Expression of genes from the lignin synthesis pathway in guineagrass genotypes differing in cell-wall digestibility

Transcription

1 Universidade de São Paulo Biblioteca Digital da Produção Intelectual - BDPI Sem comunidade WoS 2012 Expression of genes from the lignin synthesis pathway in guineagrass genotypes differing in cell-wall digestibility GRASS AND FORAGE SCIENCE, MALDEN, v. 67, n. 1, supl. 1, Part 4, pp , MAR, Downloaded from: Biblioteca Digital da Produção Intelectual - BDPI, Universidade de São Paulo

2 Grass and Forage Science The Journal of the British Grassland Society The Official Journal of the European Grassland Federation Expression of genes from the lignin synthesis pathway in guineagrass genotypes differing in cell-wall digestibility S. S. Stabile*, A. P. Bodini*, L. Jank, F. P. Rennó*, M. V. Santos* and L. F. P. Silva* *Department of Animal Nutrition and Production, Universidade de São Paulo, Pirassununga, Brazil, and Embrapa-Beef Cattle, Campo Grande, MS, Brazil Abstract Rapid decline in cell-wall digestibility hinders efficient use of warm-season grasses. The objective of this study was to identify genes whose expressions are related to the slope of decline in cell-wall digestibility. Eleven guineagrass genotypes were harvested at three ages and classified according to fibre digestibility. Extreme genotypes were separated into groups with either FAST or SLOW decline in fibre digestibility. Expression of transcripts from six genes from the lignin synthesis pathway was quantified by real-time PCR. Fast decline in fibre digestibility was associated with higher DM yield after 90 d of regrowth. Apart from lower fibre digestibility and higher lignin content for the FAST group, there were no other differences between the two groups for the chemical composition of stems and leaves. Maturity affected differently the expression of two of the six genes, cinnamate 4-hydroxylase and caffeoyl-coa O-methyltransferase (C4H and CCoAOMT). Genotypes with fast decline in fibre digestibility had greater increase in the expression of C4H and CCoAOMT from 30 to 60 d of regrowth, than genotypes with slower decline. Expression of C4H and CCoAOMT appears to be related to the decline in cell-wall digestibility with advance in maturity of guineagrass. Keywords: CCoAOMT, C4H, lignin, Panicum maximum, tropical forages Correspondence to: L. F. P. Silva, School of Veterinary Medicine and Animal Science, USP Av. Duque de Caxias Norte, 225, Pirassununga, São Paulo, Brazil. lfpsilva@usp.br Received 27 October 2010; revised 21 June 2011 Introduction Tropical grasses, such as guineagrass (Panicum maximum Jacq.), have a huge potential for dry matter production, leading to high stocking rates during the summer. On the other hand, tropical grasses have rapid elongation of stems and rapid decline in forage quality with advance in maturity (Nelson and Moser, 1994). Given the importance of forage digestibility on livestock performance, efforts have been made to genetically improve in vitro digestibility of perennial forage crops, with great success (Casler and Vogel, 1999). For tropical grasses, however, genetic improvement in forage quality has been relatively slow, mainly because of the lack of sexual plants in the collections, which limits the progress of the breeding programme (Araujo et al., 2005). In guineagrass, leaf yield and leafto-stem ratio (LSR) have been used as the most important traits when selecting for forage quality (Muir and Jank, 2004), with very little information available about fibre digestibility. Forage maturity is frequently associated with less leafiness and lower LSR, and stems are usually considered as lower-quality components than leaves. However, this is not always true. Alfalfa (Medicago sativa L.) and many other legume species use the stem as structural components (lower quality) and the leaves as metabolic organs (higher quality). In contrast, grasses use leaves both for structure, through the lignified midrib, and as metabolic organs. Thus, the nutritive value of alfalfa leaves will be maintained during the ageing process, whereas grass leaves will decrease in quality (Van Soest, 1994). Conversely, in some grasses, the stem is considered to be a reserve organ, and this will lead to the stems having higher nutritive value than leaves. For example, timothy (Phleum pratense L.) and sugarcane (Saccharum spp.) utilize the stem as a reserve organ (Van Soest, 1994). In young guineagrass genotypes, fibre digestibility of stems was higher than that of leaves, but decreased doi: /j x 43

