Successful reproduction is controlled by the secretion

Transcription

1 RESEARCH ARTICLE Gonadotropin-Inhibitory Hormone, the Piscine Ortholog of LPXRFa, Participates in 17b-Estradiol Feedback in Female Goldfish Reproduction Xin Qi,* Wenyi Zhou,* Qingqing Wang, Liang Guo, Danqi Lu, and Haoran Lin State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Province Key Laboratory for Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou , China Gonadotropin-inhibitory hormone (GnIH) plays a critical role in regulating gonadotropin-releasing hormone, gonadotropin hormone, and steroidogenesis in teleosts. In the present study, we sought to determine whether 17b-estradiol (E2) acts directly on GnIH neurons to regulate reproduction in goldfish, a seasonal breeder, and we investigated the role of estrogen receptors (ERs) in mediating this process. We found that GnIH neurons coexpress three types of ERs. Ovariectomy and letrozole implantation into female goldfish at the vitellogenic stage elicited a substantial decrease in the expression of GnIH messenger RNA (mrna), and E2 supplementation abolished this effect. In primary cultured hypothalamus cells, E2 increased GnIH mrna levels; surprisingly, selective ERa and ERb agonists showed opposite effects in regulating GnIH mrna levels. Using genome walking, we isolated a 2329-bp section of the GnIH promoter sequence, and 7 half estrogen response elements (EREs) were found in the promoter region. Luciferase assays and electrophoretic mobility shift assay results show that the half-ere element at is the key site for competitive binding between ERa and ERb. Ovariectomy and letrozole implantation into female goldfish in the maturating stage did not change the GnIH mrna expression levels. Taken together, these findings suggest that E2 binds to multiple types of ERs, which competitively bind to the same half-ere binding site of the GnIH promoter to achieve both positive and negative feedback in response to estrogen to regulate goldfish reproduction at different stages of ovarian development. (Endocrinology 158: , 2017) Successful reproduction is controlled by the secretion of gonadotropin-releasing hormone (GnRH) from the brain (1), where tonic release is regulated by negative feedback from gonadal sex steroids, and the preovulatory surgelike release in females is regulated by positive feedback from steroids (2). GnRH cells do not express estrogen receptor (ER)a (3) but do express a subset of ERb isoform (4). Reports have shown that the action of ERb in GnRH neurons does not seem to be critical for the negative feedback control of estrogen on GnRH release (5, 6), indicating that estrogen must target upstream modulators of GnRH neurons. In 2000, a novel hypothalamic RFamide peptide, gonadotropin-inhibitory hormone (GnIH), which rapidly and dose-dependently inhibits gonadotropin release from cultured pituitary cells, was identified in Japanese quail. It was reported that this newly discovered GnIH acts as a key neurohormone controlling both central and peripheral reproductive functions in mammals and birds (7 10). In rodents, GnIH-producing cell bodies are located solely in the dorsomedial nucleus of the hypothalamus (DMH), and.40% of GnRH cells receive projections from GnIH fibers (11). Additionally, the intracerebroventricular or peripheral administration ISSN Print ISSN Online Printed in USA Copyright 2017 Endocrine Society Received 4 August Accepted 27 December First Published Online 4 January 2017 *These authors contributed equally to this study. Abbreviations: cdna, complementary DNA; DMH, dorsomedial nucleus of the hypothalamus; E2, 17b-estradiol; EGFP, enhanced green fluorescent protein; EMSA, electrophoretic mobility shift assay; ER, estrogen receptor; ERE, estrogen response element; FSH, follicle-stimulating hormone; GnIH, gonadotropin-inhibitory hormone; GnRH, gonadotropin-releasing hormone; GtH, gonadotropin hormone; mrna, messenger RNA; NPPv, nucleus posterioris periventricularis ventralis; PBS, phosphate-buffered saline Endocrinology, April 2017, 158(4): doi: /en

2 doi: /en of GnIH results in a rapid and strong inhibition of luteinizing hormone secretion in hamsters, rats, sheep, and cattle (11 13). Furthermore, in hamsters, GnIH neurons have been reported to express ERa but not ERb (11). Estradiol-17 treatment has been shown to reduce c-fos labeling in enhanced green fluorescent protein (EGFP) GnIH neurons in the DMH of young transgenic female rats carrying an EGFP-tagged GnIH promoter (14). These results suggest that GnIH may play a role in mediating estrogen feedback upon GnRH release. Goldfish have numerous characteristics that make this species an excellent model for reproductive neuroendocrine studies of economically important fish, especially seasonally breeding fish. As a seasonally breeding cyprinid, goldfish have seasonal cycles during which gonadal size, serum steroid levels, and gonadotropin hormone (GtH) levels fluctuate. Following spawning, there is a decrease in gonadal size and blood steroid levels, concurrent with a decrease in blood GtH levels. During the autumn and winter gonadal recrudescence period, gonad size and sex steroid levels increase to maximal levels at the time of spawning. Additionally, goldfish are able to tolerate many types of surgical treatment, such as ovariectomy, hypophysectomy, and pinealectomy. Additionally, previous studies provide well-defined and clear nomenclature describing the structure of the goldfish brain (15) and pituitary (16, 17). These factors make goldfish a useful model animal for studying the neuroendocrine regulation of reproduction. Previously, we studied the role of GnIH in fish reproduction. Both zebrafish and native goldfish peptides were found to inhibit GnRH and GtH subunit messenger RNA (mrna) synthesis and to reduce serum LH concentrations in vivo as well as to inhibit the stimulatory effect of GnRH on GtH subunit synthesis (18, 19). Additionally, because we found that both GnIH and its receptors were highly expressed in the gonad of goldfish, we began to investigate the role of GnIH in goldfish gonads. We found that GnIH acts directly on steroidogenesis in the gonads (20). In a sex-reversed fish, grouper, we found that GnIH and its receptor were much more highly expressed in males than in females, indicating that GnIH may play an important role in female-to-male reversal or the maintenance of the male sex (21). These results suggest that GnIH plays an important role in regulating the reproduction of teleosts. Whether GnIH mediates estrogen feedback should be explored in future studies. To further understand the role of GnIH in 17bestradiol (E2) feedback in goldfish reproduction, we investigated the direct effects of E2 on GnIH expression in the goldfish hypothalamus. We demonstrated a direct influence of E2 on the expression of GnIH and therefore on feedback to the reproductive system. We also identified a competitive binding effect of ERa and ERb at the half estrogen response element (ERE) site, which mediates the upregulation and downregulation of GnIH transcription. These novel findings demonstrate that goldfish GnIH may participate in both positive and negative feedback depending on the different ratios of ERa and ERb in goldfish GnIH neurons. Materials and Methods Animals and chemicals Female goldfish (Carassius auratus) weighing 80 to 90 g were obtained from a local fish farm in Guangzhou, China, and allowed to acclimatize for 14 days in tanks with a water temperature of either 12 C (maturating condition) or 28 C (developing condition) (22) and a photoperiod cycle of 14 hours light/10 hours dark. The goldfish were fed a commercial diet (1% of body weight fed twice a day; Chia Tai, Beijing, China) without any supplemental hormones. Serum estradiol concentration was measured using an estrogen enzyme-linked immunosorbent assay kit (Cayman Chemical, Ann Arbor, MI). Letrozole and E2 were purchased from Sigma-Aldrich (St. Louis, MO). All animal experiments were conducted in accordance with the guidelines and with the approval of the Animal Research and Ethics Committees of Sun Yat-Sen University. Double in situ hybridization of GnIH and ERs To confirm the direct regulation of E2 on GnIH expression, we performed double in situ hybridization as described previously (23), with modifications. Briefly, we first perfused female goldfish at the vitellogenic stage with MS-222 containing saline, followed by 4% paraformaldehyde/phosphate-buffered saline (PBS). For the double in situ hybridization, we used a mixture of digoxigenin-labeled GnIH probe and fluoresceinlabeled ERa probe, ERb1 probe, or ERb2 probe. After the hybridization and posthybridization steps, the sections were washed and blocked with blocking reagent (Roche Diagnostics, Mannheim, Germany). Then, slides were incubated for 1 hour with a horseradish peroxidase conjugated antifluorescein antibody (diluted 1:500 with blocking reagent; Roche Diagnostics) for the ER detection. Sections were rinsed twice with PBS for 5 minutes and incubated with tyramide kits with Alexa Fluor 594 (Invitrogen, Carlsbad, CA) for 30 minutes; during this period, sections were observed with a fluorescence microscope to confirm that the staining was ready for the second fluorescein detection. Then, the slides were rinsed twice with PBS for 5 minutes each and incubated with an overdose of H 2 O 2 for 20 minutes to inactivate all the horseradish peroxidase (0.3% H 2 O 2 in PBS). Sections were then rinsed twice with PBS for 5 minutes, blocked with the blocking reagent for 30 minutes, incubated with a horseradish peroxidase conjugated antidigoxigenin antibody (dilution 1:500 with blocking reagent) for 1 hour for the GnIH detection. Sections were rinsed twice with PBS for 5 minutes and incubated with tyramide kits with Alexa Fluor 488 (Invitrogen) for 15 minutes. The incubation for this substrate was performed until visible signals were detected, at which point it was stopped by washing in PBS containing 0.5 mm EDTA. Sections were coverslipped with ProLong Gold antifade mountant (Invitrogen). Fluorescence was observed

