Article Simultaneous preimplantation genetic diagnosis for Tay Sachs and Gaucher disease

Transcription

1 RBMOnline - Vol 15 No Reproductive BioMedicine Online; on web 21 May 2007 Article Simultaneous preimplantation genetic diagnosis for Tay Sachs and Gaucher disease Gheona Altarescu obtained her MD magna cum laude at the Jassy School of Medicine, Romania, and completed her training in Genetics at the National Institutes of Health, USA from 1997 to Since then she established and runs the Preimplantation Genetic Diagnosis Clinic in the Medical Genetics Unit at the Shaare Zedek Medical Center in Jerusalem. Current clinical research interests include development of new techniques for single cell diagnosis. Dr Gheona Altarescu Gheona Altarescu 1, Barry Brooks 2, Ehud Margalioth 2, Talia Eldar Geva 2, Ephrat Levy-Lahad 1, Paul Renbaum 1,3. 1 Medical Genetics; 2 IVF Units, Zohar PGD Lab, Shaare Zedek Medical Centre, POB 3235, Jerusalem, Israel 3 Correspondence: Tel: ; Fax: ; renbaum@szmc.org.il Abstract Preimplantation genetic diagnosis (PGD) for single gene defects is described for a family in which each parent is a carrier of both Tay Sachs (TS) and Gaucher disease (GD). A multiplex fluorescent polymerase chain reaction protocol was developed that simultaneously amplified all four familial mutations and 10 informative microsatellite markers. In one PGD cycle, seven blastomeres were analysed, reaching a conclusive diagnosis in six out of seven embryos for TS and in five out of seven embryos for GD. Of the six diagnosed embryos, one was wild type for both TS and GD, and three were wild type for GD and carriers of TS. Two remaining embryos were compound heterozygotes for TS. Two transferable embryos developed into blastocysts (wt/wt and wt GD/carrier TS) and both were transferred on day 5. This single cycle of PGD resulted in a healthy live child. Allele drop-out (ADO) was observed in three of 34 reactions, yielding an 8% ADO rate. The occurrence of ADO in single cell analysis and undetected recombination events are primary causes of misdiagnosis in PGD and emphasize the need to use multiple polymorphic markers. So far as is known, this is the first report of concomitant PGD for two frequent Ashkenazi Jewish recessive disorders. Keywords: blastomere, Gaucher disease, PGD, single cell multiplex PCR, Tay Sachs disease Introduction Preimplantation genetic diagnosis (PGD) was developed almost 2 decades ago, for couples at high genetic risk of having affected children. PGD is performed by blastomere and/or polar body biopsy for Mendelian and chromosomal disorders (Handyside et al., 1990). Although polar body biopsy requires more skill, and is more time consuming and costly, it has been used successfully in a few centres worldwide for female carriers affected with autosomal dominant, recessive or X-linked disorders (Verlinsky et al., 1990; Strom et al., 2000). This study presents a childless couple, both carriers of two different mutations in both the β -hexosaminidase A (HEXA) gene and the β-glucocerebrosidase (GBD) gene. Terminating a pregnancy of an affected child was not an option for this family due to religious considerations, and they presented to the clinic for PGD. Tay Sachs (TS; GM2 gangliosidosis type B, OMIM #272800) is a recessive neurodegenerative lysosomal storage disease caused by a deficiency of the hexosaminidase A (HEXA) isoenzyme. In its most severe form the disease is characterized by rapidly progressive neurodegeneration, developmental regression and death at age 3 4 years (Beutler et al., 1993). TS was in the past highly frequent in the Ashkenazi Jewish population, at 1:3600 versus 1:360,000 in the general non-jewish population (Gravel et al., 1995). This is the result of three common founder mutations in the HEXA gene: a 4-bp (base pair) insertion in exon insTATC (accounting for 70% of mutations), a splice mutation in intron 12 IVS12+1G C, and a missense Gly269Ser mutation caused by a G A nucleotide substitution in exon 7 (Triggs-Raine et al., 1990). Gaucher disease (GD) is the most common lysosomal storage disorder (Brady and Baranger, 1983; Ginns et al., 1983), the hallmarks of which are hepatosplenomegaly, anaemia and thrombocytopenia, and bone involvement (Beutler et al., 1993) Published by Reproductive Healthcare Ltd, Duck End Farm, Dry Drayton, Cambridge CB3 8DB, UK

