Pyrosequencing Experience from Mumbai, India. Camilla Rodrigues MD Consultant Microbiologist Hinduja Hospital,Mumbai India

Transcription

1 Pyrosequencing Experience from Mumbai, India Camilla Rodrigues MD Consultant Microbiologist Hinduja Hospital,Mumbai India

2 Mumbai maximum city

3 Slow Fast 1-2 D With increasing drug resistance, DST is vital Suspected MDR Case Solid Culture & DST Liquid Culture & DST Molecular Tests Rapid diagnosis with DST is fundamental

4 India s PMDT Scale up Diagnostic algorithm for DR TB Guidelines on Programmatic Management of DR TB in India 2017

5 Beyond Xpert & LPA : Sequencing in the DR TB world - Sanger Sequencing - Pyrosequencing (PSQ) - Targeted NGS - Whole Genome Sequencing

6 PSQ Outline Principle & Cost Clinical applications Challenges

7 What is pyrosequencing? Real time diagnostic DNA sequencing by synthesis based on actual short segment sequencing (<100bp ) at a speed of 1 min / nucleotide Unlike Sanger sequencing ( chain termination with dideoxynucleotides), PSQ relies on pyrophosphate detection on nucleotide incorporation Can produce clinically relevant results in < 6 hrs from clinical samples Flexible & adaptable to regional prevalence specifics & new mutations

8 DNA extraction PCR amplification of 8 specific targets Post PCR, biotinylated ss DNA template is coupled to streptavidin coated beads Pyrosequencing Software analysis search for 100% identity match in target library containing all expected mutations

9 Pyrosequencing : cascade of enzymatic reactions 1. Iterative dntp dispensation only 1 at a time the order determined by known mutations 2. Incorporation of dntp generates PPi. 3. PPi reacts with substrate & triggers a series of chemical reactions catalyzed by enzymes. 4. Nucleotide incorporation catalyses a flash of light 5. Apyrase degrades unincorporated dntp & ATP 6. Pyrogram shows a sequential event of dntps incorporated

10 Pyrogram Target: inha promoter 100% match with wild type sequence. <Sequence read <Nucleotide Dispensation 10

11 Detecting a rpob mutation Complementary nucleotide to the base strand is accompanied by release of pyrophosphate (PPi) which generates light Query 1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42 Library1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42

12 PSQ : detecting > 64 mutations in < 6 hrs Target Location Mutations Length M tuberculosis complex Isoniazid IS katg inha promoter - 4 to ahpc- oxyr - 4 to Rifampicin rpob Fluoroquinolone gyra SLI KAN,AMK,CAP rrs KAN eis -6 to

13 PSQ : Instrumentation PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD PyroMark Q48/ Q96 MD Automated Throughput 1 24 samples 1 96 samples 1 96 samples with automation option Running volume 25 µl 40 µl 12 µl 12 µl Read lengths SQA ~ bp SNP ~ bp SQA SNP ~50 70 bp ~ bp SNP ~ bp SNP ~ bp AQ ~ bp AQ ~ bp AQ ~ bp AQ ~ bp CpG ~ bp CpG ~ bp CpG ~ bp CpG ~ bp Main applications Genetic testing Epigenetics Microbilogy Genetic testing Epigenetics Microbiology Epigenetics Genetic testing Epigenetics Genetic testing (SNP/AQ only in batch mode) Sensitivity 5% limit of detection 10% limit of detection 2% limit of detection 2% limit of detection

14 PSQ : cost Equipment : Pyromark Q 48 : approx INR 50 lakhs Q 96 : approx INR 75 lakhs Consumables : TB & XDR detection :approx INR 4500 per sample with controls

15 PSQ Outline Principle & Cost Clinical applications Challenges

16

17 : implications for global implementation BMC Infect Dis 2016;16:458

18 PTB : PSQ Sequencing success by Smear & Culture PSQ success for each target region stratified by smear and culture BMC Infect Dis 2016;16:458