3 44 S. S. Stabile et al. rapidly with advance in maturity, which suggests that stem nutritive value should be addressed as a quality trait of tropical forages (Stabile et al., 2010). Lignin is a component of cell walls and is recognized as the main factor limiting digestion of cell-wall polysaccharides in the rumen. Lignin seems to exert its negative effect on cell-wall digestibility by shielding the polysaccharides from enzymatic hydrolysis (Jung and Deetz, 1993). Expression of genes encoding enzymes from the phenylpropanoid pathway has been shown to modulate rate of lignin synthesis in grasses and legumes (Ralph et al., 2004). Given the high degree of lignin heterogeneity among species and among tissues within a plant, the regulation and nature of the pathway may differ among cell types and among species (Campbell and Sederoff, 1996). The specific differences in lignification of each tissue can be responsible for the low correlation between lignin content and cell-wall digestibility, in forage samples harvested at similar maturity stages (Jung and Casler, 2006). Similarly, different enzymes can be responsible for controlling lignifications at different plant tissues and at different forage species. The identification of genes controlling lignin biosynthesis during tropical forage development would enhance our comprehension of the lignification process and facilitate the development of better cultivars. Studies in maize have demonstrated that several genes in the lignin pathway are simultaneously under-expressed in line with higher cell-wall degradability (Barrière et al., 2009). It was hypothesized that the decline in stem nutritive value is related to differential expression of specific genes from the lignin synthesis pathway, and therefore, the objective of this study was to quantify the expression of six genes in guineagrass genotypes phenotypically classified in divergent groups according to stem fibre digestibility. Materials and methods Plant material The characteristics and composition of these samples are fully described by Stabile et al. (2010). In brief, established plots of eleven guineagrass genotypes were grown at Embrapa Beef Cattle experimental station (Campo Grande, Brazil, S lat; W long; 530Æ7 m above sea level). After an initial cut approximately 20 cm above the soil on 29 December 2005, the plots were fertilized with 100 kg ha )1 of N (urea), 100 kg ha )1 of P 2 O 5 (single superphosphate) and 100 kg ha )1 of K 2 O (potassium chloride) and harvested after 30, 60 or 90 d of regrowth. The climate over the experimental period was in accordance with the average for the season, without prolonged water deficit (Table 1). Each genotype was replicated in three plots of six rows width, spaced by 0Æ5 m, and 4 m length in a randomized block design. At each harvest date, two rows were cut with electric clippers approximately 20 cm above the soil level. A subsample of 2 kg was taken and separated into leaf blades, stems (stem plus leaf sheaths) and senescent material and stored in plastic bags at )20 C for chemical analysis and in vitro incubations. A portion of the stems was cut with scissors, put in 15-mL Falcon tubes, frozen in liquid nitrogen and stored at )80 C for subsequent analysis. Total green dry matter production was calculated by subtracting the senescent material from the leaf and stem fractions. Chemical analysis and in vitro digestibility The leaf and stem components were analysed for dry matter (DM), ash and crude protein (CP) according to AOAC (1997). Neutral detergent fibre (NDF) contents were determined in g per g of dry matter (DM), according to the method described by Van Soest et al. (1991), without addition of a-amylase and sodium sulphite. Acid detergent fibre (ADF) and acid detergent lignin (ADL) were determined according to the methods described by Goering and Van Soest (1970). DM and NDF digestibilities of leaf and stem samples were determined by an in vitro procedure, using 30 h of incubation time (Tilley and Terry, 1963 as modified by Goering and Van Soest, 1970). Rumen fluid was collected from three fistulated non-lactating Holstein cows that were kept on pasture receiving mineral supplementation. Approximately 2 L of rumen fluid was collected from each cow into a pre-warmed thermos and immediately transported to the laboratory. Samples were incubated in duplicate, in three series, one for each block, to minimize assay-to-assay variation. Ten millilitres of filtered rumen fluid was added to each flask containing the feed, medium and reducing solution. The flasks were connected to a CO 2 manifold and incubated at 39 C for 30 h. Flasks were then removed, 20 ml of Table 1 Weather conditions for the duration of the experiment. Period Mean temperature ( C) 25Æ5 24Æ9 25Æ1 Rainfall (mm) 149Æ3 178Æ3 141Æ2