3 862 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): under a Leica TCS SP2 laser-scanning confocal microscope (Leica, Wetzlar, Germany). Ovariectomy, estrogen replacement, and letrozole implantation The ovariectomy was performed as described previously (23). Briefly, after the fish were anesthetized with 0.02% MS- 222, an incision was made from near the cloaca to the throat along the medial line of the abdomen, separating the pelvic girdles. The ovaries were completely removed with forceps. The removed ovaries were fixed with Bouin s solution for histological testing. After ovariectomy, a silicone cube containing E2 was implanted into animals in the ovariectomized plus E2 group. After the operation, the incision was sutured with silk thread. The sham surgery was conducted in the same fashion except that the ovaries were kept intact. Letrozole implantation was performed as described previously (24). After the surgery, the fish were kept in 0.7% NaCl for ;1 hour and then transferred to an aquarium, where they were kept under the conditions described above. Serum estradiol concentration was measured using an estrogen enzyme-linked immunosorbent assay kit (Cayman Chemical). The serum was purified according to the extraction protocol; briefly, 500 ml of each sample was aliquoted into separate tubes. Ethyl acetate/ hexane (50:50) was added to the sample, followed by vortexing 3 times and then transfer to a new tube. Next, the mixture was evaporated under a gentle stream of nitrogen. The extracts were dissolved in the same amount of enzyme immunoassay buffer to the original sample volume. The standard samples were diluted to the desired concentration based on the manufacturer s instructions. The standard curve is shown in Supplemental Fig. 2. Primary hypothalamus cell culture Because the GnIH neurons were only localized in the nucleus posterioris periventricularis ventralis (NPPv) region of goldfish hypothalamus (25) and because of the limited number of GnIH neurons in the brain, we developed the primary culture of fish hypothalamus cells according to the established rodent protocols (26, 27) with modifications. Briefly, 20 to 25 hypothalami excised from goldfish were isolated and cut into thin slices (0.9 mm thick). The slices obtained were washed twice and incubated at 28 C for 25 minutes in M199 medium containing 3 mg/ml trypsin (Sigma-Aldrich) with constant shaking. The reaction was terminated by adding 1.25 mg/ml soybean trypsin inhibitor (Sigma-Aldrich). After a brief rinse, the hypothalamus slices were gently dispersed in Ca 2+ -free M199 (Invitrogen) supplemented with 0.1 mg/ml DNase II (Sigma-Aldrich). The undispersed fragments were removed using a filter screen with a mesh size of 30 mm, and the hypothalamus cells obtained were cultured in neurobasal medium (Invitrogen) with 200 mm L-glutamine, a 1:50 dilution of B27 serum-free supplement (Invitrogen), 100 U/mL penicillin, and 0.1 mg/ml streptomycin. After culturing for 3 days, the cell culture was replaced with fresh medium without L-glutamine. At this stage, glial cell attachment and spreading could be noted based on neuronal recovery, as indicated by neurite outgrowth in bipolar/tripolar neurons and the clustering of neuronal cells onto glial cells. The cells were incubated for another 11 days prior to E2 or agonist treatment, and the media were replaced every 3 days. RNA extraction, reverse transcription, and real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen). The amount and purity of the RNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). One microgram of isolated RNA was used to synthesize first-strand complementary DNAs (cdnas) using the ReverTra Ace-a first-strand cdna synthesis kit (Toyobo, Osaka, Japan). Real-time PCR was performed using a Roche LightCycler 480 using the SYBR Green I kit (Toyobo) according to the manufacturer s instructions. Elongation factor-1a was used as an internal control for goldfish GnIH. Relative mrna levels were determined using the standard DD cycle threshold method. Promoter isolation and analysis The 5 0 flanking regions of the GnIH genes were isolated using the Universal Genome Walker kit (BD Biosciences Clontech, Palo Alto, CA) according to the manufacturer s instructions. Briefly, four Genome Walker libraries were constructed using the restriction enzymes EcoRV, StuI, Dral, and PvuII. PCR and nested PCR were performed using the primers listed in Table 1. The PCR products obtained above were purified using the E.Z. N.A. gel extraction kit (Omega Bio-tek, Norcross, GA), subcloned into the ptz57r/t vector (Fermentas), and verified by sequencing on an ABI 3700 sequencer (Applied Biosystems). To locate the transcriptional start site of the goldfish GnIH, the 5 0 rapid amplification of cdna ends was carried out using the SMARTer rapid amplification of cdna ends kit (BD Biosciences Clontech). Luciferase assay Rat glioma cells (C6) and rat pheochromocytoma cells (PC12) were used for the promoter activity assays. Different lengths of GnIH promoters were cloned into the pgl3 plasmid. For the expression plasmids, full-length goldfish ERa (GenBank accession number AY055725), ERb1 (AF061269), and ERb2 (AF177465) were cloned into pcdna3. The pgl3 plasmid containing ERE-deleted GnIH mutant was constructed using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Primer sequences used for this study are listed in Table 1, and all of the constructs were verified by sequencing. To examine the promoter activities in response to E2 in C6 and PC12, cells were grown at a density of cells/ml in 24-well plates, and Lipofectamine 2000 (Invitrogen) was used to cotransfect the cells with 0.5 mg of the GnIH promoter construct, 0.1 mg of the ER-expressing construct, and 20 ng of Renilla luciferase plasmid. After 6 hours, cells were starved with serum-free DMEM for 24 hours and then treated with the indicated doses of E2 or ER agonist. Relative luciferase activities were first normalized to Renilla and then expressed as fold changes over the untreated control. Each experiment was performed at least 3 times. Electrophoretic mobility shift assay HEK293T cells were transfected with the ER expression vector before the nuclear extraction. The extractions were prepared using the NE-PER nuclear extraction reagent (Pierce, Rockford, IL). Oligonucleotides containing the wildtype and the mutant ER binding site were biotin labeled using a biotin 3 0 -end DNA labeling kit (Pierce). Equal

