Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Transcription

1 Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin mediated proteolysis) in sorted hematopoietic populations (GSE60101), ranked by expression in HSC (LT- and ST-). (b) Huwe1 RNA-seq counts per million in hematopoietic cell populations shown in (a). (c) Frequency of HSC in bone marrow of Huwe1 +/Y Mx1-Cre + (WT) or Huwe1 F/Y Mx1-Cre + (cko) 4 weeks post-pi:pc treatment. (d) HSPCs were sorted from bone marrow from WT or cko mice 4 weeks post pi:pc treatment and serial colony formation in methylcellulose cultures was scored over two passages. Frequency of donor cells within total bone marrow (e) or LSK population (f) of lethally-irradiated CD recipient mice transplanted with 1x10 6 bone marrow cells from untreated CD WT or cko mice, analyzed 28 weeks after pi:pc treatment. (g) WT or Mx1-cKO mice were given a single dose of 5-FU and cell cycle distribution was determined by intracellular Ki67/DAPI staining within gated HSC. *P < 0.05, **P < 0.01, ***P < (two-tailed t-test). Data are representative of two experiments with five mice per group (c; mean and s.e.m.), two experiments with three technical replicates each (d; mean and s.e.m.), one experiment with four recipient mice per group (e-f; mean and s.e.m.) or one experiment with five mice per group (g; mean and s.e.m.).

2 Supplementary Figure 2 Huwe1-deficient fetal liver HSCs are not reduced in number but are functionally impaired. (a) Flow cytometry of fetal livers from Huwe1 +/Y Vav1-Cre + (WT) and Huwe1 F/Y Vav1-Cre + (cko) at E18.5 showing average frequency of Lin - c-kit + Sca1 + HSPCs (upper panels), sub-fractionated further with CD48 and CD150 (lower panels). (b) Total cells recovered from E18.5 WT or cko fetal livers. (c) 2x10 4 cells from either WT or cko E18.5 fetal livers were plated in methycellulose, scored for colony formation and harvested 7d later. 5x10 3 cells were replated and scored again the following week. *P < 0.05, **P < 0.01 (one-way ANOVA). Data are representative of two experiments with a minimum of three embryos per genotype (a-b; mean and s.e.m.) or three technical replicates from two embryos per genotype (c).

3 Supplementary Figure 3 Huwe1 is required for lymphoid specification of HSPCs in vitro. (a) Thymii isolated from 8-week-old Huwe1 +/Y Vav1-Cre + (WT) or Huwe1 F/Y Vav1-Cre + (cko) mice. Sorted Lin - Sca1 + c-kit + cells from the bone marrow of WT or cko mice were co-cultured with OP9 stromal cell lines expressing either empty vector (OP9-MIG) (b) or a cdna to ectopically express the Notch ligand Dll1 (delta-like 1) (OP9-DL1) (c). Under these conditions, bone marrow progenitors will differentiate into B cells and T cells, respectively, in the presence of Flt3-L (5 ng/ml) and IL-7 (1 ng/ml). Cells derived from either genotype were harvested at the time points shown, stained for markers of myeloid (Gr1, CD11b), B cell (CD19) and T cell (CD4, CD8, CD25, CD44) differentiation and analyzed by flow cytometry. *P < 0.05, **P < 0.01, ***P < (two-tailed t-test). Data are representative of two experiments with three technical replicates per genotype (b-c; mean and s.e.m.).

