Article Derivation of male germ cell-like lineage from human fetal bone marrow stem cells
|
|
- Isaac Henderson
- 6 years ago
- Views:
Transcription
1 RBMOnline - Vol 19 No Reproductive BioMedicine Online; on web 8 May 2009 Article Derivation of male germ cell-like lineage from human fetal bone marrow stem cells Jinlian Hua has been studying human and mammalian embryonic stem cells and their characteristics since His interest is focusing on mechanisms in germ cell specification and stem cells. He has received science and technology awards from Yangling (2006) and Shaanxi Province (2005, 2006). He was also accepted into the Youth Research Key Member Program of Northwest A & F University (2005). Dr Jinlian Hua Jinlian Hua 1,3, Shaohui Pan 1, Chunrong Yang 1, Wuzi Dong 1, Zhongying Dou 1, Kuldip S Sidhu 2 1 College of Veterinary Medicine, Shaanxi Centre of Stem Cells Engineering and Technology, Shaanxi Key Laboratory for Agriculture Molecular Biotechnology Centre, Northwest A and F University, Yangling, Shaanxi, China; 2 Stem Cell Laboratory, Faculty of Medicine, School of Psychiatry, University of New South Wales, NSW 2031, Australia 3 Correspondence: jlhua2003@126.com Abstract Mesenchymal stem cells derived from bone marrow are a well characterized population of adult stem cells that can be maintained and propagated in culture for a long time with the capacity to form a variety of cell types. Reports have shown that murine and human embryonic stem cells can differentiate into primordial germ cells and then to early gametes. Evidence has indicated that some adult stem cells also have the potential to differentiate into germ cells. Currently, there are no reports on directed differentiation of human mesenchymal stem cells into germ cells. This study investigated the ability of retinoic acid and testicular extracts to induce human bone marrow stem cells (hbmsc) to differentiate into male germ cells. It was found that a small population of hbmsc seem to transdifferentiate into male germ cell-like cells. These cells expressed early germ cell markers OCT4, STELLA, NANOG and VASA, and male germ-cell-specific markers such as DAZL, TH2, c-kit, β 1 -integrin, ACR, PRM1, FSHR, STRA8 and SCP3, as analysed by reverse transcription-polymerase chain reaction and immunohistochemistry. These results demonstrated that hbmsc may differentiate into male germ cells and the same could be used as a potential source of cells for reproductive toxicological studies. Keywords: human bone marrow stem cells (hbmsc), male germ cells, spermatozoa Introduction The potential of embryonic stem cells (ESC) to generate all cell lineages of embryo and bodies in vivo and in vitro has been widely reported (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004). It is now believed that for most stem cell types the specific extracellular environment provides signals necessary for self-renewal and differentiation (Nayernia et al., 2004). Reports have shown that ESC can differentiate into germ cells in vitro (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004; Nayernia et al., 2006a,b). However, it is difficult to purify the germ cells derived from ESC. Infertility affects 13 18% of couples and the growing evidence from clinical and epidemiological studies suggests an increasing incidence of male reproductive problems. A male factor is involved in up to half of all infertile couples. The pathogenesis of male infertility manifests itself as defective spermatogenesis due to failure in germ cell proliferation and differentiation (Lammarrone et al., 2003). Recently, several reports have shown that germ cells can be produced in vitro from ESC (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004; Nayernia et al., 2006a,b) and even from adult stem cells (Dyce et al., 2006; Nayernia et al., 2006a; Danner et al., 2007). Mesenchymal stem cells (MSC) derived from bone marrow are a well-characterized population of adult stem cells that can form a variety of cell types, including fat cells, cartilage, bone, tendon and ligaments, muscle cells, skin cells and nerve cells (Pittenger et al., 1999; Jiang et al., 2002). It has recently been reported that murine MSC derived from bone Published by Reproductive Healthcare Ltd, Duck End Farm, Dry Drayton, Cambridge CB23 8DB, UK
2 100 marrow trans-differentiate into spermatozoa (Nayernia et al., 2006a). In this paper, it was investigated whether human bone marrow stem cells (hbmsc) have the potential to express markers characteristic of male germ cell differentiation. Materials and methods Isolation and culture of hbmsc hbmsc were isolated from the bone marrow of human male fetuses of 4- to 6 months gestation, based on previously described methods (Pittenger et al., 1999; Jiang et al., 2002). This research was approved by the human ethics committee of Shaanxi Centre of Stem Cell Engineering and Technology. The bone marrow aspirate was mixed with an equal amount of Dulbecco s modified Eagle s medium (DMEM; Invitrogen, USA) and centrifuged at 300 g for 10 min at room temperature. The cells were then resuspended in DMEM, layered on a Ficoll-Hypaque gradient (density g/cm 3 ; Sigma), and centrifuged again. The low-density mononuclear fraction was collected, washed and resuspended in complete culture medium (DMEM with 10% fetal bovine serum (FBS; Hyclone, USA), penicillin/streptomycin (Invitrogen, USA) and