4 doi: /en Table 1. Nucleotide Sequences of the Primers Used for Genome Walking, Plasmid Construction, Real-Time PCR, and In Situ Hybridization and EMSA Probe Preparation Primers and Probes Sequences (From 5 0 to 3 0 ) Primers for in situ hybridization probe preparation GnIH probe-f GCCACTTCCTGATGACACTG GnIH probe-r TGTTTGTGGGCTTCGTTAGT ERa probe-f GATGAAAGGAGGTATTCGTAA ERa probe-r AGGCGTCAGTGATGTTGT ERb1 probe-f TCTCCATCCCTACCAGTG ERb1 probe-r GGTAACCACCTTATTTCCAC ERb2 probe-f GCCTGTCAGGATTATTCAC ERb2 probe-r TGTACGGCTTCTTTATTGG Primers for real-time PCR GnIH real-time-f CTCCCACCATCCTGCGACTT GnIH real-time-r CTTTGCGGTAGGGTGGCTGA ef1a real-time-f AAGAACGTGTCTGTCAAGG ef1a real-time-r GTTCAGGATGATGACCTGAG Primers for GnIH promoter cloning Adaptor GW-AP1 GTAATACGACTCACTATAGGGC Primer GW-AP2 ACTATAGGGCACGCGTGGT GnIH-GW-R1 CTGTCATCAGGAAGTGGC GnIH-GW-R2 CGTCACCTCCCTCAGCAT GnIH-GW-R3 GGGTGCCGAGGGCTAAA GnIH-GW-R4 GGGCTCTGCAATCATGCAGT GnIH-GW-R5 ATTCGCAGCCTCTCACAAAA Primers for ER-expressing plasmid construction ERa-ORF-F TGCTCTAGAATGTACCCTAAGGAGGAGCA ERa-ORF-R CCGCTCGAGTCAGGGGTCTGGACTCTGC ERb1-ORF-F TGCTCTAGAATGACAGCACTGAACTCGTAC ERb1-ORF-R CCGCTCGAGTTAGGGTCTTAAGGTCCCGC ERb2-ORF-F TGCTCTAGAATGAGCTCCTCCACTGGTC ERb2-ORF-R CCGCTCGAGTCAGTCTGTGTCCACGTCCAC Primers for construction of report plasmids GnIH-Promoter-F0 GGCGAGCTCTTTTGTGAGAGGCTGCGAAT GnIH-Promoter-F1 GGCGAGCTCTTTGTGAGAGGCTGCGAATG GnIH-Promoter-F2 GGCGAGCTCTCAGTTTCGTTGAAAGGTTA GnIH-Promoter-F3 GGCGAGCTCACCCCACATCTTAGGAATCT GnIH-Promoter-F4 GGCGAGCTCATCCTTCATCAGCACCTTCG GnIH-Promoter-F5 GGCGAGCTCACATTTGATTGGACGACCCT GnIH-Promoter-F6 GGCGAGCTCAGGGTTCAAAGATATCACCAC GnIH-Promoter-F7 GGCGAGCTCCCTGTCGCTCTGTTGCTATG GnIH-Promoter-R CCGCTCGAGTGAAGTCCAAGCACAACGCA GnIH-mut-ERE2-F GAAAGGTTAACCCCACTCAT GnIH-mut-ERE2-R ATGAGTGGGGTTAACCTTTC Primers for EMSA probe EMSA-2-F AAAGGTTAACGGTCACCCACTCATCCCACA EMSA-2-R TGTGGGATGAGTGGGTGACCGTTAACCTTT EMSA-2-mut-F AAAGGTTAACAAGTCCCCACTCATCCCACA EMSA-2-mut-R TGTGGGATGAGTGGGGACTTGTTAACCTTT Abbreviations: AP, adaptor primer; F, forward; GW, genome walking; Mut, mutant; ORF, open reading frame; R, reverse. amounts of labeled and complementary oligonucleotides were gradually allowed to cool to room temperature to allow for the annealing of double-stranded oligonucleotides. Electrophoretic mobility shift assay (EMSA) was performed according to the LightShift chemiluminescent EMSA kit (Pierce). Briefly, 15 mg of each nuclear protein extract was incubated with 20 fmol biotin-labeled oligonucleotides for 20 minutes at room temperature. A competitive reaction was performed under identical conditions by adding 200-fold of the amount of unlabeled oligonucleotides. Samples were separated using nondenaturing 5% polyacrylamide gel electrophoresis and transferred to a Hybond-Nylon membrane (GE Healthcare, Piscataway, NJ). The membrane was blocked, and streptavidin horseradish peroxidase conjugate was applied for 15 minutes. After thorough washing, the membrane was exposed to x-ray film after incubation with the chemiluminescence reagents. Statistical analyses All data are expressed as the mean 6 standard error of the mean, and the numbers of samples are indicated in the figure legends. Statistical significance was determined using 1-way analysis of variance and a Dunnett test for multiple group comparison. A Student t test was used for comparisons between two groups. Statistical significance was defined as P, 0.05.