4 Supplementary Figure 4 Aged Huwe1 Vav1-cKO mice exhibit myeloid expansion and anemia. Complete blood counts (CBC) were measured from 4 month old Huwe1 +/Y Vav1-Cre + (WT) or Huwe1 F/Y Vav1-Cre + (cko) littermates. (a) Hemoglobin (Hb) content, (b) red blood cell (RBC) counts and (c) white blood cell (WBC) counts from peripheral blood of aged WT and cko mice are shown. (d) Light micrographs of stained blood smears (left, 20x) and histological sections of bone marrow (middle, 10x) and spleen (right, 5x) comparing tissues from WT (upper panels) and cko (lower panels) mice. Insets are of light micrographs taken at 63x magnification. (e) Peripheral blood mononuclear cells (PBMCs) and spleen suspensions (f) from aged WT or cko mice were analyzed for expression of mature cell markers by FACS. Average frequency of B cells (B220 + ), T cells (CD4 + helper or CD8 + cytotoxic) and granulocytes/monocytes (CD11b + Gr1 lo/hi ) in each organ by cohort is shown. *P < 0.05, **P < 0.01 (two-tailed t-test). Data shown represents analyses of nine WT and six cko mice (a-c, e-f; mean and s.e.m.).

5 Supplementary Figure 5 Unique gene-expression signatures in N-myc hi HSCs versus N-myc lo HSCs. (a) Schematic representing targeting strategy for Mycn M allele. The 3 exons of Mycn, mcherry cdna and loxp-flanked Neomycin resistance cassette are depicted. Recombination between the endogenous Mycn locus and the long (5.6kb) and short (2kb) homologous arms off the targeting construct yields Mycn MNeo. Expression of Cre recombinase leads to looping out of the Neo cassette and results in a functional Mycn M allele. mcherry hi and mcherry lo CD150 + HSPCs were sorted from pooled bone marrow from Mycn M/M mice. Whole RNA was isolated from either population and amplified cdna was hybridized to Affymetrix microarrays. (b) Heat map of genes that were differentially expressed (fold change > 2, P < 0.05) between the N-myc hi and N-myc lo cells. Gene sets were tested for enrichment in expression among either population. Enrichment plots for two gene sets that were highly enriched in the N- myc hi HSPCs are shown: (c) Genes upregulated in small cell lung carcinoma where MYCN is amplified and (d) Genes highly expressed in stem cells from adult tissues.

6 Supplementary Figure 6 Identification of genome-wide transcriptional targets of N-myc in HSCs. (a) Smear plot illustrating global gene expression changes in Huwe1-deficient HSCs. Differentially expressed transcripts are highlighted in red. (b) Chart showing distribution of N-myc peaks across genomic regions. (c) Heat map of ChIP-sequencing read densities for N- Myc, H3K27ac, H3K4me3 and H3K27me3. All heatmaps are centered on N-myc peaks +/- 5kb and scaled to reads per million.

7 Supplementary Figure 7 Restoration of HSC function in Huwe1- and N-myc-dKO mice. (a) HSPCs sorted from bone marrow of Huwe1 +/Y Mycn +/+ Mx1-Cre + (WT), Huwe1 F/Y Mycn +/+ Mx1-Cre + (Huwe1 cko), Huwe1 +/Y Mycn F/F Mx1-Cre + (N-myc cko) or Huwe1 F/Y Mycn F/F Mx1-Cre + (dko) mice two weeks after pi:pc treatment were plated in complete methylcellulose medium (M3434) and colonies were enumerated, harvested and replated every 7d for 3 passages. (b) Absolute number of phenotypic HSC as determined by FACS in the bone marrow from mice with indicated genotypes. (c) Representative FACS histograms showing GFP fluorescence in HSC and myeloid progenitors from Mycn +/+ Myc G/+ Mx1-Cre+ or Mycn F/F Myc G/+ Mx1-Cre + mice 2 weeks after pi:pc administratrion. (d) Relative levels of Mycn and Myc mrna were measured by qrt- PCR in Lin - Kit + Sca1 + cells from bone marrow of WT or N-myc cko mice, using Gapdh as an internal control. (e) HSPCs from Huwe1 F/Y Cre - mice were transduced simultaneously with Cre (or empty) retrovirus with a bicistronic Thy.1.1 reporter and a retroviral shrna GFP construct targeting a previously identified Huwe1 substrate or Renilla luciferase. Thy1.1 + GFP + cells were sorted 48h later, plated in methylcellulose medium and scored for colony formation as in (a). *P < 0.05, **P < 0.01 (a, e; one-way ANOVA, b,d; two-tailed t-test). Data are representative of two experiments with three technical replicates (a, e; mean and s.e.m.), analyses of four mice per genotype (b; mean and s.e.m.), or one experiment with three biological replicates (c-d; mean and s.e.m. in d).