19 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low

20 HNH 2017 : DR conferring mutations detected by MTBDRplus & MTBDRsl Resistant Phenotype Reference Genes DR conferring mutations No(%) Detected ONLY WT absent Only WT absent with no Mutant band INH R kat G S315T1/ S315T (87%) katg (2.23%) inha C15T A16G T 8C 202 ( 9.2%) 27 (1.23%) inha RIF R rpob D516V H526Y H526D S531L 32 ( 1.4%) 6 ( 0.2%) 4 ( 0.18%) 1717 (93%) WT 1 : WT 2 : WT 2/3 : WT 3/4 : Wt 4/5 : WT 5/6 : WT 7 : WT 8 : (0.5%) 8 (0.3%) 13 (0.5%) 6 (0.27%) - 52 (2.3%) 21 (0.95%) OFX R gyra gyrb A90V S91P D94A D94N/Y D94G D94H N538D/ E540G 318 (26%) 14 (1.1%) 30 (2.4%) 21 (1.73%) 423 (64%) 12 (1%) 2 (0.1%) gyra WT1 : WT2 : WT3: gyrb WT1 : (3.96%) 4 ( 0.3%) KAN R KAN R /AMK R / CAP R eis rrs C14T A1401G G1484T 4 (0.33%) 106 (94%) eis WT1: G37T, WT2: : WT3 : -2 rrs WT 1: WT (0.4%) 44 (3.63%) 9 (0.8%) 20

21 Comparison of PSQ, GenotypeMTBDR & MGIT DST Incremental increase in SNP identification RIF : 13% FQL : 8.2% Tuberculosis 2018 ;110:86-90

22 Drug Number PSQ mutations / confidence Rifampicin rpob 13 / 100 L511(1) Minimal Q513K (2) High D516Y (1) Moderate D516Y+533gag (1) Moderate H526P(1) Moderate H526C (1) High H526L (1) High S531Q (1) High L533P (4) Moderate FQL gyra 5 / 61 G88C+S95T(1) High 94gtc +S95T(1)? Phenotypic MGIT Susceptible with PSQ mutations Tuberculosis 2018 ;110:86-90

23 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low

24 Case 1 PM 32 F Miliary TB : DOTS for 3 months A month later developed seizures Tuberculomas found Sputum Xpert MTB / RIF R Smear negative : LPA indeterminate TB MGIT culture done

25 Case 1 : Sputum Pyrosequencing Rifampicin R rpob S531L Fluoroquinolone R gyra D94G Isoniazid R katg S315T Global Consortium for Drug resistant TB Diagnostics (GCDD) funded by NIH, USA : Grant #5U01AI082229

26 Case 1. PreXDR (katg S315T,rpoB S531L & gyra D94G) Treated with KAN, CLF, LZD,PAS, ETH Follow up well at 6 months

27 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low

28

29 Case 2 19 year male being treated elsewhere diagnosed as Pulmonary TB H 300 R 450 E 800 Z months later, developed abscess Left palm Drained pus, smear +, MGIT culture neg

30 Case Months later developed abscess in Lt ankle Amikacin & levoflox added Abscess in Rt forearm, Smear + MGIT : No growth after 6 weeks 3 months later Pus from Rt forearm, Smear + MGIT : No growth at 6 weeks

31 Pyrosequencing : No mutations detected MTB detected Isoniazid ahpc No mutations Isoniazid : katg No mutations FLQ : no mutations Isoniazid :inha No mutation SLI : rrs No mutations v RIF : no mutations RIF : no mutations

32 TB : Treatment failure not always drug resistance Compliance Dosage issues Absorption of drugs Poor quality drugs Drug Interactions Penetration at site

33 TBM

34 To date 67 TBM suspects, 46 PSQ + ve,17 MGIT culture + ve, 21 Xpert + ve

35 Dilemmas in the management of TBM / tuberculomas Drug resistance Paradoxical response Adequate drug penetration Vasculitis / infarcts Hyponatremia Brain edema Hydrocephalus Seizures Mixed infections ( HIV )

36 Penetration of TB drugs High (>90%): Intermediate (60-90%): Low (<50%): Isoniazid, Pyrazinamide, Ethionamide Levofloxacin, Moxifloxacin, Linezolid, Cycloserine Rifampicin, Streptomycin, Amikacin, Capreomycin Ethambutol