5 864 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): Figure 1. Expression of ER mrna in GnIH neurons in the NPPv of the goldfish hypothalamus. The GnIH neurons in the NPPv (green, stained with Alexa Fluor 488) coexpress ERa (A C), ERb1 (D F), or ERb2 (G I) mrna (red, stained with Alexa Fluor 594). Arrowheads indicate GnIH neurons coexpressing ERs. Open arrowheads indicate GnIH neurons that do not express ERs. Scale bars, 20 mm.

6 doi: /en Results GnIH neurons express ERa, ERb1, and ERb2 To determine whether 2E has direct effects on GnIH neurons, we first performed dual-fluorescence in situ hybridization assays for GnIH neurons and all 3 types of goldfish ERs (ERa,ERb1, and ERb2). Because no results on goldfish ER mrna localization have been previously reported, we performed regular in situ hybridization before conducting the dual-fluorescence experiment, and we confirmed that our ER probes were suitable for dualfluorescence in situ hybridization (data not shown). However, because GnIH neurons are present only in the NPPv region of the goldfish brain (25), we only evaluated ER expression in this region. As shown in Fig. 1, dualfluorescence in situ hybridization demonstrated that GnIH neurons in the NPPv express all three types of goldfish ER genes: ERa [Fig. 1 (A C)], ERb1[Fig.1(D F)], and ERb2 [Fig.1(G I)]. E2 promotes GnIH expression in developing-stage goldfish To demonstrate whether E2 regulates GnIH expression, adult female goldfish underwent ovariectomies and letrozole implantation, and GnIH expression in the hypothalamus was measured. Before the surgery, we first tested whether the feeding conditions influenced GnIH expression because we were unsure whether the surgery would affect the appetite of goldfish. As shown in Supplemental Fig. 1, neither overfeeding nor fasting affected GnIH expression. We then performed ovariectomies and letrozole implantation. The histological results are shown in Fig. 2(A), and the gonadosomatic index values and serum E2 concentrations are listed in Table 2. Compared with the effects of the sham surgery, the ovariectomized fish showed a significant decrease in GnIH expression in the hypothalamus, and E2 implantation rescued this effect [Fig. 2(B)]. Similarly, the implantation of letrozole, a selective antagonist of aromatase, also decreased GnIH expression [Fig. 2(C)]. The effects of E2 and selective ER agonists on GnIH expression in primary cultured hypothalamus cells To further demonstrate the direct effect of E2 on GnIH expression, we developed a primary hypothalamic cell culture. As shown in Fig. 3(A), the bipolar/tripolar neurons exhibited fiber outgrowth in clusters at the 14th day after culture, which was when these cells were used for the experiment. As shown in Fig. 3(B), when the primary cells were treated with E2, GnIH expression in these cells increased significantly in a dose- and timedependent manner. We subsequently used selective ERa and ERb agonists to determine whether this effect was mediated by 1 or both types of ER. When the primary Figure 2. Ovariectomy, estradiol replacement, and letrozole implantation experiments indicate that the expression of GnIH is upregulated by ovarian estrogen in the hypothalamus of vitellogenic goldfish. (A) Histological results of the ovary showing the fish at the developing stage (hematoxylin-eosin stain). Scale bar = 100 mm. (B) The expression of GnIH in the hypothalamus was lower in the ovariectomized (OVX) fish than in the sham-operated controls, and GnIH expression was restored by estradiol replacement. (C) The expression of GnIH in the hypothalamus was also lower in the letrozole-treated fish than in the untreated controls (n = 8 10). *P, 0.05 vs corresponding control. cells were treated with the selective ERa agonist, as expected, GnIH expression increased, whereas GnIH expression decreased in cells treated with the selective ERb agonist [Fig. 3(C)].

7 866 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): Table 2. Gonadosomatic Index and Serum E2 Concentration of the Surgery Animals Gonadosomatic Index Serum E2 Concentration (ng/ml) Vitellogenic female goldfish OVX OVX plus E Maturating female goldfish OVX OVX plus E , no data. Abbreviation: OVX, ovariectomized. Characterization of the GnIH gene promoter and luciferase assay To characterize the mechanism underlying the opposite effects observed for different ERs, we analyzed the regulatory mechanism of GnIH gene transcription in goldfish. Using genome walking, we isolated a 2329-bp sequence from the 5 0 flanking region of goldfish GnIH (Supplemental Fig. 2). Within this sequence, we found 7 half-eres [Fig. 4(A)]. Then, we used a rat glioma cell line (C6) [Fig. 4(B D)] and a rat pheochromocytoma cell line (PC12) in luciferase assays to test the effect of E2 on GnIH transcription. Perhaps because of the low transfection efficiency, the results from the PC12 cell line showed a significant effect only at the highest dose (Supplemental Fig. 3). Similar to the results from the primary cells, in the C6 cells, the selective ERa agonist enhanced GnIH transcription [Fig. 4(B)], whereas the ERb agonist suppressed GnIH transcription [Fig. 4(C) and 4(D)]. Because we found that GnIH neurons expressed all 3 types of ERs, we cotransfected C6 cells with all 3 ER expression vectors together with the GnIH promoter luciferase assay vectors. Because we were not sure of the ratio of ERa to ERb, we used the following ratio: ERa/ERb1/ERb2 = 2:1:1. The results were consistent with those previously mentioned; that is, ERa enhanced transcription, whereas ERb suppressed transcription. Interestingly, we also found that the selective ERa agonist had a greater effect than did the E2 treatment itself [Fig. 5(A)]. To further support our speculation that different ERa/ERb ratios have different effects on GnIH expression, we cotransfected cells with GnIH promoter luciferase assay vectors together with vectors expressing the 3 ERs at the following ERa/ERb ratios:2:1,1:1,1:2, 1:4, and 1:16. These results show that when the level of ERb is much higher than that of ERa, the same concentration of E2 leads to the inhibition of GnIH expression [Fig. 5(B)]. Figure 3. E2 exerts direct effects on GnIH neurons. (A) Primary hypothalamic cell culture for 0 days and 14 days. When the neurite outgrowth in bipolar/tripolar neurons and the clustering of neuronal cells onto glial cells were observed, the cells were used for E2 or agonist treatment. (B) Dose- and time-dependent effects of E2. Primary cells were incubated with various concentrations of E2 for 6, 12, and 24 hours, and mrna levels of GnIH were measured using real-time PCR(n = 6).(C) Effects of ERa and ERb agonists on GnIH expression. Primary cells were incubated with various concentrations of ERa or ERb agonists for 6 hours, and mrna levels of GnIH were measured using real-time PCR (n = 6). *P, 0.05 vs corresponding control. Mapping of the estrogen-responsive region and the identification of functional nonconsensus EREs on the goldfish GnIH promoter To investigate the ER-dependent E2-responsive regions in the goldfish GnIH promoters, a series of deletion mutants for the GnIH promoters were constructed via PCR, as shown in the left panel of Fig. 6(A). E2 significantly enhanced the activity of the wild-type promoter. A deletion mutation of the GnIH promoter at position abolished E2-induced promoter activity [Fig. 6(B)]. The mutation of the half- ERE at position of the GnIH promoter did not affect the E2-induced response [Fig. 6(B)].