plated at cells/100 mm 2. The cultures were maintained at 37 C in a humidified atmosphere containing 95% air and 5% CO 2, and they were and subcultured each time prior to achieving full confluency. Characterization of hbmsc: flow cytometry hbmsc at passage 5 were treated with 0.25% trypsin (Invitrogen, USA), harvested, and washed twice with culture medium. Before staining, cells were allowed to recover for 20 min in suspension. Cell staining was performed using mouse monoclonal antibodies followed by fluorescein isothiocyanate (FITC)-conjugated affinity-purified mouse fluorochromeconjugated isotype control antibodies, or FITC or phycoerythrin (PE)-coupled antibodies against the common leukocyte antigen CD45 (Becton Dickinson, USA), the surface-expressed 5ʹ-ectonucleotidase CD71 (Becton Dickinson), the β 1 -integrin CD29 (Becton Dickinson), CD11a (Becton Dickinson), CD166 (Becton Dickinson), CD117 (Abcam, UK), CD34 (Becton Dickinson) and CD44 (Becton Dickinson); all antibodies used following the manufacturers instructions. Binding of antibodies against the markers as primary antibodies was detected by antimouse immunoglobulin G (IgG) conjugate (Becton Dickinson), or isotype-specific FITC- or PE-conjugated goat anti-mouse IgG F(abʹ)2 fragments (Becton Dickinson). Cells were analysed by fluorescence-activated cell sorting (FACS) using a FACSCalibur flow cytometer. Results are expressed as the mean percentage of positive cells and standard deviation from multiple experiments. Induction of hbmsc Isolated cells were cultured at 37 C in an atmosphere of 5% CO 2 in RPMI-1640 (Invitrogen) supplemented with 10% FBS and 50 μg/ml penicillin/streptomycin (Haribin Biological Technology Corporation, China). Cells of 5 10 passages were used to induce differentiation. The cells were cultured for days in DMEM containing 10 5 mol/l retinoic acid (RA; Sigma, USA) in combination with extracts derived from adult goat testis. The preparation of testis extracts was based on the method of Häelien et al. (2004). The protein concentration of the extract was estimated spectrophotometrically and added to the medium to give a concentration of 50 μg/ml. RNA isolation and reverse transcriptionpolymerase chain reaction analysis RNA was extracted from cells and human fetal testis using the Trizol reagent (Invitrogen) according to the manufacturer s instruction. For reverse transcription-polymerase chain reaction (RT-PCR) analysis, 1 μg RNA with DNase treatment was reverse transcribed into cdna at 42 C for 50 min in a final volume of 20 μl containing 200 units Superscript reverse transcriptase (Invitrogen), 0.5 μg oligo dt Primer, 10 mmol/l dithiothreitol and 0.5 mmol/l dntps. RT-PCR was carried out with 0.5 μl cdna, 30 pmol each of forward and reverse primers and 2 units Platinum Taq polymerase (Invitrogen, Germany) in a final volume of 15 μl. The solution was incubated at 94 C for 2 min and then subjected to 35 cycles of amplification, each consisting of 95 C for 30 s (denaturation), C for s (annealing) and 72 C for 60 s (primer extension). At the end of the temperature cycles the solution was incubated at 72 C for 10 min. The PCR products were subjected to electrophoresis on 1.0% (w/v) agarose gels containing 1 mg/ml ethidium bromide and the amplified fragments were viewed and photographed under UV light. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The primers used for RT-PCR analyses are shown in Table 1. Primers were designed to span exons to distinguish cdna from genomic DNA products. Immunofluorescence staining Cells from treatment groups treated for days with RA in combination with testicular extracts, and untreated cells as controls, were used for immunofluorescence studies. The cultures were fixed using 4% paraformaldehyde for 15 min, followed by three washes in cold PBS for 5 min. Washed cultures were treated with blocking solution (1% bovine serum albumin in phosphate-buffered saline (PBS)/Tween) for a minimum of 30 min before being washed with PBS and treated with primary antibodies against OCT4 (1:500; Chemicon), β 1 - integrin (1:100; Santa Cruz Biotechnology, Inc., USA), DDX4 (1:1000; Abcam), EMA1 (1:100; Developmental Studies Hybridoma Bank, USA) and FE-J1 (1:100; Developmental Studies Hybridoma Bank) overnight at 4 C. Antibodies were diluted according to the manufacturer s or provider s instructions. Cultures were washed with PBS and incubated in the appropriate secondary antibody conjugated with FITC or tetramethylrhodamine iso-thiocyanate (1:500 dilution in PBS; Invitrogen) for 30 min at room temperature in the dark. Then cells were washed with cold Dulbecco s PBS three times for 5 min. Slides were mounted and inspected under a Leica fluorescence microscope. Results Three hbmsc cultures from human fetal bones were identified and induced for differentiation to germ cells. The individual