4 Expression of genes from the lignin synthesis pathway 45 neutral detergent solution was added and the flasks were immediately frozen to stop fermentation. The contents of each flask were then transferred into a 600-mL beaker that contained 80 ml of neutral detergent solution and were refluxed for 1 h. The contents of the beaker were then transferred to a Gooch crucible and filtered under vacuum to isolate the fibre residue. The residual fibre was rinsed with hot water and acetone, dried at 105 C for 24 h and weighed. The eleven guineagrass genotypes were separated according to the slope of decline in stem NDF digestibility with advance in maturity. Three genotypes (Milênio, Mombaça and Tanzânia) with fast decline in NDF digestibility (FAST) and three genotypes (PM39, PM47 and Massai) with slow decline in NDF digestibility (SLOW) were selected for gene-expression analysis. Quantitative Real-Time PCR Total RNA from tissue samples was isolated using TRIzol Ò Reagent (Invitrogen, Carlsbad, CA, USA) according to Chomczynski and Sacchi (1987) and included a DNase I (Invitrogen) treatment. The quality of isolated RNA was determined by measuring the absorbance at 260 and 280 nm, and its integrity was verified as mainly 18S and 28S rrna by electrophoresis in 1Æ5% (w v) agarose gel. Three lg of total RNA from each tissue sample was used for cdna synthesis. After denaturing at 70 C for 10 min, half of the sample (1Æ5 lg) was reverse-transcribed into cdna with 0Æ5 lg of oligo thymidine and 200 units of Superscript II reverse transcriptase (RT) (Invitrogen) in a final volume of 20 ll, for 60 min at 42 C. The other half was incubated without reverse transcriptase and used as a negative control in polymerase chain reaction (PCR) to confirm the absence of residual genomic DNA contamination. Primer pairs specific for six genes from the monolignols biosynthesis pathway: cinnamate-4-hydroxylase (C4H), 4-coumarate-CoA ligase (4CL), cinnamoyl-coareductase (CCR), caffeoyl-coa O-methyltransferase (CCoAOMT), cinnamyl alcohol dehydrogenase (CAD), phenylalanine ammonia lyase (PAL) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were designed based on conserved regions of maize and rice. After PCR amplification and sequencing of the amplicons, new primers were designed for real-time PCR quantification of gene expression (Table 2). Studies in other grasses, such as maize, have demonstrated that the genes from the lignin biosynthesis pathway are usually present as members of small multigene families (Barrière et al., 2009). Two C4H genes have been described in maize (Guillaumie et al., 2007; Barrière et al., 2009), and based on the amplicon sequence obtained with our guineagrass primers (Gen- Bank EU741932), we are probably detecting the C4H1 gene (95% similarity) and not the C4H2 gene (74% similarity). Five classes of 4CL genes have been described in maize (Guillaumie et al., 2007; Barrière et al., 2009), and based on the guineagrass amplicon Table 2 Oligonucleotide primer pairs designed for use in real-time polymerase chain reaction (PCR) amplification. Genes * Oligonucleotide primers: 5 fi 3 GenBank accession number PCR insert size (bp) 4CL F: (T A)GAACACCATCGAC(T G)AGGAC EU R: TGGATTTCGTGAAGAAGACC C4H F: TCGCAGAGCTTCGAGTACA EU R: AGGACGTTGTCGTGGTTGAT CAD F: ACATGGGCGTGAAGGT(G A)GC R: CTT(G C)CCGTCCAGCTTCAG CCR F: CTGGTACTGCTACGGGAAGG EU R: CATCTTGTACTCCTGCTTCC CCoAOMT F: AAGAGCGACGACCTGTACCA EU R: GGAGGGAGTAGCCGGTGTAG PAL F: AGGTCAAATCCGTGAACGAC EU R: GAGTTTCACGTCCTGGTTGT GAPDH F: GTTCGTTGTTGGTGTCAACC R: TCCAGTGCTGCTGGGAATGA * 4CL, 4-coumarate-CoA ligase; C4H, cinnamate-4-hydroxylase; CAD, cinnamyl alcohol dehydrogenase; CCR, cinnamoyl-coareductase; CCoAOMT, caffeoyl-coa O-methyltransferase; PAL, phenylalanine ammonia lyase. Primers were designed based on the sequences of guineagrass PCR amplicons obtained in this study that were deposited in GenBank. Primers were designed based on previously deposited maize sequences.

5 46 S. S. Stabile et al. sequence (EU741933), our primers are specific for the class I genes, with 93% similarity with the maize sequence, which is a putative orthologue to 4CL2 from Arabidopsis and poplar (GenBank AY ). Seven CCR genes have been described in maize (Guillaumie et al., 2007; Barrière et al., 2009), and our guineagrass sequence (GenBank EU741931) has high similarity with class 1 genes (89% similarity with CCR1 and 72% similarity with CCR2). One COMT gene and five CCoAOMT genes have been described in maize (Guillaumie et al., 2007; Barrière et al., 2009), and based on sequence homology with the amplified guineagrass amplicon (EU741935), we are detecting the class 1 genes, with 95% similarity to maize CCoAOMT1 and CCoAOMT2. There are seven genes codifying for CAD in maize (Guillaumie et al., 2007; Barrière et al., 2009), and our primers are able to amplify the two genes from the class 1 (GenBank Y13733 and Contig ), but not the genes from the other classes of CAD. For PAL, our guineagrass amplicon sequence (EU741934) has high similarity with class I genes (88% similarity with PAL3 GenBank NM_ ). Quantification of gene expression was performed using the StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The PCR reactions were incubated at 95 C for 10 min, followed by forty cycles of 95 C for 10 s and 60 C for 30 s. Each reaction contained 10 ll ofsybr Ò Green PCR Master Mix reagent, 1Æ0 ll of template cdna, 