8 doi: /en Figure 4. Promoter analysis of the goldfish GnIH gene. (A) Locations and sequences of the 7 half-ere binding sites on the goldfish GnIH gene promoter. C6 cells were transiently transfected with ERa (B), ERb1 (C), and ERb2 (D) expression vectors and/or 2329/Luc of the goldfish GnIH gene and treated with E2 for 24 hours at the indicated concentrations (n = 6). The relative luciferase activity was measured for cell lysates and is expressed as the fold activation over the respective basal levels. *P, 0.05 vs corresponding control. EMSA To further demonstrate the binding activity of ERs to the GnIH promoter, we performed EMSAs. Using the HEK293T cell line, we obtained the nuclear proteins containing the goldfish ERa, ERb1, and ERb2 expression products, which were used in the in vitro binding reaction. As shown in Fig. 7, we obtained the binding bands from the in vitro combination system for ERa [Fig. 7(A)], ERb1 [Fig. 7(B)], and ERb2 [Fig. 7(C)]. Ovariectomy in the maturation stage AsshowninFig.8,wealsoperformedovariectomiesin fish at the maturation stage. The GSI values and E2 levels are shown in Table 2. In the maturation stage, GnIH expression was not affected by ovariectomy [Fig. 8(B)], E2 supplementation, or letrozole implantation [Fig. 8(C)]. Discussion GnRH, a decapeptide, is the mediator of the neuroendocrine control of the ovulatory cycle. It is delivered through the hypophysial portal vessels to the extracellular spaces of the anterior pituitary gland and binds to its receptors on the plasma membranes of gonadotropes in mammals and birds (28). GnRH receptor activation directs the synthesis of the gonadotropins LH and follicle-stimulating hormone (FSH) and their secretion into the peripheral circulation to govern ovarian steroidogenesis and folliculogenesis. Ovarian steroid secretion in turn provides feedback that alters the secretion of GnRH and LH. In the reproductive cycles of most mammals, estrogen exerts negative feedback on GnRH and LH secretion until proestrus, and elevated follicular estrogen secretion evokes the release of a strong GnRH surge and therefore an LH surge, which triggers ovulation (28, 29). Thus, both the negative and positive feedback actions of estrogen are critical in the physiological control of cyclic hormone secretions and ovulatory cyclicity in mammals. However, less is known about this process in fish. Several studies (30 33) have demonstrated that surgical gonadectomy causes an increase in the plasma levels of a single type of GtH (maturational GtH, or GtH II) in mature rainbow trout and that the postgonadectomy rise in GTH levels can be suppressed with steroids. These effects of the steroid have

9 868 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): Figure 5. Promoter analysis of the goldfish GnIH gene. (A) C6 cells were transiently transfected with ERa, ERb1, and ERb2 expression vectors at the ratio of 2:1:1, together with the 2329/Luc of the goldfish GnIH gene and treatment with dimethyl sulfoxide (controls), E2, PPT, and ERb-41, respectively, for 24 hours at the indicated concentrations (n = 6). (B) C6 cells were transiently transfected with ERa and ERb1/ERb2 expression vectors at the ratios of 2:1, 1:1, 1:2, 1:4, and 1:16, as indicated, together with the 2329-bp region of the goldfish GnIH gene and luciferase and treated with E2 for 24 hours at the indicated concentrations (n = 6). The relative luciferase activity was measured for cell lysates and is expressed as the fold activation over the respective basal levels. *P, 0.05 vs corresponding control. been found to be dependent on the stage of the reproductive cycle (31, 32). The mechanism of this feedback has been suggested to act through effects on GnRH receptors (34, 35) and catecholamine metabolism (36, 37). Unfortunately, the mechanisms underlying these effects have not yet been clarified. In this study, we provide some evidence for the role of a newly discovered neuropeptide, GnIH, which mediates both the positive and negative feedback of E2 in goldfish reproduction. First, we showed that 3 types of ERs are all expressed in GnIH neurons in goldfish. This is different from rodents, in which only ERa and not ERb has been found in the hamster GnIH neurons (11). Similarly, another key reproductive factor, kisspeptin, was also found to colocalize with all 3 ER types in goldfish (23); however, knockout of kisspeptin did not affect zebrafish reproduction (38). This suggests that kisspeptin is not as important in fish as it is in mammals, emphasizing the difference in the regulation of reproduction between mammals and fish. The colocalization results in this study demonstrate that E2 acts directly on GnIH neurons to affect GnIH synthesis and secretion. Several studies have demonstrated that the expression of GnIH mrna in the DMH is either inhibited (39, 40) or remains unchanged (41) in ovariectomized females receiving exogenous E2 or is increased in pubertal or sexually immature females (42). In this study, we found that ovariectomies in female goldfish in the vitellogenic stage significantly suppressed GnIH expression, and the implantation of E2 rescued this effect. However, the implantation of the aromatase inhibitor letrozole also suppressed GnIH expression in fish at the same stage. These findings suggest that E2 increases GnIH expression in goldfish in the vitellogenic stage. Using primary cultures of goldfish hypothalamus cells, we demonstrated that E2 exerts direct effects on GnIH neurons, inducing the expression of GnIH. These findings, together with the detection of ER transcripts on GnIH neurons, demonstrate that E2 can act directly on GnIH neurons to enhance GnIH expression. Surprisingly, when we used selective agonists to evaluate whether ERa or ERb mediated this effect, we found that GnIH expression was increased by the selective ERa agonist and suppressed by the selective ERb agonist. In mammals, ERb appears to be very important in the central nervous system, bones, lungs, urogenital tract, cardiovascular system, ovaries, testes, kidneys, and colon (43, 44). The physiological function of ERb is under intensive study, but some results indicate that ERa and ERb have different or even opposite biological actions (45). In this study, we found that in goldfish, ERa and ERb mediate opposite biological functions. To explore the possible underlying mechanism for these different effects, we isolated the 5 0 flanking regions of the GnIH gene, and 7 half-eres were found in the promoter region. In rats, 7 half-ere sites have been found in a 1.7-kb DNA sequence of the GnIH promoter via Transcription Element Search System analysis (14). Those results further demonstrated that GnIH neurons sensitivity to estradiol is conserved from fish to mammals. Then, employing rat glioma and pheochromocytoma cell lines, we performed luciferase assays, and, as expected, the results were consistent with those from the primary cells, showing that GnIH expression was increased by ERa and decreased by ERb. Because GnIH neurons express all 3 ER types, we cotransfected vectors expressing all 3 types together with the GnIH luciferase vectors into the cell lines and treated the cells separately with DMSO (as the control) and agonists for E2, and ERa and ERb. Interestingly, the ERa agonist showed a stronger effect than E2, suggesting that the ERa and ERb may competitively bind to the GnIH promoter to regulate GnIH expression. Previously, we showed that ERa