3 Table 1. The primers and polymerase chain reaction (PCR) conditions used for the reverse transcription-pcr analysis of treated human bone marrow stem cells. Gene Sense Antisense Product Annealing size (bp) temperature ( C) GAPDH TTAGCACCCCTGGCCAAGG CTTACTCCTTGGAGGCCATG c-kit TGACTTACGACAGGCTCGTG AAGGAGTGAACAGGGTGTGG OCT4 CGTGAAGCTGGAGAAGGAGAACTG CAAGGGCCGCAGCTTACACATGTTC DDX4 AAAGTGCCCAGTTCTTGTTGC TACCTGGATTGGGAGCTTGTGAAG DAZL ATGAAAGATAAAACCACCAACC TGTTGACAGCCTGGTCCACTGA STELLA CTCAAATCTCCTCCGAGACG GTACGAACTCCGCCCAGTAA β 1 -Integrin CTGCAAGAACGGGGTGAATG CACAATGTCTACCAACACGCCC FSHR TGAGGGCCAGGTCGACTTAC TGAGGCTGGCTTCCATGAG STRA8 AGCAGCTTAGAGGAGGTCAAGA TACTCGGAACCTCACTTTTGTC NANOG GCGCGGTCTTGGCTCACTGC GCCTCCCAATCCCAAACAATACGA htert GTGTGCTGCAGCTCCCATTTC GCTGCGTCTGGGCTGTCC SCP3 CTAGAATTGTTCAGAGCCAGAGA GTTCAAGTTCTTTCTTCAAAG ACR ATGACTGGAGACTGGTTTTCGG CTTAGCACGGGCACAGCCTA PRM1 AACCGAAGTAACATATACTCA ATCTGCTTTCTCCACGACCTC TH2B GTGCTACCATTTCCAAGAAG CTCGCTATACGCTCAAAGAT hbmsc appeared as spindle-shaped-like fibroblasts and the cells were unique in their phenotypes and assumed a monolayer configuration on reaching confluency during culture (Figure 1A C). Giemsa staining of hbmsc at passage 5 8 indicated that most of the cells were of mononuclear fibroblast morphology (Figure 1D). Overgrown confluent mononuclear cells in culture formed colonies (Figure 1E, F). The cells after five passages showed strong positive homogeneous staining for markers of mesenchymal progenitors; these markers included CD44 (Figure 2A), CD133 (Figure 2B), CD166 (Figure 2C), and the β 1 -integrin CD29 (Figure 2D). Meanwhile, these cells were negative for the markers of haematopoietic cells (CD11a; Figure 2E), and they showed weak expression of CD45 (Figure 2F), CD117 (Figure 2G) and CD71 (Figure 2H), which denote haematopoietic or mature fibroblast differentiation. To investigate the potential of hbmsc for differentiation into germ cells, the cells were treated with 10 5 mol/l RA and it was found that there were some round cells and a small number of sperm-like cells formed in the treated cultures (Figure 3). The results of RT-PCR analysis demonstrated that initially RAtreated and testicular-extract-treated and untreated hbmsc were positive for some pre-meiotic germ cell markers and markers of ESC and primordial germ cells (PGC) (Figure 4). However, the expression of the meiotic and post-meiotic markers STRA8, SCP3 and PRM1 increased in RA-treated cultures compared with the untreated group based on semi-quantitative RT-PCR (Figure 4). The expression of germ cell markers in hbmsc was consistent with previous observations (Nayernia et al., 2006a) that also indicated spontaneous differentiation of part or all of the population of human mesenchymal bone cells (hmsc) to germ cells in vitro. To confirm the effects of RA and testicular extracts together on differentiation of hmsc to germ cells, the cells were treated for 2 15 days with 10 5 mol/l RA and testicular extract. Some round and spindle-shaped cells derived after the treatment of hbmsc with RA and testicular extract showed specific expression of OCT4, VASA, β 1 -integrin and SSEA1 by immunohistochemical analysis (Figure 5). However, a small number of spermatidlike cells (<3%) in culture for days expressed FE-J1 and EMA1. All these genes are expressed specifically in PGC, spermatogonial stem cells and male germ cells (Bowles et al., 1982; Fenderson et al., 1984; Hahnel and Eddy, 1986; Hartshorne, 1997; Clark et al., 2004). After RA and testicular extract treatment, an increase in the number of cells which expressed DDX4 was detected compared with untreated cells (20% versus 5%, P < 0.01). The percentage of cells positive for germ cell markers (DDX4, FE-J1 and EMA1) was increased in induction cultures compared with the untreated group (Figure 6). The results indicated that a small subpopulation of hbmsc is able to differentiate to male germ cells and a few spermlike cells (Figure 6). However, it has not yet been determined whether these male germ cells can complete meiosis and form functional spermatozoa. Discussion Two independent reports have used a three-dimensional embryoid body differentiation strategy for male ESC, concomitant with RA treatment and/or bone morphogenetic protein 4 stimulation, to induce embryoid body differentiation into male germ cells (Toyooka et al., 2003; Geijsen et al., 2004). Nayernia et al. (2006a,b) cultured male ESC transfected with a Stra8 (stimulated by retinoic acid gene 8)-reporter and a Prm1 (protamine 1)-reporter construct in monolayer culture. Following repeated RA treatments and selection of Stra8- positive cells, Prm1-positive cells were isolated and injected into eggs, and seven live pups carrying the Prm1-reporter gene were born when the resulting embryos were transferred to surrogate mothers. Additionally, male germ cells were produced from embryonal carcinoma cells and bone-marrow-derived 101
4 Figure 1. The characteristics of human bone marrow stem cells (hbmsc). (A, B) The cells showed a spindle or fibroblast-shaped morphology. (C) A confluent culture grown as a monolayer of spindle-shaped hmsc. (D) Giemsa staining of hbmsc shows that most of the cells are of mononuclear fibroblast morphology. A phase-contrast micrograph (E) and Giemsa staining (F) show confluent mononuclear cultures of hbmsc colonies. Bar = 50 μm. 102 Figure 2. Human mesenchymal stem cells (hmsc) at fifth passage were analysed after immunofluorescence staining with flow cytometry. Staining profiles of representative samples with 10,000 events each are shown. The markers are represented by shaded histograms. The cells stained homogeneously strong with markers for mesenchymal progenitors such as CD44 (A), CD133 (B), CD166 (C), and the β 1 -integrin CD29 (D), were negative for the markers of haematopoietic cells (CD11a (E)), and weakly expressed CD45 (F), CD117 (G) and CD71 (H).