1Æ25 ll of each primer (10 lm) and 7Æ5 ll of nuclease-free water. All reactions were performed in triplicate wells. Glyceraldehyde 3-phosphate dehydrogenase was used as housekeeping gene, as it has been shown before to be stable in maturing grass internodes (Iskandar et al., 2004), and its expression did not vary more than onefold from the mean under the conditions of this experiment. Changes in gene expression were calculated by relative quantification using the DDCt method (Livak and Schmittgen, 2001), where Ct is the cycle number at which the fluorescence signal of the product crosses an arbitrary threshold set with exponential phase of the PCR and DDCt = (Ct target gene unknown sample ) Ct GAPDH unknown sample) ) (Ct target gene calibrator sample ) t GAPDH calibrator sample). Average abundance of target genes at 30 d of regrowth was considered as the calibrator. Fold changes in gene expression were calculated as 2 )DDCt after testing for efficiency of amplification not different than 100%. Statistical analysis All statistical analyses were conducted using SAS, version for Windows (SAS Institute Inc., Cary, NC, USA). Data for in vitro NDF digestibility (IVNDFD) of the stem were analysed as a randomized block design in a split-plot arrangement. Genotype was considered the plot, maturity the subplots and genotype (treatment) as blocks. Analysis of variance was performed using the MIXED procedure of SAS according to the model: Y = l + genotypes + maturity + genotypes maturity + block + block maturity + e, where the terms block and block maturity were considered as random. Because there was a significant genotypes maturity effect (P <0Æ05) on stem NDF digestibility, the slope of decline in NDF digestibility was calculated by linear contrast and compared by t-tests adjusted for multiple comparisons (Gill, 1978). After separation of the genotypes in two groups (fast and slow), data for DM production, morphological components, chemical composition, in vitro digestibility and gene expression were analysed as a randomized block design in a split-plot arrangement. Treatment was considered the plot, maturity the subplots and genotype (treatment) as blocks. Analysis of variance was performed using the MIXED procedure of SAS according to the model: Y = l + treatment + maturity + treatment maturity + genotype (treatment) + genotype (treatment) maturity + e, where the terms genotype (treatment) and genotype (treatment) maturity were considered as random. When there was a significant treatment maturity effect, the average of the treatments in each maturity was compared by contrast using the SLICE option of SAS. The P-values were represented as * for P <0Æ05, ** for P <0Æ01, *** for P <0Æ001 and NS for not significant. Results Eleven guineagrass genotypes were classified according to the slope of decline in stem NDF digestibility with advanced maturity and separated into two groups with three genotypes each: FAST or SLOW decline in NDF digestibility (Table 3). For better comprehension of the text, these two groups of cultivars will be addressed as treatments in this study. The accession PM45, although it had a small difference in IVNDFD from 30 to 90 d, was not selected as part of the SLOW group because of the abnormal behaviour (Table 3). For this accession, there was a large increase in stem IVNDFD from 30 to 60 d, followed by a great decline from 60 to 90 d. Therefore, the accession PM39 was included in the SLOW group, instead of the accession PM45. Dry matter production In our study, there was no treatment effect (P = 0Æ12) or treatment age interaction (P = 0Æ13) on total green dry matter production (Table 4). However, the contrast

6 Expression of genes from the lignin synthesis pathway 47 Table 3 Comparison of the slope of decline in stem in vitro NDF digestibility of 11 guineagrass genotypes harvested at three ages. IVNDFD * (% NDF) Genotypes 30 d 60 d 90 d Linear contrast (30 90 d) Milênio 48Æ2 40Æ5 27Æ5 21Æ0 a Mombaça 44Æ5 47Æ3 25Æ8 18Æ8 ab Tanzânia 47Æ2 44Æ7 28Æ6 18Æ6 ab PM46 47Æ8 34Æ3 30Æ7 17Æ1 abc PM40 44Æ3 51Æ3 31Æ2 13Æ1 abc PM44 40Æ4 40Æ0 29Æ1 11Æ4 abc PM41 45Æ4 48Æ8 34Æ1 11Æ3 abc PM39 50Æ0 47Æ9 38Æ8 11Æ2 bc PM47 49Æ1 48Æ1 39Æ6 9Æ4 c PM45 38Æ2 46Æ0 32Æ1 6Æ4 c Massai 39Æ7 43Æ4 34Æ0 5Æ8 c s.e.m. 2Æ6 2Æ7 3Æ2 3Æ8 * IVDNDF: In vitro neutral detergent fibre digestibility. Values in the same column with different lowercase superscript letters are significantly different by adjusted t-tests at P <0Æ05. Days of growth after levelling cut at s.e.m., Standard error of mean. analysis demonstrated that the FAST group had higher (P < 0Æ05) DM production with 90 d of regrowth (Table 4). The error term for testing the main effect of treatment on green DM production was genotype (treatment), and there was large variation in average production among the three genotypes within treatments (CV = 16%), which could explain the lack of treatment effect on DM production. Average