10 doi: /en Figure 6. Deletion and mutation analysis of goldfish GnIH promoters. Left panel: schematic representation of the 5 0 -deletion constructs (A) or ERE-mutated promoter constructs (B) and the positions of the putative motifs. Right panel: cells were cotransfected with the wild-type, 5 0 -deleted, or ERE-mutated promoter constructs, together with the prl-cmv and goldfish ERa or ERb1 orerb2 expression plasmid. After transfection, the cells were exposed to either medium only or M E2 for 24 hours and assayed for firefly and Renilla luciferase activities. The relative luciferase activities were normalized to the empty pgl3-basic vector. The results are from at least three independent experiments. *P, 0.05 vs corresponding control.

11 870 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): Figure 7. A biotin-labeled probe designed based on the to region of the GnIH promoter was incubated at room temperature with ;15 mg of nuclear extract from HEK293T cells with (lanes 6, 7, and 8) or without (lanes 2, 3, and 4) the transfection of (A) ERa, (B) ERb1, or (C) ERb2. Probe alone (lane 1) and scrambled probe (lanes 3 and 7) were used as negative controls. The no-label probe was used as a competitor (lanes 4 and 8).

12 doi: /en Figure 8. Ovariectomy, estradiol replacement, and letrozole implantation experiments indicate that the expression of GnIH is not affected by ovarian estrogen in the hypothalamus of maturing goldfish. (A) Histology results of the ovary showing the developing stage of the fish (hematoxylin-eosin stain). Scale bar = 100 mm. (B) No change in GnIH expression in the hypothalamus was observed in the ovariectomized (OVX) fish compared with the sham-operated controls, and no effect was observed in the estradiol-treated group. (C) No difference in GnIH expression in the hypothalamus was observed in the letrozole-treated fish compared with the untreated controls. enhances the effect of the kisspeptin promoter in goldfish (46), whereas ERb suppressestheeffectofthatpromoterin grouper (unpublished data). These results suggest that in fish, E2 both stimulates and suppresses reproduction through different receptors. Next, to determine how the binding site mediates this effect, we constructed a series of deletion and mutation vectors and found that the half-ere at was the key site. Using EMSA, we further demonstrated the binding ability of ERs to the half-ere at of the GnIH promoter. Taken together, our results suggest that different subtypes of ERs competitively bind to the same half-ere binding site for both upregulation and downregulation of GnIH expression in goldfish. It is therefore possible that GnIH acts as a mediator that participates in both negative feedback during the developing stage and positive feedback in the maturation stage based on different ratios of ERa to ERb in GnIH neurons. Therefore, we performed ovariectomies again in female goldfish in the maturation stage. As expected, in the maturing goldfish, neither ovariectomy nor letrozole implantation affected GnIH expression. These results, together with our previous findings that GnIH is a negative regulator of GnRH and GtH (19), partially support our hypothesis that GnIH acts as a mediator in both negative feedback in the developing stage and positive feedback in the maturation stage. However, because we were not able to test the protein or expression levels of ERa or ERb in goldfish GnIH neurons at different stages, further studies are still needed to prove our hypothesis. Mechanistic differences have been demonstrated for the neuroendocrine regulation of reproduction between mammals and fish. In mammals, it is well established that GnRH release is the final step in the control of gonadotropin release. In fish, however, the reproductive axis is likely controlled by multiple independent neuroendocrine factors (47, 48). In addition to GnRH, many neurohormones, such as GnIH, act both directly at the gonadotropins and indirectly through the modulation of the GnRH neuronal system to regulate GtH release and seasonal reproductive cyclicity (19, 49). In rodents, the administration of GnIH inhibits LH secretion and GnRHinduced LH release (11 13). Furthermore, other studies have shown a central inhibitory effect of GnIH on the GnRH system (50). In vitro studiesshowedthatgnih only inhibited LH secretion from cultured rat pituitary cells when GnRH was present (13). In most avian species studied, GnIH inhibits gonadotropin release and is considered a key factor inhibiting reproduction. Chronic GnIH treatment decreases plasma LH concentration and the expressions of the common a,lhb,and FSHb subunit mrnas in mature birds (7, 8). Unlike in rodents, in vitro studies in quail have shown a dose-dependent inhibitory effect of GnIH on LH release and a possibly similar