5 Figure 3. The morphology of treated human bone marrow stem cells (hbmsc). (A) Control (untreated hbmsc) confluent mesenchymal stem cells. (B, C) Some sperm-like cells (indicated by arrows) were formed in treated hbmsc 10 days after treatment with 10 5 mol/l retinoic acid. Bar = 100 μm. Figure 4. Reverse transcription-polymerase chain reaction analysis showing the expression of germ cell markers in treated human bone marrow stem cells (hbmsc). Treated hbmsc were positive for premeiotic germ cell markers and markers of embryonic stem cells and primordial germ cells, and for meiotic and post-meiotic markers such as OCT4, NANOG, htert, STELLA, DAZL and c-kit, DDX4, β 1 -integrin, STRA8, SCP3, ACR, PRM1 and TH2B. RNA isolated from human fetal testis served as the positive control. hmsc = human mesenchymal stem cell. Figure 5. Immunohistochemical analysis of treated human bone marrow stem cells (hbmsc). Specific antibodies against the germ cell and male germ cell markers OCT4 (A, green; bar = 20 μm), VASA (B, green; bar = 50 μm), β 1 -integrin (C, green; bar = 50 μm), EMA1 (D, red; bar = 50 μm) in a spermatid-like cell were obtained in treated cultures (E), bar = 50μm. The spermatidlike cell was positive for FE-J1 (F red, bar = 50 μm). 103
6 104 Cells positive for germ cell markers (%) hbmsc DDX4 Induction hbmsc FE-J1 Induction hbmsc EMA1 Induction Figure 6. The effect of retinoic acid (RA) on the differentiation of human mesenchymal stem cells (hmsc) to male germ cells. After RA treatment, an increase in the number of cells expressing DDX4, FE-J1 and EMA1 was detected as compared with untreated cells. The percentage of positive cells is shown. MSC in mice using a similar RA-based approach (Nayernia et al., 2004, 2006a). Moreover, Nayernia et al. (2006a) reported that human bone marrow also has the potential to differentiate into spermatozoa. Some cells with specific expression of male germ-like cells and a small fraction of sperm-like cells were derived from hbmscs in this study. As far as is known, this is the first report of the production of sperm-like cells derived from human adult stem cells. These results showed that RA can stimulate stem cells to differentiate into spermatozoa in vitro (Toyooka et al., 2003; Geijsen et al., 2004; Nayernia et al., 2006a,b). But RA is a multipurpose factor, which can regulate the development and differentiation of neural cells, cardiac cells and many other tissues in addition to germ cells. The appropriate concentration of RA and its temporal effects to induce germ cell specification from stem cells needs further investigation. Lue et al. (2007) showed that adult bone marrow cells, in a favourable testicular environment, may differentiate into somatic and germ cell lineages. The resident neighbouring cells in the recipient testis may control site-appropriate stem cell differentiation. These observations promise new models of germ cell development and therapy for infertility using bone marrow cells. But the defined pathway of germ cell development, differentiation derived stem cells needs to be further investigated. OCT4 and Nanog are transcription factors involved in the regulation of pluripotency during embryonic development and are detected in both pluripotent cells and other early germ cells (Allergrucci et al., 2005; Nagano, 2007). In the adult murine testes, undifferentiated spermatogonial cells expressing OCT4 are distributed on the basement membrane of the seminiferous tubules (Nagano, 2007). Expression of fragilis (also called Ifitm3) is increased in the migratory PGC, and expression of other germ-cell-specific genes such as STELLA (Saitou et al., 2002; Sato et al., 2002) and the VASA homologue (Toyooka et al., 2003) is also increased. VASA (Mvh/DDX4) encodes an ATP-dependent RNA helicase which is specific for differentiating germ cells from the late migration stage to the post-meiotic stage, with the gene being specifically expressed in early PGC. The FSH receptor is a seven transmembrane spanning receptor which plays a crucial role in male and female reproduction (Piketty et al., 2006). Recent studies have reported that the decision of meiotic entry or mitotic arrest of post-migratory PGC is regulated by RA. Male PGC do not enter meiosis because an enzyme (Cyp26b1) expressed in somatic cells in the male genital ridge degrades RA. In contrast, the repression of Cyp26b1 expression in females or its lack in nullmutant embryos allows PGC to enter meiosis (Koubova et al., 2006). These studies suggest that RA may promote meiotic entry of PGC into the genital ridge. PGC that migrate to an ectopic site (e.g. adrenal gland) spontaneously enter meiosis, regardless of their genetic sex. Additionally, RA can stimulate mitotic proliferation of PGC up to 13.5 days post coitus. Therefore, while migratory and post-migratory PGC appear to respond differently to RA, the gonadal somatic environment also has an important role in regulating sex-specific germ cell development. RA is helpful for the derivation of germ cells from ESC in vitro (Toyooka et al., 2003; Geijsen et al., 2004; Nayernia et al., 