green DM productions were 6541, 7192 and 8249 kg ha )1 for the genotypes on the SLOW group and 7312, 9906 and kg ha )1 for the genotypes in the FAST group. Plant morphology There was no difference between the two treatments for height, percentage of leaves or percentage of senescent material (Table 4). Also, there was no difference for leaf stem ratio between treatments (Table 4). Chemical composition As expected, there was a significant treatment age interaction for stems IVNDFD (P <0Æ05), with the FAST group having lower (P <0Æ05) IVNDFD with 90 d of regrowth (Table 5). Apart from IVNDFD, there were few differences between the two treatments for the chemical composition of stems and leaves (Table 5). There was a tendency (P = 0Æ10) for overall treatment effect on stem lignin content, expressed as per cent (%) of NDF, with the FAST group having greater average lignin content (7Æ5 ±0Æ3 vs. 6Æ7 ±0Æ3 for the FAST and SLOW groups, respectively). There was no effect of treatment, age or treatment age interaction on IVNDFD or chemical composition of leaves (P > 0Æ10, Table 5). Table 4 Effect of treatment and maturity on mean herbage production, height and proportion of leaf, stem and dead material in two groups of guineagrass genotypes separated according to the slope of decline in stem NDF digestibility with advance in maturity. Treatment SLOW FAST Significance (P) Variables 30 d 60 d 90 d 30 d 60 d 90 d s.e.m. Trt Age T A GDMP (kg ha )1 ) b a 1397 NS *** NS Height (cm) NS *** NS Stem (%) NS *** NS Dead (%) 6Æ9 15Æ7 6Æ8 11Æ6 2Æ8 NS * NS LSR 19Æ6 12Æ2 2Æ7 22Æ7 7Æ0 1Æ4 4Æ9 NS ** NS Days of growth after levelling cut at Standard error of the mean. Treatment. Interaction treatment age. Green dry matter production (total production dead material). Leaf stem ratio. Values in the same row with different lowercase superscript letters are significantly different by t-test at P <0Æ05. *P < 0.05; **P < 0.01; ***P < 0.001; NS, Non-significant; FAST, fast decline in NDF digestibility; SLOW, slow decline in NDF digestibility.

7 48 S. S. Stabile et al. Table 5 Effect of treatment and maturity on chemical composition and in vitro NDF digestibility of stem and leaf tissue in two groups of guineagrass genotypes separated according to the slope of decline in stem NDF digestibility with advance in maturity. Treatment SLOW FAST Significance (P) Variables 30 d 60 d 90 d 30 d 60 d 90 d s.e.m. Trt Age T A Stem CP, %DM 4Æ4 5Æ8 a 3Æ5 4Æ7 4Æ7 b 2Æ8 0Æ22 NS *** NS NDF, %DM 77Æ9 80Æ9 84Æ4 76Æ2 79Æ5 83Æ1 0Æ65 NS *** NS Lignin, %NDF 6Æ03 5Æ84 8Æ16 b 6Æ25 6Æ44 9Æ86 a 0Æ28 0Æ10 *** NS IVNDFD, %NDF 46Æ3 46Æ5 37Æ5 a 46Æ3 44Æ2 27Æ3 b 1Æ6 NS *** ** Intercept 52Æ2 58Æ7 2Æ9 NS Linear slope )4Æ4 a )9Æ7 b 1Æ3 *** ** Leaf CP, %DM 9Æ0 9Æ2 6Æ9 9Æ4 9Æ4 6Æ9 0Æ4 NS *** NS NDF, %DM 75Æ4 76Æ8 74Æ5 74Æ3 76Æ7 74Æ2 1Æ0 NS * NS Lignin, %NDF 5Æ17 5Æ87 6Æ70 5Æ04 5Æ78 6Æ21 0Æ28 NS *** NS IVNDFD, %NDF 37Æ0 34Æ5 33Æ4 39Æ0 37Æ3 33Æ8 3Æ0 NS NS NS CP, Crude protein, NDF, Neutral detergent fibre, IVDNDF, In vitro neutral detergent fibre digestibility; *P < 0.05; **P < 0.01; ***P < 0.001; NS, Non-significant; FAST, fast decline in NDF digestibility; SLOW, slow decline in NDF digestibility. Days of growth after levelling cut at Standard error of the mean. Treatment. Interaction treatment age. Values in the same row with different lowercase superscript letters are significantly different by t-test at P <0Æ05. Gene expression Before comparing gene expression, it is necessary to adjust for unequal efficiencies of cdna amplification (Yuan et al., 2006). In our study, all efficiencies were similar (lcon gene with P = 0Æ93) and not different than two (all confidence intervals for slopes included the number )1); therefore, an efficiency of two (100%) was assumed for all genes (Table 6). Expression of the housekeeping gene, GAPDH, was not affected by age (P > 0Æ10) or by treatment (P > 0Æ10), demonstrating its validity as a reference gene in this study (Table 7). We were most interested in existing treatment age interactions for gene expression, which would indicate that gene expression was differentially altered by maturity between the two groups. There was a signif- Table 6 Efficiency of gene amplification using real-time polymerase chain reaction. Genes * Slope coefficient 95% confidence interval Amplification Minimum Maximum efficiency (E = 2 ()1 slope) ) Percentage amplification efficiency GAPDH )1Æ1 )1Æ2 )0Æ9 1Æ9 0Æ95 4CL )1Æ2 )1Æ9 )0Æ5 1Æ8 0Æ84 C4H )1Æ1 )1Æ7 )0Æ4 1Æ9 0Æ93 CAD )1Æ0 )1Æ4 )0Æ6 2Æ0 1Æ01 CCR )1Æ0 )1Æ4 )0Æ5 2Æ1 1Æ05 CCoAOMT )1Æ1 )1Æ3 )0Æ9 1Æ9 0Æ91 PAL )1Æ0 )1Æ2 )0Æ9 2Æ0 0Æ98 * GAPDH, glyceraldehyde 3-phosphate dehydrogenase; 4CL, 4-coumarate-CoA ligase; C4H, cinnamate-4-hydroxylase; CAD, cinnamyl alcohol dehydrogenase; CCR, cinnamoyl-coa-reductase; CCoAOMT, caffeoyl-coa O-methyltransferase; PAL, phenylalanine ammonia lyase. Linear slope between the Log 2 of the cdna concentration and threshold cycle.