13 872 Qi et al GnIH Mediates E2 Feedback in Goldfish Reproduction Endocrinology, April 2017, 158(4): tendency for GnIH to inhibit FSH release (10). In our previous study, the administration of goldfish GnIH peptides suppressed salmon GnRH mrna levels in the hypothalamus and decreased the mrna levels of both LHb and FSHb in the goldfish pituitary (19). We also found that goldfish GnIH peptides did not affect either LHb or FSHb mrna levels in cultured pituitary cells. In contrast, those peptides decreased the FSHb mrna levels when GnRH was present (19). Additionally, in the gonad, GnIH function also differs between species. GnIH treatment of in vitro cultured whole proestrus mouse ovaries decreased the accumulation of progesterone and estradiol (51). More recently, human GnIH was demonstrated to reduce gonadotropin-stimulated progesterone accumulation in isolated human granulose lutein cells (52). However, in the Syrian hamster, central administration of RFRP-3 significantly elevated plasma testosterone (53). Additionally, in mature birds, GnIH treatment also induces testicular apoptosis and decreases the testosterone concentration and the diameter of seminiferous tubules. In immature birds, GnIH treatment suppresses normal testicular growth and the testosterone concentration (54). In the goldfish, GnIH was able to act directly on gonads, increasing testosterone secretion while having no effect on estradiol production (20). These results clearly demonstrate that GnIH performs different functions in fish compared with mammals or birds. In the present study, we found that both ERa and ERb were present in GnIH neurons, which is much different from findings in mammals and birds. In hamsters, GnIH neurons have been reported to express ERa but not ERb (8). E2 treatment has been shown to reduce c-fos labeling in GnIH neurons in the DMH of young transgenic female rats carrying an EGFP-tagged GnIH promoter (14). To date, no report has shown ERb expression in GnIH neurons in birds. Accordingly, we think that the mechanisms we found in goldfish represent a unique strategy for fish reproduction. In summary, the present study provides initial insight into the direct action of E2 on GnIH expression in goldfish. Our findings suggest that E2, acting through different ERs, induces and suppresses GnIH expression in different reproductive stages. Acknowledgments Address all correspondence and requests for reprints to: Xin Qi, PhD, School of Life Science, Sun Yat-Sen University, No. 135 Xingang xi Road, Guangzhou , China. qixin7@ mail.sysu.edu.cn. This work was supported by the National Science Foundation of China Grants and to X.Q. and H.L. and Open Project of the State Key Laboratory of Biocontrol Grant SKLBC15KF05 to X.Q. Disclosure Summary: The authors have nothing to disclose. References 1. Clarke IJ. Control of GnRH secretion: one step back. Front Neuroendocrinol. 2011;32(3): Fink G. Neuroendocrine Regulation of Pituitary Function. In: Conn PM, Freeman ME, eds. Neuroendocrinology in Physiology and Medicine. Totowa, NJ: Humana Press; 2000: Herbison AE, Robinson JE, Skinner DC. Distribution of estrogen receptor-immunoreactive cells in the preoptic area of the ewe: colocalization with glutamic acid decarboxylase but not luteinizing hormone-releasing hormone. Neuroendocrinology. 1993;57(4): Huang X, Harlan RE. Absence of androgen receptors in LHRH immunoreactive neurons. Brain Res. 1993;624(1 2): Chu Z, Andrade J, Shupnik MA, Moenter SM. Differential regulation of gonadotropin-releasing hormone neuron activity and membrane properties by acutely applied estradiol: dependence on dose and estrogen receptor subtype. JNeurosci. 2009;29(17): Chu Z, Takagi H, Moenter SM. Hyperpolarization-activated currents in gonadotropin-releasing hormone (GnRH) neurons contribute to intrinsic excitability and are regulated by gonadal steroid feedback. J Neurosci. 2010;30(40): Tsutsui K. A new key neurohormone controlling reproduction, gonadotropin-inhibitory hormone (GnIH): biosynthesis, mode of action and functional significance. Prog Neurobiol. 2009;88(1): Tsutsui K, Bentley GE, Bedecarrats G, Osugi T, Ubuka T, Kriegsfeld LJ. Gonadotropin-inhibitory hormone (GnIH) and its control of central and peripheral reproductive function. Front Neuroendocrinol. 2010;31(3): Kriegsfeld LJ, Ubuka T, Bentley GE, Tsutsui K. Seasonal control of gonadotropin-inhibitory hormone (GnIH) in birds and mammals. Front Neuroendocrinol. 2015;37: Tsutsui K, Saigoh E, Ukena K, Teranishi H, Fujisawa Y, Kikuchi M, Ishii S, Sharp PJ. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun. 2000; 275(2): Kriegsfeld LJ, Mei DF, Bentley GE, Ubuka T, Mason AO, Inoue K, Ukena K, Tsutsui K, Silver R. Identification and characterization of a gonadotropin-inhibitory system in the brains of mammals. Proc Natl Acad Sci USA. 2006;103(7): Rizwan MZ, Porteous R, Herbison AE, Anderson GM. Cells expressing RFamide-related peptide-1/3, the mammalian gonadotropininhibitory hormone orthologs, are not hypophysiotropic neuroendocrine neurons in the rat. Endocrinology. 2009;150(3): Murakami M, Matsuzaki T, Iwasa T, Yasui T, Irahara M, Osugi T, Tsutsui K. Hypophysiotropic role of RFamide-related peptide-3 in the inhibition of LH secretion in female rats. J Endocrinol. 2008; 199(1): Soga T, Kitahashi T, Clarke IJ, Parhar IS. Gonadotropin-inhibitory hormone promoter-driven enhanced green fluorescent protein expression decreases during aging in female rats. Endocrinology. 2014;155(5): Peter RE, Gill VE. A stereotaxic atlas and technique for forebrain nuclei of the goldfish, Carassius auratus. J Comp Neurol. 1975; 159(1): Kaul S, Vollrath L. The goldfish pituitary. I. Cytology. Cell Tissue Res. 1974;154(2): Kaul S, Vollrath L. The goldfish pituitary. II. Innervation. Cell Tissue Res. 1974;154(2): Zhang Y, Li S, Liu Y, Lu D, Chen H, Huang X, Liu X, Meng Z, Lin H, Cheng CH. Structural diversity of the GnIH/GnIH receptor system in teleost: its involvement in early development and the negative control of LH release. Peptides. 2010;31(6): Qi X, Zhou W, Li S, Lu D, Yi S, Xie R, Liu X, Zhang Y, Lin H. Evidences for the regulation of GnRH and GTH expression by