2006a,b). During embryogenesis, Stra8 expression is restricted to the pre-meiotic male developing germ cells (Oulad-Abdelghani et al., 1996). DAZ-like (DAZL) proteins are germ-cell-specific RNA-binding proteins essential for gametogenesis. In humans, loss of the Y chromosomal DAZ genes is associated with oligozoospermia or azoospermia. The DAZ genes are strong candidates for azoospermia factor c, which is one of the most common genetic causes of male infertility (Xu et al., 2007). PGC and spermatogonial cells express the cytokine receptor c-kit at relatively high levels. β 1 -Integrin and OCT-4 were expressed in germline stem cells; c-kit is a marker of spermatogonia and spermatocytes, while synaptonemal complex protein 3 (SCP3) and testis-specific histone protein (TH2B) are markers of spermatocytes, and transition protein in spermatids (Lee et al., 2006). The presence of mrna corresponding to the protamine genes can be detected in the mature testicle but also in the mature spermatozoa (Lambard et al., 2004). In the present study, it was found that hbmsc expressed OCT4, STELLA, VASA and c-kit before and after RA treatment, and this was evidence that a population of MSC shows germ cell characteristics without RA treatment (Figure 3). The results are consistent with those of Nayernia et al. (2006). However, expression of some genes, such as DDX4, STRA8, SCP3 and PRM1, specific for germ cells and male germ cells, was increased after RA in combination with testicular extract treatment which indicates that RA treatment promotes germ cell differentiation of human MSC. SCP3 is a specific marker of meiosis in male and female germ cells (Hartshorne, 1997). From these results it can be suggested that a population of hbmsc shows expression of male germcell-specific markers. These studies suggest the possibility that human MSC may recruit the germ line for undergoing meiosis. However, the completion of meiosis in ESC-derived germ cells in vitro might be promoted by additional appropriate germ cell factors and/or somatic cell interactions that are native to the specific in-vivo environment (Hua and Sidhu, 2008). In conclusion, it was found that induced hbmsc expressed the markers of male germ cell and spermatocytes, which suggests that hbmsc have the potential to differentiate into male germ cells, and adds a new potential source of male germ cells that may be used for production of male germ cells that are used for various reproductive toxicological studies.
7 Acknowledgements This work was supported by grants from the Program ( ) from National Natural Science Foundation of China, the Scientific Research Program of Shaanxi Province (2008K02 05), China Postdoctoral Science Foundation funded project ( ), and the Youth Research Key Member Program of Northwest A & F University ( ). References Allergrucci C, Thurston A, Lucas E, Young I 2005 Epigenetics and the germline. Reproduction 129, Bowles J, Knight D, Smith C et al Ectopic germ cells: natural model for the study of germ cell sexual differentiation. Proceedings of the National Academy of Sciences of the USA 79, Clark AT, Bodnar MS, Fox M et al Spontaneous differentiation of germ cells from human embryonic stem cells in vitro. Human Molecular Genetics 13, Danner S, Kajahn J, Geismann C et al Derivation of oocyte-like cells from a clonal pancreatic stem cell line. Molecular Human Reproduction 13, Dyce PW, Wen L, Li J 2006 In vitro germline potential of stem cells derived from fetal porcine skin. Nature Cell Biology 8, Fenderson BA, O Brien DA, Millette CF, Eddy EM 1984 Stagespecific expression of three cell surface carbohydrate antigens during murine spermatogenesis detected with monoclonal antibodies. Developmental Biology 103, Geijsen N, Horoschak M, Kim K et al Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, Hahnel AC, Eddy EM 1986 Cell surface markers of mouse primordial germ cells defined by two monoclonal antibodies. Gamete Research 15, Hartshorne GM 1997 In vitro culture of ovarian follicles. Reviews of Reproduction 2, Hua J, Sidhu K 2008 Recent advances in the derivation of germ cells from the embryonic stem cells. Stem Cells and Development 17, Hübner K, Fuhrmann G, Christenson LK et al Derivation of oocytes from mouse embryonic stem cells. Science 300, Jiang Y, Jahagirdar BN, Reinhardt RL et al Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, Koubova J, Menke DB, Zhou Q et al Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proceedings of the National Academy of Sciences of the USA 103, Lambard S, Galeraud-Denis I, Martin G et al Analysis and significance of mrna in human ejaculated sperm from normozoospermic donors: relationship to sperm motility and capacitation. Molecular Human Reproduction 100, 1 7. Lammarrone E, Balet R, Lower AM et al Male infertility. Best Practice and Research Clinical Obstetrics and Gynaecology 17, Lawson KA, Hage WJ 1994 Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Foundation Symposium 182, Lee DR, Kim KS, Yang YH et al Isolation of male germ stem cell-like cells from testicular tissue of non-obstructive azoospermic patients and differentiation