8 Supplementary Table 1 Conjugated Clone dilution Manufacturer Cat. No. Alexa-780 2B8 1:400 ebioscience APC 2B8 1:200 Biolegend PE-Cy7 M1/70 1:300 BD Biosciences Biotin M1/70 1:300 Biolegend efluor450 A7R34 1:50 ebioscience PE A2F10 1:50 Biolegend APC TC15-12F12.2 1:200 Biolegend PE TC15-12F12.2 1:200 Biolegend efluor :100 ebioscience APC-Cy7 1D3 1:400 BD Biosciences PE PC61.5 1:400 BD Biosciences APC PC61.5 1:400 BD Biosciences APC-Cy C11 1:100 Biolegend Biotin 145-2C11 1:300 Biolegend FITC RAM34 1:50 ebioscience APC RAM34 1:50 BD Biosciences Biotin RM4 5 1:300 BD pharmingen APC RM4 5 1:100 BD pharmingen FITC S7 1:400 BD Biosciences FITC A20 1:200 BD Biosciences PerCP-Cy5.5 A20 1:400 ebioscience PE 104 1:200 Biolegend FITC 104 1:200 BD pharmingen Biotin RA3-6B2 1:300 BD pharmingen Pacific Blue RA3-6B2 1:400 BD pharmingen Pacific Blue HM48-1 1:200 Biolegend PE-Cy :100 Biolegend Biotin :300 Biolegend APC II/41 1:400 BD Biosciences PE-Cy7 D7 1:400 Biolegend Biotin RB6-8C5 1:300 Biolegend APC RB6-8C5 1:300 BD Biosciences Biotin TER-119 1:300 BD pharmingen PE-Cy7 TER-119 1:300 ebioscience FITC 1:1000 BD Biosciences efluor710 1:1000 ebioscience APC-eFluor780 1:800 ebioscience

9 Supplementary Table 2 Gene Name Forward primer (5'-3') Reverse primer (5'-3') Huwe1 GGGCTTCTATGAAATCATTCCA AAACCACTGGATCTGAATAGAG Mycn CTCCGGAGAGGATACCTTGA TCTCTACGGTGACCACATCG Myc ACAGGACTCCCCAGGCTCCG CGTGGCTGTCTGCGGGGTTT Stat1 GCTCCTGCGTGCAGTGATCGT TCCGGGTGCAGGTTCGGGAT Cdkn1c GTCTGAGATGAGTTAGTTTAGAGG TGCTACATGAACGAAAGGTC Cdk6 GGCGTACCCACAGAAACCATA AGGTAAGGGCCATCTGAAAACT Tek CTGGAGGTTACTCAAGATGTGAC TCCGTATCCTTATAGCCTGTCC Mpl CCCACCTGGGAGAAATGTGAAGAG CCGGTGTAGGTCTGGAAGCGAGGG Ndn CCCCACATCGAGCCTCCCGA AGGCCACGCCTGGGGATCTT Satb1 GAGTGATCCGAAGGGTCCAC GGTTCCTTTCCTAAGGTTGGTTT Nr1d1 AGCCGAGTGTCCCCCAGCAA CGCCCAAAACGCACAGCATCTC Topbp1 CCGGGCACCCTTGGCAGTTT AGGCCTGGGTCAGAGCTCCTT Trp53 AAGATCCGCGGGCGTAA CATCCTTTAACTCTAAGGCCTCATTC