2 84 The non-neuronopathic, type I variant is highly prevalent in the Ashkenazi Jewish population, with a gene frequency of (Zimran et al., 1991; Horowitz et al., 1998). The most frequent mutation, N370S (Tsuji et al., 1988), accounts for 75% of all disease-causing alleles, and its presence precludes neuronopathic disease (Le Coutre et al., 1997; Horowitz et al., 1998). Most N370S homozygotes are asymptomatic (Beutler et al., 1993; Azuri et al., 1998), but compound heterozygotes require lifetime enzymatic replacement treatment (Cox and Schofield, 1997). This paper describes the development of a sensitive and highly reliable multiplex fluorescent single cell polymerase chain reaction (PCR) for simultaneous analysis of two recessive diseases using a total of 10 polymorphic markers flanking both genes. So far as is known, this is the first report of concomitant PGD for two frequent Ashkenazi Jewish recessive disorders. Materials and methods IVF and blastomere biopsy IVF treatment were performed according to a standard protocol involving pituitary downregulation with gonadotrophin-releasing hormone analogue, followed by ovarian stimulation with recombinant FSH. Vaginal ultrasound-guided oocyte retrieval was performed 34 h after human chorionic gonadotrophin injection. Oocytes were identified, washed and transferred to organ culture dishes containing equilibrated culture medium (Medicult, Denmark) and placed in an incubator with 5% CO 2. Oocytes were denuded with hyaluronidase (Sigma-Aldrich, USA) 2 h after oocyte collection, and were allowed to recover in the incubator for a further 2 h. Intracytoplasmic sperm injection (ICSI) was then performed on each mature oocyte. Fertilized oocytes were then placed in fresh 20 μl droplets of P1 medium (Irvine Scientific, USA) under oil and cultured for a further 48 h. Blastomere biopsy was performed on day 3 on 6- to 8-cell stage embryos, using the zona-slitting technique (Verlinsky and Kuliev, 2005). Each blastomere was separately transferred to a 0.5 ml tube containing 5 μl of proteinase K lysis buffer (Thornhill et al., 2001). A sample of culture medium (media blank) from each droplet that contained a biopsied blastomere was analysed to verify the absence of maternal cellular genetic material or DNA in the culture medium. In addition, a no template control (NTC, reaction blank) was used to monitor absence of external contamination in each PCR reaction. Molecular analysis Genetic testing for the familial HEXA and GBA mutations and haplotype analysis were performed on DNA extracted from peripheral blood cells using a salt precipitation method (Miller et al., 1988). Proteinase K digestion of each blastomere sample was followed immediately by inactivation at 94 C for 15 min and 30 cycles of a multiplex PCR reaction containing 0.2 μmol/l dntps, 10% dimethylsulphoxide, with 1.25 IU Taq polymerase in reaction buffer supplied by the manufacturer (JMR801, UK) in a 50 μl volume, using 0.1 μmol/l forward and reverse primers (see Tables 1 and 2 for primer sequences) from each of 10 primer pairs for 10 polymorphic genetic markers: D15S204, TS-AAAT (chr 15: , assembly July 2003) (Karolchik et al., 2003), D15S215, D15S169 and D15S818 for TS and GAU-CA (chr 1: ) (Karolchik et al., 2003), GAU-GT (chr1: ) (Karolchik et al., 2003), GAU-AAAG (chr1: ) (Karolchik et al., 2003), D1S2140 and D1S2721 for GD. The reaction was thermocycled for 30 cycles using a 20 s denaturation step at 95 C, 1 min annealing at C and 30 s elongation at 72 C. From each reaction, 1.5 μl was used as a template with a hemi-nested primer 5 fluorescently labelled with 6-FAM (MWG Biotech, UK), HEX (MWG Biotech), or NED (Applied Biosystems/ABI, USA] with one outside primer for an additional 35 cycles for each of the 10 individual PCR reactions. Reaction products were diluted and run on an ABI Prism 3100 Avant automated sequencer, and analysed using Genotyper software (ABI). Results A childless couple of Ashkenazi Jewish origin presented to the clinic for PGD after each partner was found to be a carrier for both TS and GD. The man s mother was known to be affected with GD, prompting GD testing in the female partner, and the TS mutations were identified as part of an Ashkenazi Jewish carrier screening panel. The couple was at risk for compound heterozygote children in both genes: HEXA (IVS12+1G C/ Gly269Ser) and GBA (N370S/IVS2+1G A). Five informative polymorphic markers for each disease, mapping in the order