into haploid male germ cells in vitro. Human Reproduction 21, Lue YH, Erkkila K, Liu PY et al Fate of bone marrow stem cells transplanted into the testis: potential implication for men with testicular failure. American Journal of Pathology 170, Nagano MC 2007 In vitro gamete derivation from pluripotent stem cells: progress and perspective. Biology of Reproduction 76, Nayernia K, Lee JH, Drusenheimer NN et al. 2006a Derivation of male germ cells from bone marrow stem cells. Laboratory Investigation 86, Nayernia K, Nolte J, Michelmann HW et al. 2006b In vitro differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Development Cell 11, Nayernia K, Li M, Jaroszynski L et al Stem cell based therapeutical approach of male infertility by teratocarcinoma derived germ cells. Human Molecular Genetics 13, Oulad-Abdelghani M, Bouillet P, Decimo D et al Characterization of a premeiotic germ cell-specific cytoplasmic protein encoded by Stra8, a novel retinoic acid-response gene. Journal of Cell Biology 135, Piketty V, Kara E, Guillou F et al Follicle-stimulating hormone (FSH) activates extracellular signal-regulated kinase phosphorylation independently of beta-arrestin- and dynaminmediated FSH receptor internalization. Reproductive Biology and Endocrinology 33, Pittenger MF, Mackay AM, Beck SC et al Multi-lineage potential of adult human mesenchymal stem cells. Science 284, Saitou M, Barton SC, Surani MA 2002 A molecular programme for the specification of germ cell fate in mice. Nature 418, Sato M, Kimura T, Kurokawa K et al Identification of PGC7, a new gene expressed specifically in preimplantation embryos and germ cells. Mechanisms of Development 113, Toyooka Y, Tsunekawa N, Akasu R, Noce T 2003 Embryonic stem cells can form germ cells in vitro. Proceedings of the National Academy of Sciences of the USA 100, Xu H, Li M, Gui J, Hong Y 2007 Cloning and expression of medaka dazl during embryogenesis and gametogenesis. Gene Expression Patterns 7, Zhao GQ, Garbers DL 2002 Male germ cell specification and differentiation. Developmental Cell 5, Declaration: The authors report no financial or commercial conflicts of interest. Received 26 June 2008; refereed 21 August 2008; accepted 9 February
Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.
Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper
More informationTesticular stem cells
Testicular stem cells Dirk G. de Rooij Department of Endocrinology Faculty of Biology, Utrecht University 1. Knowledge on the development of the spermatogenic stem cell lineage 2. Principals of the nature
More informationTransplantation directs oocyte maturation from embryonic stem cells and provides a therapeutic strategy for female infertility
Transplantation directs oocyte maturation from embryonic stem cells and provides a therapeutic strategy for female infertility Cory R. Nicholas 1, Kelly M. Haston 1, Amarjeet K. Grewall 2, Teri A. Longacre
More informationSymposium: Genetic and epigenetic aspects of assisted reproduction Development of artificial gametes
RBMOnline - Vol 16. No 4 2008 539-544 Reproductive BioMedicine Online; www.rbmonline.com/article/3205 on web 22 February 2008 Symposium: Genetic and epigenetic aspects of assisted reproduction Development
More informationSUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
More informationTo General Embryology Dr: Azza Zaki
Introduction To General Embryology The Human Development is a continuous process that begins when an ovum from a female is fertilized by a sperm from a male. Cell division, growth and differentiation transform
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationRejuvenation of Gamete Cells; Past, Present and Future
Rejuvenation of Gamete Cells; Past, Present and Future Denny Sakkas PhD Scientific Director, Boston IVF Waltham, MA, USA Conflict of Interest I have no conflict of interest related to this presentation.
More informationBiology 4361 Developmental Biology. October 11, Multiple choice (one point each)
Biology 4361 Developmental Biology Exam 1 October 11, 2005 Name: ID#: Multiple choice (one point each) 1. Sertoli cells a. surround spermatocytes b. are the structural components of the seminiferous tubules
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationGerm Cell Transplantation in Fish
Larvi 2009 Germ Cell Transplantation in Fish Goro Yoshizaki (Tokyo University of Marine Science and Technology, SORST/JST) Tuna Mackerel Body weight; 300 kg 300 g Body length; 3 m 30 cm Scombridae family
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationEXPRESSION PROFILING OF CREM GENE IN TESTIS WITH NORMAL AND IMPAIRED SPERMATOGENESIS IN EGYPTIAN MALES
EXPRESSION PROFILING OF CREM GENE IN TESTIS WITH NORMAL AND IMPAIRED SPERMATOGENESIS IN EGYPTIAN MALES MANAL O. EL HAMSHARY 1, ALIAA M. ISSA 2, M. K. KHALIFA 3, K. Z. SHAEER 4 1. 2. 3. Genetic Engineering
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,500 108,500 1.7 M Open access books available International authors and editors Downloads Our
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationSpermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis?
