:5' CAACCAAGACTACAAGTACCGCGTCAGTGA 3'and 1UL Reverse primer: 5' AACCAGCGGGAAGAGGTCAAGGG 3' were used with PCR to amplify the fragment of the VDR gene including the Bsm I restriction site in intron 8.The reactions were performed in a DNA thermocycler (Biometra 210, Gottingen, Germany) and consisted of an initial denaturation step of 94 C for 5 min, followed by 35 cycles of denaturation at 94 C for 40 seconds, annealing at 60 C for 45 seconds, extension at 72 C for 1 min and a final extension step of 72 C for 10 min. PCR products were digested with 1.5 UL of Bsm I (fermentase, Beverly, MA) at 37 C for 5 h and run on a 2% agarose gel and visualized by ethidium bromide UVB illumination. The respective genotypes were defined as B ( Bsm I site absent, with a fragment of 822 bp) or b ( Bsm I site present, with 2 fragments: 646 and 176 bp). VDR Taq I Polymorphism A selected fragment of 494 bp was amplified by PCR with 25 ng DNA, 1 UL Forward primer : 5' CAGAGCATGGACAGGGAGCAAG 3', 1 UL Reverse primer: 5' GGATGTACGTCTGCAGTGTG 3' and 16 UL master mix(fermentase). The reactions were performed in a DNA thermocycler (Biometra 210, Gottingen, Germany) using denaturation at 94 C for 5 min, followed by 37 cycles of denaturation at 94 C for 40 seconds, annealing at 59 C for 45 seconds, extension at 72 C for 1min and a final extension step of 72 C for 10 min. Two hundred nano grams of the PCR product were digested with 1 UL TaqI (fermentase, Beverly, MA) at 65 C for 3 h. The digestion products were separated by electrophoresis in 2% acrylamide gel and stained with ethidium bromide (0.5 μg/ml). The respective genotypes were defined as T(Taq I site absent, with a fragment of 494 bp and 251bp) or t (Taq I site present, with 3 fragments: 293,201 and 251 bp).

6 TaqI Genotypes

7 BsmI genotypes

8 Method & Materials: Statistical ti ti Analysis Results are presented as means with standard deviation (mean ± SD) for parametric data and as median for nonparametric data. Numbers and their percent showed when appropriate. The Mann Whitney U test was used for evaluating the differences between groups, and Pearson s correlation coefficient for evaluating correlations. For all tests P < 0.05 was considered significant. Demographic data were analyzed and differences among groups were assessed by Mann Whitney U test for the nonparametric data or independent sample t test for parametric data and we further determined correlations between all variables with Pearson s correlation test. Differences between groups were evaluated, where appropriate, using Kruskal wallis H test. The chi square test was used to calculate whether genotype frequencies in HD patients deviated from the expected Hardy Weinberg equilibrium observed in the control population. SPSS version 18 was used for the statistics analysis.

9 Results: The baseline characteristics of the study population are summarized in Table 1. Although serum Fetuin-A and Vitamin D levels were significantly lower in the HD patients than healthy control group [(100.5±50.8) ng/ml vs. (188.3±93.4) ng/ml, p< and (22.7±7)ng/ml vs. (36.22±15.2) 2) ng/ml, p< respectively]. Table 3 shows that serum levels of Fetuin-A did not differ between males and females in the both HD patients [106.5±57ng/ml vs ±39.1ng/ml, p=0.3] and control groups [197.9±86.4ng/ml vs ±96.4ng/ml, p=0.5]. A significant difference of serum ipth, calcium and phosphorus concentrations were also found between the HD and control groups (p< both of them). The distribution of the genotype frequencies of BsmI and TaqI polymorphisms in HD and normal subjects are shown in Table2. As it has been shown, There is no statistically significant difference for distribution of the genotype frequencies of BsmI and TaqI polymorphisms in HD patients and normal individuals (p> all the genotypes). Table 4 shows that serum levels of Vitamin D and ipth levels have correlation significantly with Fetuin-A in the HD patients (r=0.507 p , r = p=0.02, respectively).as shown in Table 5, serum Fetuin-A, Vitamin D and ipth levels were categorized based on the vitamin D polymorphisms, in both HD and control groups. There was no significant difference in serum Fetuin-A, Vitamin D and ipth levels between three Vit D genotypes in the both groups(p >0.05 all the cases), except ipth level in HD patients with different TaqI genotypes (p <0.0001).