8 Expression of genes from the lignin synthesis pathway 49 Table 7 Threshold cycle for real-time PCR detection (C T ) of the control gene GAPDH. Treatment Age SLOW FAST Significance (P) 30 d * 60 d 90 d 30 d 60 d 90 d Trt Age T A C T -GAPDH 21Æ2 21Æ8 22Æ1 22Æ6 22Æ0 21Æ3 NS NS NS * Days of growth after levelling cut at Treatment. Interaction treatment age. GAPDH=glyceraldehyde 3-phosphate dehydrogenase. NS, Non-significant; FAST, fast decline in NDF digestibility; SLOW, slow decline in NDF digestibility. Table 8 Probability of main effects and interaction on expression of genes from the lignin synthesis pathway in two groups of guineagrass genotypes separated according to the slope of decline in stem NDF digestibility with advance in maturity. Treatments Slice SLOW FAST Age (Trt) Significance 30 d 60 d 90 d 30 d 60 d 90 d Trt # Age Trt Age SLOW FAST Genes DDCt s.e.m. P 4CL 0Æ0 )0Æ3 )1Æ7 0Æ0 )0Æ5 0Æ3 1Æ5 NS ** NS C4H 0Æ0 )0Æ5 B )1Æ8 0Æ0 )1Æ7 A )0Æ9 0Æ5 NS ** * ** * CAD 0Æ0 0Æ6 0Æ5 0Æ0 )0Æ4 )0Æ2 0Æ6 NS NS NS CCR 0Æ0 0Æ7 )0Æ7 0Æ0 1Æ2 )1Æ0 0Æ8 NS * NS CCoAOMT 0Æ0 1Æ6 B 0Æ5 0Æ0 )2Æ6 A )1Æ3 1Æ3 NS NS ** NS * PAL 0Æ0 1Æ0 1Æ5 0Æ0 )1Æ1 0Æ8 1Æ2 NS NS NS 4CL, 4-coumarate-CoA ligase; C4H, cinnamate-4-hydroxylase; CAD, cinnamyl alcohol dehydrogenase; CCR, cinnamoyl-coareductase; CCoAOMT, caffeoyl-coa O-methyltransferase; PAL, phenylalanine ammonia lyase. Days of growth after levelling cut at Standard error of the mean. Decomposition of the Trt age interaction through the SLICE option of SAS, testing for the effect of Age within Trt. # Treatment. Interaction treatment age. DDCt = (Ct target gene unknown sample ) Ct GAPDH unknown sample ) ) (Ct target gene calibrator sample ) Ct GAPDH calibrator sample ). Values in the same row with different upper case superscript letters are significantly different by t-test at P < 0Æ05. *P < 0.05; **P < 0.01; NS, Non-significant; FAST, fast decline in NDF digestibility; SLOW, slow decline in NDF digestibility. icant treatment age interaction for the expression of the genes C4H and CCoAOMT (Table 8). The decomposition of the interaction by the SLICE option of SAS revealed that expression of CCoAOMT was altered by age only at the FAST group, with no change in the expression of CCoAOMT with advance in maturity at the SLOW group (Table 8, Figure 1). There was a great increase in CCoAOMT expression from 30 to 60 d in the FAST group, followed by a decline in expression from 60 to 90 d (Figure 1). For the expression of C4H, the decomposition of the interaction demonstrated that there was a steady increase in C4H expression with maturity in the SLOW group, C4H expression at 60 d was similar to expression at 30 or 90 d and expression at 90 d was higher than expression at 30 d of regrowth (Figure 1). In the FAST group, there was a great increase in C4H expression from 30 to 60 d of regrowth, with expression at 60 d being higher than that at 30 d and similar to 90 d of regrowth (Figure 1). The expression of 4CL and CCR was altered by age (P <0Æ05), but there was no effect of treatment or of treatment age interaction (Table 8). Expression of 4CL increased with age at both treatments, while expression of CCR decreased from 30 to 60 d and increased from 60 to 90 d in both groups (Table 8).