D15S204, TS-AAAT, D15S215, D15S169 and D15S818 for TS and GAU-CA, GAU-GT, GAU-AAAG, D1S2140 and D1S2721 for GD, less than 2 Mb from each gene were identified, labelled and used to create a haplotype map for this family (Figure 1a,b). The HEXA mutations reside between markers TS-AAAT and D15S215 and the GBA mutations between markers GAU-GT and the intragenic GAU-AAAG. The results of one cycle of simultaneous PGD for TS and GD are presented in Table 3. An example of the results of hemi-nested fluorescent PCR reactions for four of five markers for TS and GD analysis are shown in Figure 2a,b (fifth marker not shown). No blank media or template control contamination was observed during this cycle. Since all four familial mutations were only partially informative in blastomeres and the presence of a single mutation was indistinguishable from ADO, mutation testing was not included in the analysis, which for both genes was based only on informative linked polymorphic markers, both intragenic (GAU-AAAG) and flanking. Five informative markers were used for each disease. Of 19 retrieved oocytes, only 13 were at metaphase II stage and underwent ICSI. Eight oocytes fertilized and seven reached the 6-cell stage on day 3. Single cell blastomere biopsy was successfully performed on each of the seven developed embryos. GD analysis revealed five wild-type embryos, one embryo

3 with a mutant paternal allele and a recombinant maternal allele (mutant/wild-type), and one embryo with inconclusive results for both GD and TS due to amplification failure of four of five markers. TS analysis revealed one wild-type embryo, two mutant embryos, three carrier embryos, and one inconclusive embryo as noted above. Four embryos were therefore eligible for transfer: one wildtype for both diseases and three wild-type for GD and carriers for TS. Two of these (one GD/TS wild-type and one GD wild-type/ts carrier) reached the blastocyst stage on day 5 and were transferred to the proband, resulting in a singleton pregnancy and a healthy child born at term. Analysis of all four mutations after birth revealed that the child inherited the wild-type alleles for both diseases. ADO analysis Prior to performing the first PGD cycle, 40 single fibroblasts from an unrelated control individual were isolated and used to test amplification efficiency (all markers were tested) and ADO rates (only four out of the five markers were heterozygous in this control individual for GD, and three out of five markers were heterozygous for TS). Thirty-eight fibroblasts showed amplification of all markers, while no markers amplified in the remaining two samples. ADO was observed in 15 out of 280 reactions (5%). For the PGD cycle, ADO was observed in 3/38 (8%) totally informative reactions (i.e. for markers with four different alleles in the couple): 2/20 (10%) in the GAU-AAAT marker and 1/18 (6%) TS marker reactions. Table 1. Primers used for polymerase chain reaction for Tay Sachs disease in a nested (TS-AAAT) and a hemi-nested approach. Forward primers Nested primers Reverse primers D15S204-Fout D15S204-Fin D15S204-R GGAAAGGCCTTGAATCTGTA ATGGTGTTTGAGGTAAATGG ACCCCACATGGCTTCATA TS-AAAT-Fout TS-AAAT-Fin TS-AAAT-Rout ATTAGCCGGGCATGGT GCTGAGGCAAGAGAATCG GCCTCCAAGCTTGATCTTC TS-AAAT-Rin TCGGCAAAAAGAAAATTACC D15S215-Fout D15S215-Fin D15S215-R TCATAAATCTTGCCCTGTTT GGGAACCAAGGAAATGTTACTA CTCGGGAGGCTGAAAT D15S169-Fout D15S169-Fin D15S169-R, TGGATAGTGGTGGCTAATGA GAGACATCTCTTCTGAAAGCTC CAGGAGAGAGCCTTGGAT D15S818-Fout D15S818-Fin D15S818-R CAAAATTTAGCCAGAGCACA GCTAAGATGGCGCCATTG R TGTGCATCCTCTATGTCCCT Fout = forward outside primer; Fin = forward inside primer; R = reverse primer; Rin = reverse inside primer; Rout = reverse outside primer. Table 2. Primers used for polymerase chain reaction for Gaucher disease in a hemi-nested approach. Forward primers Nested primers Reverse primers Gau-CA-Fout Gau-CA-Fin Gau-CA-R AATGTAAGGACTTACCATAAAA TATACAAAAGGAGGGCCAAG TGTAACAAACCTGCACATCC Gau-GT-Fout Gau-GT-Fin Gau-GT-R TGGGGTAATCAGTCCAGAGT TCCTTCACTCCCTCTTCTTG TAATTACTGCAGCCACCTGA Gau-AAAG-Fout Gau-AAAG-Fin Gau-AAAG-R GAGGCAGAATTGCTTGAAC AGTGAGCCAAGATCACACC ATCCATCTCACTCACACTGC D1S2140-Fout D1S2140-Fin D1S2140-R CCTAGCTACTCGGGAGACTG ATGGTATGAACCTGGAGGTG GCTGAAAAGACACTTCAGTGG D1S2721-Fout D1S2721-Fin D1S2721-R TGGCAAACGCTAAAGAGC TCCTCCCCAAATCAATACAC ACCCAAAGTGCTCTGATCTC Fout = forward outside primer; Fin = forward inside primer; R = reverse primer. 85