Spermatogenesis What is it and what does it look like? How do hormones regulate spermatogenesis? FSH, androgens, growth factors Animal Physiology (Hill, Wise, Anderson): Ch. 15 435-438 1 Spermatogenesis:
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationDetailed step-by-step operating procedures for NK cell and CTL degranulation assays
Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSUPPORTING ONLINE MATERIAL
SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE TEXT Efficiency of SCNT Alive fetuses at mid-gestation The rate of viable (beating heart) embryos at day 12.5-14.5 dpc was assessed after sacrifice of foster
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationFresh and Frozen Ovary Tissue Transplants: Mechanism of Adult Primordial Follicle Recruitment And Fetal Oocyte Arrest
Fresh and Frozen Ovary Tissue Transplants: Mechanism of Adult Primordial Follicle Recruitment And Fetal Oocyte Arrest Locking and Unlocking: Oocyte Meiosis and PGC differentiation Yasui et al 2012 Factors
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationfollicles and spermatogonia
5 th World Congress of the International Society for Fertility Preservation Vienna, Austria. November 16-18; 2017 Session 2: Stem cells and in vitro growth of gametes Development, sex differentiation and
More informationDevelopment, sex differentiation and clonal expansion of PGCs to create primordial follicles and spermatogonia. Scenarios for in vitro gametogenesis
5 th World Congress of the International Society for Fertility Preservation Vienna, Austria. November 16-18; 2017 Session 2: Stem cells and in vitro growth of gametes Development, sex differentiation and
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationBi-potent Gonads. Sex Determination
יצירת הגונדות Primordial Germ Cells (PGCs) Somatic cells Genital ridge Bi-potent Gonads Sex Determination Testis and Sperm Ovary and Oocyte Migration of Primordial Germ Cells in the Chick Embryo The
More informationA549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationDifferential expression of VASA gene in ejaculated spermatozoa from normozoospermic men and patients with oligozoospermia
Asian J Androl 2007; 9 (3): 339 344 DOI: 10.1111/j.1745-7262.2007.00253.x www.asiaandro.com. Original Article. Differential expression of VASA gene in ejaculated spermatozoa from normozoospermic men and
More informationGametogenesis. Omne vivum ex ovo All living things come from eggs.
Omne vivum ex ovo All living things come from eggs. William Harvery, 1651 Gametogenesis This lecture is the preface, so to speak, to embryology; that is, it introduces the development of the specialized
More informationCHAPTER. Cloning and Stem Cells
CHAPTER 18 Cloning and Stem Cells 1 Cloning and Stem Cells SUMMARY Stem cells are undifferentiated cells that can still divide and proliferate. Stem cells have the ability to become different types of
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationHuman Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Introduction Kit Components Cat. # # of vials Reagent Quantity Storage
Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Catalog #5901 Introduction Human pluripotent stem cells (hpsc), including embryonic stem cells (ESC) and induced pluripotent stem
More informationKnockout TM SR : ; ; ; : R ; R : A : X(2013) , ,, B. , (Knockout TM
33 1 Vol.33 No.1 013 1 Dec. 013 Reproduction & Contraception doi: 10.7669/j.issn.03-37X.013.1.0804 E-mail: randc_journal@163.com Knockout TM SR ; ; ; 400014 : FBS Knockout TM SRKSR : FBS KSR HE TUNEL RT-PCR
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationEFFECTS OF NICOTINE ON HUMAN MESENCHYMAL STEM CELLS. Connor McNeil Central Catholic HS
EFFECTS OF NICOTINE ON HUMAN MESENCHYMAL STEM CELLS Connor McNeil Central Catholic HS Purpose To determine whether nicotine causes any effects on human Mesenchymal Stem Cell (hmsc) proliferation or migration
More informationBiology 4361 Developmental Biology Exam 1 ID#: October 11, 2005
Biology 4361 Developmental Biology Name: Key Exam 1 ID#: October 11, 2005 Multiple choice (one point each) 1. Primordial germ cells a. are immortal b. produce polar bodies c. are haploid d. are somatic
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationMcAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells
Effects of McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells X.C. Wei, D.D. Yang, X.R. Han, Y.A. Zhao, Y.C. Li, L.J. Zhang and J.J. Wang Institute of hematological research,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSPERMATOGENESIS IN VITRO
SPERMATOGENESIS IN VITRO INDUCTION OF PROLIFERATION, MEIOSIS AND DIFFERENTIATION Mário Sousa Lab Cell Biology Institute of Biomedical Sciences (ICBAS) University of Porto msousa@icbas.up.pt Spermatogonia
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationstem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products
stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products Stem Cell Qualified Extracellular Matrix Proteins Stem cell research requires the finest
More informationEffect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63
68 Chin J Cancer Res 22(1):68-72, 2010 www.springerlink.com Original Article Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 Jing-Wei Wang 1, Yi Liu 2, Hai-mei Tian 2, Wei
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More information5 15/3/2012. Malik Al-Momani
5 15/3/2012 Malik Al-Momani بسم هللا الرحمن الرحيم Spermatogenesis Note : Please refer to slides so see photos. Quick Revision : - Testis is divided by septum into testicular lobules, inside the lobules
More informationInstructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests
3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationAnnexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationAnimal Development. Lecture 3. Germ Cells and Sex
Animal Development Lecture 3 Germ Cells and Sex 1 The ovary of sow. The ovary of mare. The ovary of cow. The ovary of ewe. 2 3 The ovary. A generalized vertebrate ovary. (Wilt and Hake, Ch 2, 2004) 4 The
More informationTesticular germ cells can colonize sexually undifferentiated embryonic gonad and produce functional eggs in fish
Testicular germ cells can colonize sexually undifferentiated embryonic gonad and produce functional eggs in fish Tomoyuki Okutsu*, Kensuke Suzuki*, Yutaka Takeuchi*, Toshio Takeuchi*, and Goro Yoshizaki*
More informationDAX1, testes development role 7, 8 DFFRY, spermatogenesis role 49 DMRT genes, male sex differentiation role 15
Subject Index N-Acetylcysteine, sperm quality effects 71 Ambiguous genitalia, origins 1, 2 Anti-Müllerian hormone function 13 receptors 13 Sertoli cell secretion 10, 38 Apoptosis assays in testes 73, 74
More informationSenior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University
Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationThe expression and significance of CATSPER1 in human testis and ejaculated spermatozoa
Asian J Androl 2006; 8 (3): 301 306 DOI: 10.1111/j.1745-7262.2006.00132.x. Original Article. The expression and significance of CATSPER1 in human testis and ejaculated spermatozoa Hong-Gang Li, Ai-Hua
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationResident cardiac stem cells: how to find and use them
Resident cardiac stem cells: how to find and use them G. Hasenfuß Cardiology and Pneumology Heart Research Center Göttingen Georg-August-University Göttingen Definition: Stem cell Selfrenewal Stem cell
More informationInduction of spermatogenic synchrony by retinoic acid in neonatal mice
EDITOR'S Letter to CORNER the Editor Spermatogenesis 3:1, e23180; January/February/March 2013 2013; 2013 Landes Bioscience EDITOR'S CORNER Induction of spermatogenic synchrony by retinoic acid in neonatal
More informationExosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway
Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
More informationAdapted from Preg. & Part., Senger
MALE ENDOCRINOLOGY AND SPERMATOGENESIS (Chapter 10) AVS 222 (Instructor: Dr. Amin Ahmadzadeh) I. MALE ENDOCRINOLOGY (Figure10-1 to 10-3) A. Glands and their respective hormones 1) Hypothalamic hormone:
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationSupplementary Information
Supplementary Information 1 Supplementary information, Figure S1 Establishment of PG-haESCs. (A) Summary of derivation of PG-haESCs. (B) Upper, Flow analysis of DNA content of established PG-haES cell
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationIMMP8-1. Different Mechanisms of Androg and IPAD on Apoptosis Induction in Cervical Cancer Cells
IMMP8-1 Different Mechanisms of Androg and IPAD on Apoptosis Induction in Cervical Cancer Cells Assanan Dokmaikaew* Tipaya Ekalaksananan** Dr.Chamsai Pientong** ABSTRACT Androg and IPAD are recently known
More informationCell Divisions. The autosomes represent the whole body. * Male Sex Chromosomes: XY * Female Sex Chromosomes: XX
Cell Divisions Each Cell (including gonads) has 46 chromosomes (23 pairs of chromosomes: 22 pairs of autosomes, 1 pair of sex chromosomes) which are located in the nucleus). The autosomes represent the
More informationLesson 1. Quiz (short) Cell cycle Chromosomes Mitosis phases
Lesson 1 Quiz (short) Cell cycle Chromosomes Mitosis phases 2 Cell division is needed for Growth (Mitosis) Repair (Mitosis) Reproduction (Meiosis) 3 Mitosis consists of 4 phases (division of the nuclear
More informationGerm cells and germ cell transplantation
Int. J. Dev. Biol. 42: 855-860 (1998) EGF, epithelium and Germ cells and germ cell transplantation 855 Germ cells and germ cell transplantation ANNE MCLAREN* Wellcome/CRC Institute of Cancer and Developmental
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationBiology Developmental Biology Spring Quarter Midterm 1 Version A
Biology 411 - Developmental Biology Spring Quarter 2013 Midterm 1 Version A 75 Total Points Open Book Choose 15 out the 20 questions to answer (5 pts each). Only the first 15 questions that are answered
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationHistology of Male Reproductive system (1)
Histology of Male Reproductive system (1) Prof. Dr. Malak A. Al-yawer Learning Objectives At the end of this lecture, the medical student will be able to: State the organization of the testis Define seminiferous
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationComparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy
Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy Jiali Luo 1, 2, 3, 4, a, Shanshan Feng 1, 2, 3, 4, b 1Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University,
More informationRayBio Annexin V-FITC Apoptosis Detection Kit
RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationCluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,
A Transcriptome (RNA-seq) Transcriptome (RNA-seq) 3. 2.5 2..5..5...5..5 2. 2.5 3. 2.5 2..5..5...5..5 2. 2.5 Cluster Dendrogram RS_ES3.2 RS_ES3. RS_SHS5.2 RS_SHS5. PS_SHS5.2 PS_SHS5. RS_LJ3 PS_LJ3..4 _SHS5.2
More informationMinireview. Telomerase Activity and Telomere Length in Male Germ Cells. Downloaded from Saffet Ozturk 1
BIOLOGY OF REPRODUCTION (2015) 92(2):53, 1 11 Published online before print 7 January 2015. DOI 10.1095/biolreprod.114.124008 Minireview Telomerase Activity and Telomere Length in Male Germ Cells Saffet
More informationSupplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
More information