10 Results: Tbl1 Table1 Demographic data for the hemodialysis and control groups. Variable HD group (n=46) Control group (n=43) p values Age (years) (mean±sd) 61.08± ± a Sex (male/female) 28/18 20/ b Calcium (mg/dl) (mean±sd) 8.5± ±0.55 < a Phosphorus (mg/dl) (mean±sd) 6.05± ±0.6 < a ipth (pg/dl) (mean±sd) 367.3± ±15.57 < a Vit D (ng/ml) 22.7± ±15.2 < a Total Protein (gr/dl) 8.2± ± a Alk (IU/l) 411.1± ±59.4 < a Albumin (g/dl) (mean±sd) 3.4± ±0.5 < a Fetuin A (ng/ml) (mean±sd) (100.5±50.8) (188.3±91.2) < a

11 Results: Tbl2 Table2 Genotype Frequencies of BsmI and TaqI Polymorphisms in Normal Subjects and Hemodialysis Patients. VDR polymorphism Genotypes Control group (n=43) HD patients(n=46) P value a BB 6(14%) 9(19.6%) NS BsmI Bb 27(62.8%) 27(58.7%) NS bb 10(23.3%) 10(21.7%) NS TT 15(34.9%) 15(32.6%) NS TaqI Tt 23(53.5%) 27(58.7%) NS tt 5(11.6%) 4(8.7%) NS

12 Results: Tbl3 Table3 Comparison of the serum levels of Vit D, Fetuin A and ipth between males and females in two HD and Control study groups Parameters Male (mean±sd) Sex Female (mean±sd) p value a Vit D (ng/ml) (HD) 24.5± ± Vit D(ng/ml) (Control) 32.6± ± p value b Fetuin A (ng/ml) (HD) 106.5± ± Fetuin A (ng/ml) (Control) 197.9± ± p value c ipth (pg/dl) (HD) 336.8± ± ipth (pg/dl) (Control) 23.5± ± p value d

13 Results: Tbl4 Table4 The correlations between Fetuin A, Vit D and ipth in both HD and Control groups. parameter HD patients Control group r p a r p a Vit D and Fetuin A < ipth and Fetuin A ipth and Vit D

14 Tbl5 Table5 Serum Fetuin A, Vit D and ipth levels in BsmI and TaqI polymorphisms in HD and control groups. HD patients Control group Parameter BsmI p value a BsmI p value a BB Bb bb BB Bb bb N(%) 9(19.6) 27(58.7) 10(21.7) 6(14) 27(62.8) 10(23.3) Vit D (ng/ml) 23.6± ± ± ± ± ± Fetuin A (ng/ml) 90.8± ± ± ± ± ± ipth (pg/dl) 301.3± ± ± ± ± ± TaqI p value a TaqI p value a TT Tt tt TT Tt tt N(%) 15(32.6) 27(58.7) 4(8.7) 15(34.9) 23(53.5) 5(11.6) Vit D (ng/ml) 22.6± ± ± ± ± ± Fetuin A (ng/ml) 93.53± ± ± ± ± ± ipth (pg/dl) 468.8± ± ±92.5 < ± ± ±

15 Discussion & Conclusion: In this study, we compared the main factors involved in vascular calcification included serum levels of Fetuin-A protein, Vitamin D and ipth between HD patients and healthy controls. Also we studied the association of these parameters with two VDR gene BsmI and TaqI polymorphisms. In this study we showed that serum Fetuin-A and Vitamin D levels were significantly lower in the HD patients than the control group, whereas ipth and phosphorus were higher In our study, we found significant correlation between serum Fetuin-A and serum ipth Our results showed that BsmI and TaqI polymorphisms were distributed equally among HD patients and normal controls. In our study, Patients with wild-type allele t for (Tt or tt) had significantly lower ipth levels than those with mutant genotype TT, on the other hand, the serum concentration of intact parathyroid hormone were higher in the TT-genotype group in HD patients

16 Discussion & Conclusion: The VDR gene polymorphisms might influence cardiovascular morbidity and mortality through its relationship with hyperparathyroidism and calcium phosphate metabolism or through a VDR-mediated effect of 1, 25 (OH) 2 Vitamin D 3 on vascular smooth muscle cells and myocytes. In conclusion, our findings expand previous knowledge about existence of relationship between serum Fetuin-A, Vitamin D and ipth levels and cardiovascular calcification, and subsequently mortality in HD patients. Also our results suggested that VDR gene TaqI polymorphisms could affect the management of cardiovascular events in HD patients

17 Discussion & Conclusion: Further studies with a larger sample of patients t and study of other polymorphisms on VDR gene, will improve our understanding of the contribution of this gene in vascular calcification and allow preventive or /and therapeutic interventions in HD patients.

18 Thank You