4 a b Figure 1. Family haplotype map for Tay Sachs (a) and Gaucher (b) disease based on five informative markers and two mutations for each disease. *Mutant allele; WT = wild type. Numbers represent marker allele length in base pairs. a b Figure 2. Capillary electropheoregrams of amplified fluorescently labelled linked polymorphic markers for Tay Sachs disease (a) and Gaucher disease (b). M = maternal allele; P = paternal allele; P-ADO = paternal allele drop-out. Four out of five markers are shown. Blue traces = FAM-labelled primers; Green traces = HEX-labelled primers. Red indicates mutant allele. 86

5 Table 3. Summary of one cycle of blastomere-based preimplantation genetic diagnosis analysis for both Gaucher and Tay Sachs disease. Disease COC MII ICSI Fertilized Blastomeres WT Carrier Mutation Not Embryos Live biopsied diagnosed transferred birth Gaucher (1 recombination) Tay-Sachs COC = cumulus oocyte complexes; ICSI = intracytoplasmic sperm injection; MII = metaphase II; WT = wild type. Discussion A sensitive and highly reliable single cell assay is described for PGD in a couple where both partners are carriers for two frequent Ashkenazi diseases: TS and GD. TS is a severe neurodegenerative disorder with death usually occurring between 3 and 5 years of age, so prenatal diagnosis and pregnancy termination of affected fetuses is acceptable to most couples. However, non-neuronopathic type I GD is highly variable in compound heterozygotes, leading to significant dilemmas regarding prenatal diagnosis and pregnancy termination. A multiplex fluorescent PCR assay was developed, including highly polymorphic markers close to each mutation, in order to increase diagnosis rates and reduce ADO-related misdiagnosis. ADO is the main reason for misdiagnosis in PGD, because the lack of amplification of an allele can mistakenly be interpreted as absence of this allele (Wells, 2004). ADO is unlikely to occur in all reactions, so testing for multiple polymorphic markers enables ADO detection, and thereby increases the accuracy of PGD diagnosis. Verlinsky and Kuliev (2000) have shown that using four polymorphic assays reduces ADO-related error rates from as high as 27% (in single amplicon analysis in blastomeres) to almost 0%. ADO rates are lower in polar bodies than in blastomeres (Rechitsky et al., 1996, 1998, 1999; Altarescu et al., 2006). However, because PGD in this case was performed for two different diseases, blastomere analysis was performed in order to determine both maternal and paternal alleles, and maximize the number of transferable embryos. An exceptional feature in this case is the presence of four different pathogenic mutations. The specific familial mutations are usually the first to be included in the PGD assay. However, in this case, if only one mutation were detected in the GBA or HEXA gene, ADO of the other parent s mutation could not be ruled out, and mutant embryos would not be definitively distinguishable from carrier embryos. Analysis for both diseases was therefore based only on informative intragenic and flanking polymorphic markers for both the HEXA and GBA genes. The use of polymorphic markers can also reveal recombination events (Verlinsky and Kuliev, 2000). Such a recombination was indeed observed in the maternal TS allele in one embryo, precluding TS diagnosis in this embryo. Of seven 6-cell embryos obtained in one IVF cycle, definitive diagnosis was reached for GD in six of seven embryos, and for TS in five of seven embryos. Four embryos were not affected with either disease, and the two that developed into blastocysts were transferred, resulting in the birth of a healthy baby. This case demonstrates the feasibility and advantages of analysing a large number of markers in a single multiplex reaction, allowing the analysis of multiple diseases in cases where couples are carriers of mutations in several genes. This situation is particularly common in the Ashkenazi Jewish population, in which there are a large number of prevalent autosomal recessive diseases (Zlotogora, 2007). Large-scale screening programmes in this population have effectively reduced the number of affected offspring (Langlois and Wilson, 2006), and at the same time have increased public awareness of carrier status for these diseases. Couples at risk for more than one recessive disease may therefore become more common, and with the addition of milder