14 doi: /en GnIH in the goldfish, Carassius auratus. Mol Cell Endocrinol. 2013;366(1): Qi X, Zhou W, Lu D, Wang Q, Zhang H, Li S, Liu X, Zhang Y, Lin H. Sexual dimorphism of steroidogenesis regulated by GnIH in the goldfish, Carassius auratus. Biol Reprod. 2013;88(4): Wang Q, Qi X, Guo Y, Li S, Zhang Y, Liu X, Lin H. Molecular identification of GnIH/GnIHR signal and its reproductive function in protogynous hermaphroditic orange-spotted grouper (Epinephelus coioides). Gen Comp Endocrinol. 2015;216: Kobayashi M, Aida K, Hanyu I. Induction of gonadotropin surge by steroid hormone implantation in ovariectomized and sexually regressed female goldfish. Gen Comp Endocrinol. 1989;73(3): Kanda S, Karigo T, Oka Y. Steroid sensitive kiss2 neurones in the goldfish: evolutionary insights into the duplicate kisspeptin geneexpressing neurones. J Neuroendocrinol. 2012;24(6): Li G, Liu X, Lin H. [Aromatase inhibitor letrozole induces sex inversion in the protogynous red spotted grouper (Epinephelus akaara)]. Sheng Li Xue Bao. 2005;57(4): Sawada K, Ukena K, Satake H, Iwakoshi E, Minakata H, Tsutsui K. Novel fish hypothalamic neuropeptide. Eur J Biochem. 2002;269 (24): Belsham DD, Cai F, Cui H, Smukler SR, Salapatek AM, Shkreta L. Generation of a phenotypic array of hypothalamic neuronal cell models to study complex neuroendocrine disorders. Endocrinology. 2004;145(1): Kaech S, Banker G. Culturing hippocampal neurons. Nat Protoc. 2006;1(5): Levine JE. New concepts of the neuroendocrine regulation of gonadotropin surges in rats. Biol Reprod. 1997;56(2): Herbison AE. Multimodal influence of estrogen upon gonadotropinreleasing hormone neurons. Endocr Rev. 1998;19(3): Breton B, Jalabert B, Fostier A. [Induction of pituitary gonadotropin discharge in the carp (Cyprinus carpio L.) with the aid of cisclomiphene citrate]. Gen Comp Endocrinol. 1975;25(4): Billard R, Richard M, Breton B. [Stimulation of pituitary gonadotropin secretion after castration in rainbow trout: variation of the response during the reproductive cycle]. C R Acad Sci Hebd Seances Acad Sci D. 1976;283(2): Bommelaer MC, Billard R, Breton B. Changes in plasma gonadotropin after ovariectomy and estradiol supplementation at different stages at the end of the reproductive cycle in the rainbow trout (Salmo gairdneri R.). Reprod Nutr Dev. 1981;21(6A): Van Putten LJ, Peute J, Van Oordt PG, Goos HJ, Breton B. Glycoprotein gonadotropin in the plasma and its cellular origin in the adenohypophysis of sham-operated and ovariectomized rainbow trout, Salmo gairdneri. Cell Tissue Res. 1981;218(2): Crim L, Wilson C, St Arnaud R, Evans D, Harmin S. Characteristics of fish pituitary LHRH receptors. In: Proceedings of the Third International Symposium on Reproductive Physiology of Fish; August 2 7, 1987; St. John s, NL, Canada. Pp De Leeuw R, Beumer P, Goos HT, Van Oordt P. The effect of castration and steroid replacement on gonadotropin-releasing hormone (GnRH) receptor binding in the African catfish, Clarias gariepinus. In: Proceedings of the Third International Symposium on the Reproductive Physiology of Fish; August 2 7, 1987; St. John s, NL, Canada. P Trudeau V, Sloley B, Wong A, Peter R. Mechanisms of sex steroid negative and positive feedback control of gonadotropin (GTH) secretion in teleosts. In: Proceedings of the Fourth International Symposium on Reproductive Physiology of Fish; July 7 12, 1991; Sheffield, UK. Pp Linard B, Anglade I, Bennani S, Salbert G, Navas J, Bailhache T, Pakdel F, Jego P, Valotarie Y, Saligaut C. Some insights into sex steroid feedback mechanisms in the trout. In: Proceedings of the Fifth International Symposium on Reproductive Physiology of Fish; July 2 8, 1995; University of Texas, Austin, TX. Pp Tang H, Liu Y, Luo D, Ogawa S, Yin Y, Li S, Zhang Y, Hu W, Parhar IS, Lin H, Liu X, Cheng CH. The kiss/kissr systems are dispensable for zebrafish reproduction: evidence from gene knockout studies. Endocrinology. 2015;156(2): Gibson EM, Humber SA, Jain S, Williams WP III, Zhao S, Bentley GE, Tsutsui K, Kriegsfeld LJ. Alterations in RFamide-related peptide expression are coordinated with the preovulatory luteinizing hormone surge. Endocrinology. 2008;149(10): Molnár CS, Kalló I, Liposits Z, Hrabovszky E. Estradiol downregulates RF-amide-related peptide (RFRP) expression in the mouse hypothalamus. Endocrinology. 2011;152(4): Quennell JH, Rizwan MZ, Relf HL, Anderson GM. Developmental and steroidogenic effects on the gene expression of RFamide related peptides and their receptor in the rat brain and pituitary gland. J Neuroendocrinol. 2010;22(4): Iwasa T, Matsuzaki T, Murakami M, Kinouchi R, Osugi T, Gereltsetseg G, Yoshida S, Irahara M, Tsutsui K. Developmental changes in the mammalian gonadotropin-inhibitory hormone (GnIH) ortholog RFamide-related peptide (RFRP) and its cognate receptor GPR147 in the rat hypothalamus. Int J Dev Neurosci. 2012;30(1): Paterni I, Granchi C, Katzenellenbogen JA, Minutolo F. Estrogen receptors alpha (ERa) and beta (ERb): subtype-selective ligands and clinical potential. Steroids. 2014;90: Heldring N, Pike A, Andersson S, Matthews J, Cheng G, Hartman J, Tujague M, Ström A, Treuter E, Warner M, Gustafsson JA. Estrogen receptors: how do they signal and what are their targets. Physiol Rev. 2007;87(3): Gustafsson JA. Estrogen receptor beta a new dimension in estrogen mechanism of action. J Endocrinol. 1999;163(3): Wang Q, Sham KW, Ogawa S, Li S, Parhar IS, Cheng CH, Liu X, Lin H. Regulation of the two kiss promoters in goldfish (Carassius auratus) by estrogen via different ERa pathways. Mol Cell Endocrinol. 2013;375(1-2): Zohar Y, Mu ~ noz-cueto JA, Elizur A, Kah O. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol. 2010; 165(3): Popesku JT, Martyniuk CJ, Mennigen J, Xiong H, Zhang D, Xia X, Cossins AR, Trudeau VL. The goldfish (Carassius auratus) as a model for neuroendocrine signaling. Mol Cell Endocrinol. 2008; 293(1 2): Moussavi M, Wlasichuk M, Chang JP, Habibi HR. Seasonal effect of gonadotrophin inhibitory hormone on gonadotrophin-releasing hormone-induced gonadotroph functions in the goldfish pituitary. J Neuroendocrinol. 2013;25(5): Anderson GM, Relf HL, Rizwan MZ, Evans JJ. Central and peripheral effects of RFamide-related peptide-3 on luteinizing hormone and prolactin secretion in rats. Endocrinology. 2009;150(4): Singh P, Krishna A, Tsutsui K. Effects of gonadotropin-inhibitory hormone on folliculogenesis and steroidogenesis of cyclic mice. Fertil Steril. 2011;95(4): Oishi H, Klausen C, Bentley GE, Osugi T, Tsutsui K, Gilks CB, Yano T, Leung PC. The human gonadotropin-inhibitory hormone ortholog RFamide-related peptide-3 suppresses gonadotropininduced progesterone production in human granulosa cells. Endocrinology. 2012;153(7): Ancel C, Bentsen AH, Sébert ME, Tena-Sempere M, Mikkelsen JD, Simonneaux V. Stimulatory effect of RFRP-3 on the gonadotrophic axis in the male Syrian hamster: the exception proves the rule. Endocrinology. 2012;153(3): Tsutsui K, Saigoh E, Yin H, Ubuka T, Chowdhury VS, Osugi T, Ukena K, Sharp PJ, Wingfield JC, Bentley GE. A new key neurohormone controlling reproduction, gonadotrophin-inhibitory hormone in birds: discovery, progress and prospects. J Neuroendocrinol. 2009;21(4):