37 Case 3 AK 16 years TBM Started on HRZE & steroids partial improvement After tapering of steroids, c/o severe headache Intercisternal tuberculomas with exudates Referred to ID

38 Case 3..? DRTB or paradoxical response Xpert : Not detected PSQ: INH mono R katg 315ACC INH replaced with ETH (better CSF penetration & EBA) Re started steroids Patient improved on FU

39 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low

40 Operator related Protocol related Heteroresistance Inadequate knowledge about mutations Lung India 2018;35(2):

41 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Repeat Xpert RIF: Resistant Repeat Xpert RIF: Resistant Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Check LJ for 2 types of colonies Check LJ for 2 types of colonies (Heteroresistance) Repeat Xpert RIF Repeat Xpert RIF Susceptible Perform PSQ for the Perform PSQ for the exact SNP SNP Perform RIF MGIT MICs at 0.25 /0.12 Perform RIF MIC at 0.25 / 0.12 Send isolate for WGS Send isolate for WGS Lung India 2018;35(2):

42 Mechanisms that underlie resistance Drug resistance in M. tuberculosis is a mixed bag: significant heterogeneity is present with low, moderate & high level phenotypic resistance In high incidence settings an average of 17% of new TB cases, can be multiply infected Clin Microbiol Rev 2011; 2 : doi: /CMR

43 Understanding heterogeneity Upper lobectomy specimen of a 19 year old male with MDR-TB Within the lung, each lesion is independent & engaged in various phases of immune battles at diff metabolic states of TB bacilli

44 Single infecting strain showed heteroresistance Mixed infection in presence of hetero resistance could worsen outcome.

45 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Repeat Xpert from original MGIT tube Repeat Xpert RIF: Resistant Repeat Xpert RIF: Resistant Check LJ for 2 types of colonies Check LJ for 2 types of colonies (Heteroresistance) Repeat Xpert RIF Susceptible Send isolate for WGS Lung India 2018;35(2):

46 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Repeat Xpert from original MGIT tube Repeat Xpert RIF Susceptible Repeat Xpert RIF Susceptible Send isolate for WGS Send isolate for WGS Lung India 2018;35(2):

47 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Perform PSQ for the exact SNP Perform PSQ for the exact SNP Perform RIF MIC at 0.25 / 0.12 Lung India 2018;35(2):

48 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Rif R maybe missed for specific rpob mutations Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Perform PSQ for the exact SNP Perform RIF MICs Perform RIF MIC at 0.25 / 0.12 Lung India 2018;35(2):

49 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band (ii) Smear negative TB : PTB & EPTB (iii)resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low

50 Xpert MTB Detected Caution : False Resistant in MTB Detected VERY LOW

51 Confirming in RIF R in MTB DETECTED VERY LOW in non MDR suspects In RIF DST S & Xpert R, PSQ confirmed no mutations in 10/40 Submitted

52 PSQ Outline Principle & cost Clinical applications Challenges

53 PSQ : challenges Homopolymers (more than 3-4) Homopolymer string (mainly T) regions influence synchronized extension & synthesis of DNA strand causing non uniform sequence peak heights, affecting read length & possibly cause sequence errors In Smear negative, low sensitivity of gyra & rpob Indeterminate readings (instruments issues, mixed population, new minority mutations) Technical expertise essential PSQ currently standardised for XDR defining drugs

54 Higher rates of Pre XDR TB than MDR TB (56.8% vs 29.4%) PLoS One 2015 :10(1):e

55 Genetic resistance markers Drug Mechanism of Action Genetic Marker Function Frequency (%)

56 Genetic resistance markers Drug Mechanism of Action Genetic Marker Function Frequency (%) Advantages for WGS Sequencing 1) WGS captures complete genetic mutational profile in one test. 2) New mutations identified that relate to adaptive responses (compensatory mutations).

57 WGS for DR conferring mutations XDR drugs : <10% ( LPA WT absent with no mutant) Oral FLD : Ethambutol, PZA Oral SLD : Ethionamide, PAS, cycloserine Re purposed drugs : CFZ, LZD New Drugs : BDG, DLD

58 History will judge us not by our scientific breakthroughs, but how we apply them