diseases to the screening panel (e.g. Connexin26- related deafness), PGD may become the procedure of choice for couples wishing to avoid the birth of an affected child. Acknowledgements We would like to thank Rabbi David Fuld and Mrs Anita Fuld for their generous and ongoing support, and to Hadassa Hartman for her valuable editorial assistance. References Altarescu G, Eldar-Geva T, Brooks B et al Polar body versus blastomere biopsy for PGD. PB or not PB? The American Society of Human Genetics 56th Annual Meeting, 28 Azuri J, Elstein D, Lahad A et al Asymptomatic Gaucher disease implications for large-scale screening. Genetic Testing 2, Beutler E, Nguyen NJ, Henneberger MW et al Gaucher disease: gene frequencies in the Ashkenazi Jewish population. American Journal of Human Genetics 52, Brady RO, Barranger JA, Furbish FS et al Prospects for enzyme replacement therapy in Gaucher disease. Progress in Clinical Biological Research 95, Cox TM, Schofield JP 1997 Gaucher disease: clinical features and natural history. Bailliere s Clinical Hematology 10, Ginns EI, Erickson A, Tegelaers FP et al Isozymes of betaglucosidase: determination of Gaucher s disease phenotypes. Isozymes Current Topics in Biology and Medical Research 11, Gravel RA, Clarke JTR, Kaback MM et al The Gm2 gangliosidoses. In: Scriver C, Beaudet A, Valle D et al (eds) The Metabolic and Molecular Bases of Inherited Disease. McGraw- Hill, New York, pp Handyside AH, Kontogianni EH, Hardy K et al Pregnancies 87

6 from biopsied human preimplantation embryos sexed by Y-specific DNA amplification. Nature 344, Horowitz M, Pasmanik-Chor M, Borochowitz Z et al Prevalence of glucocerebrosidase mutations in the Israeli Ashkenazi Jewish population. Human Mutation 12, Karolchik D, Baertsch R, Diekhans M et al The UCSC Genome Browser Database. Nucleic Acids Research 31, Langlois S, Wilson RD 2006 Carrier screening for genetic disorders in individuals of Ashkenazi Jewish descent. Journal of Obstetrics and Gynaecology Canada 28, Le Coutre P, Demina A, Beutler E et al Molecular analysis of Gaucher disease: distribution of eight mutations and the complete gene deletion in 27 patients from Germany. Human Genetics 99, Miller SA, Dykes DD, Polesky HF 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 16, 1215 Rechitsky S, Strom C, Verlinsky O et al Accuracy of preimplantation diagnosis of single-gene disorders by polar body analysis of oocytes. Journal of Assisted Reproductive Genetics 16, Rechitsky S, Strom C, Verlinsky O et al Allele dropout in polar bodies and blastomeres. Journal of Assisted Reproductive Genetics 15, Rechitsky S, Freidine M, Verlinsky Y et al Allele dropout in sequential PCR and FISH analysis of single cells (cell recycling). Journal of Assisted Reproductive Genetics 13, Strom CM, Levin R, Strom S et al Neonatal outcome of preimplantation genetic diagnosis by polar body removal: the first 109 infants. Pediatrics 106, Thornhill AR, McGrath JA, Eady RA et al A comparison of different lysis buffers to assess allele dropout from single cells for preimplantation genetic diagnosis. Prenatal Diagnosis 21, Triggs-Raine BL, Feigenbaum AS, Natowicz M et al Screening for carriers of Tay Sachs disease among Ashkenazi Jews. A comparison of DNA-based and enzyme-based tests. New England Journal of Medicine 323, Tsuji S, Martin BM, Barranger JA et al Genetic heterogeneity in type 1 Gaucher disease: multiple genotypes in Ashkenazic and non-ashkenazic individuals. Proceedings of the National Academy of Sciences of the USA 85, Verlinsky Y, Kuliev A 2005 Micromanipulation and biopsy of polar bodies and blastomeres. In: An Atlas of Preimplantation Genetic Diagnosis 2nd edition. Taylor and Francis, pp Verlinsky Y, Kuliev A 2000 An Atlas of Preimplantation Genetic Diagnosis. Taylor and Francis, pp Verlinsky Y, Ginsberg N, Lifchez A et al Analysis of the first polar body: preconception genetic diagnosis. Human Reproduction 5, Wells D 2004 Advances in preimplantation genetic diagnosis. European Journal of Obstetrics and Gynecologic Reproductive Biology 115 (Suppl. 1), S97 S101. Zimran A, Gelbart T, Westwood B et al High frequency of the Gaucher disease mutation at nucleotide 1226 among Ashkenazi Jews. American Journal of Human Genetics 49, Zlotogora J 2007 Ministry of Health forum of community genetics. &PageId=1136 [accessed 18 May 2007]. Received 14 February 2007; refereed 12 March 2007; accepted 25 April