9 50 S. S. Stabile et al. (a) Warm-season grasses produce more edible dry matter but are typically low in digestibility (Reid et al., 1988). The lower forage nutritive value at a given stage of maturity in tropical forages is mainly attributed to a relatively low leaf-to-stem ratio and rapid rates of maturation (Jones, 1985). The major effect of this rapid maturity rate is a fast increase in NDF content concomitantly with an increase in lignification of the cell wall, which leads to lower DM digestibility and also lower NDF digestibility. The experiment tested the hypothesis that the rate of decline in stem fibre digestibility with advance in maturity is controlled by differential expression of genes from the lignin biosynthesis pathway. The results indicate that expression of two genes, CCoAOMT and C4H, is important in determining the decline in fibre digestibility with maturity. Dry matter production (b) Figure 1 Data reported as least-squares mean ± s.e.m. (a) Alterations in mrna abundance of caffeoyl-coa O-methyltransferase in the stems of Panicum maximum genotypes separated into two groups with either slow or fast decline in NDF digestibility with advance in maturity. Tissues were obtained with 30, 60 and 90 d after a levelling cut. Data were analysed by the 2 )DDCt method with 30 d as the reference expression point. (b) Alterations in mrna abundance of cinnamate-4-hydroxylase (C4H) in the stems of P. maximum genotypes separated into two groups with either slow or fast decline in NDF digestibility with advance in maturity. Significant differences (P < 0.05) among days within the SLOW treatment are represented by different capital letters, and significant differences (P < 0.05) among days within the FAST treatment are represented by different lowercase letters. There was no effect of age, treatment or of treatment age interaction on the expression of the genes CAD and PAL (Table 8). Discussion Greater DM production is commonly associated with fast decline in stem digestibility, and genotypes with faster stem elongation are usually the ones with higher DM production (Brégard et al., 2001). Also, rapid decline in digestibility of tropical grasses is often associated with stem elongation and higher percentage of stem in the total dry matter (Cherney et al., 1993). Our results agreed in part with this idea, because the genotypes with fast decline in stem digestibility had greater DM production after 90 d of regrowth. However, there was no overall difference between treatments when the three ages were considered. It has been reported that the cultivars Tanzânia and Mombaça, which have rapid stem elongation, usually reach 95% of light interception (critical leaf area index) between 90 and 100 cm of height (Carnevalli et al., 2006), which in our study corresponded to the age of 60 d. These cultivars with the capacity of rapid stem elongation will also be capable of maintaining greater green dry matter production after a long period of growth, as seen in our study. Most management or environmental factors that increase total DM production, such as temperature and maturity at harvest, usually decrease plant nutritive value (Neel et al., 2008; Nordheim-Viken et al., 2009). However, it is possible to breed, or to select forages, for higher DM digestibility without affecting DM production (Jank et al., 1994; Casler and Vogel, 1999). The modern cultivars of guineagrass, such as Tanzânia and Mombaça, were selected for commercial release among other accessions in the population, because of their higher DM production, higher leaf production and better nutritive value than older cultivars (Jank et al., 1994). The development of Tifton 78 also demonstrated that it is feasible to improve both yield and dry matter digestibility in bermudagrass (Burton and Monson, 1988; Hill et al., 1993). Plant morphology The leaf stem ratio is the most common trait used to evaluate tropical forage nutritive value in a breeding programme, because voluntary feed intake of foraging

10 Expression of genes from the lignin synthesis pathway 51 cattle is usually directly related to percentage of leaves on the pasture; foraging cattle eat more leaves than stems (Minson, 1990). This happens because leaves have usually higher nutritive value than stems (Allison, 1985); moreover, leaves loose nutritive value less intensely with maturity (Hacker and Minson, 1981; Stabile et al., 2010). However, immature stems are high in nutritive value, sometimes even higher than leaves on the same date (Minson, 1990; Stabile et al., 2010). Our results suggest that the rate of decline in stem IVNDFD of guineagrass genotypes is not related to leaf stem ratio. Similarly, in timothy (Phleum pratense L.), selection for lower ratio of acid detergent lignin (ADL) to cellulose (ADL CEL) reduced ADL and NDF concentrations and increased DM digestibility of stems, but did not change leaf stem ratio or other aspects of plant morphology, nor did it change any leaf characteristics (Claessens et al., 2005). Chemical composition When comparing different genotypes of tropical forages, it is common to encounter greater differences for stem than for leaf nutritive value (Buxton and Redfearn, 1997). Likewise, maturity has a much greater effect on stem than on leaf nutritive value (Griffin and Jung, 1983). This could be clearly demonstrated in our study. The genotypes with higher lignin and lower fibre digestibility of the stems did not differ for leaf composition. Therefore, these results support the idea that breeding or selecting for forage quality should focus also on stem, rather than only on leaf nutritive value (Casler and Carpenter, 1989). Maturity has a great effect on stem digestibility. After the plant reaches 95% of light interception, there is a rapid decline in nutritive value (Carnevalli et al., 2006), and therefore, farmers should plan to graze or harvest tropical forages at young ages. However, even in those farms that adopt rotational grazing with electric fences, it is not always feasible to adjust stock density according to forage availability, because of the great variability of forage growth rate during the summer. Consequently, farmers would greatly benefit from the development of cultivar that maintained high nutritive value during longer periods. Gene expression To minimize undesired side effects and improve success of genetic modifications, it is important to identify the points of regulation of the lignin biosynthesis pathway. As in other metabolic pathways, not all enzymes are transcriptionally regulated when there is a change in monolignol synthesis in the plant. It was our hypothesis that the decline in stem nutritive value is related to differential expression of specific genes from the lignin synthesis pathway. Among the six genes studied, only the expression of CCoAOMT and C4H was differentially affected by age between the two treatments. Caffeoyl-CoA O-methyltransferase catalyses the methylation of caffeoyl-coa to feruloyl-coa and 5- hydroxyferuloyl-coa to sinapoyl-coa and is believed to occupy a pivotal position in the lignin biosynthetic pathway (Pinçon et al., 2001) and probably also crosslinking in grasses (Ralph et al., 2004). Cinnamate 4- hydroxylase enzymes, which belong to the cytochrome P450 enzyme family, catalyse the first hydroxylation step in the phenylpropanoid pathway with the production of p-coumaric acid from cinnamic acid (Riboulet et al., 2009). Our results indicated that the greater increase in the expression of C4H and CCoAOMT in the FAST group with 60 d of regrowth, when compared with the SLOW group, could indicate greater rate of monolignol synthesis during this period. For the SLOW group, there was no effect of age on the expression of CCoAOMT over the 90 d studied, a striking difference from the sharp increase in CCoAOMT expression after 60 d of regrowth in the FAST group. This increase in monolignol synthesis around 60 d of regrowth could be responsible for the greater decline in IVNDFD from 60 to 90 d observed in the FAST group. In other grasses, such as maize, most of the genes involved in monolignol biosynthesis belong to small multigene families (Barrière et al., 2009). Barrière et al. (2009) identified five CCoAOMT genes, two C4H genes, six PAL genes, five 4CL genes, seven CCR genes and six CAD genes in the maize genome. Heath et al. (1998) identified three COMT-like cdna homologues from perennial ryegrass (LpOMT1, LpOMT2 and LpOMT3), which are differentially expressed in young or mature stems. Also working with perennial ryegrass, Tu et al. (2010) observed that an upregulation in OMT expression was correlated with lignin deposition during the reproductive stage; however, this effect was specific for the LpOMT1 gene. In maize, quantification of expression of CCoAOMT genes in different tissues during development suggests that CCoAOMT3 and CCoAOMT4 are of little importance for stem lignification (Riboulet et al., 2009), while CCoAOMT2 is highly expressed at the stem (Guillaumie et al., 2007). The different members of the CCoAOMT multigene family have not been described in guineagrass; however, based on sequence similarity with maize, the observed different expression of CCoAOMT in our study probably refers to CCoAOMT1 and CCoAOMT2. Expression of C4H was also correlated with lower fibre digestibility of the stems in our study. For the genotypes in the SLOW group, with a lesser decline in

11 52 S. S. Stabile et al. IVNDFD with advance in maturity, there was a linear increase in C4H expression with age, with the expression being greater at 90 d of regrowth than at 30 d, while expression at 60 d was intermediate. The greater expression of C4H at 90 d in the SLOW group, in contrast to the greater expression of C4H at 60 d for the FAST group, suggests that there may be a delay in monolignol biosynthesis in this group, which is related to the slower rate of lignifications of the stem. A similar pattern of C4H expression was reported in the ear internode in maize (Riboulet et al., 2009), where C4H had increased expression from silking to 8 d after silking, followed by a decline in expression at 15 d after silking. Data from Guillaumie et al. (2007) demonstrate that C4H2 has a tendency to be more highly expressed in all organs of young maize plants, while C4H1 is by far the predominant gene during late stem development. Sequence similarity suggests that our primers are detecting C4H1 expression in guineagrass. Studies with genetically engineered plants have clearly demonstrated the importance of these two genes: CCoAOMT and C4H in monolignol biosynthesis. Downregulation of C4H in alfalfa decreases lignin deposition and reduces or eliminates the needs for chemical pre-treatment in the production of fermentable sugars (Chen and Dixon, 2007). In tobacco, downregulation of C4H also reduced lignin deposition (Sewalt et al., 1997). In maize, expression of C4H and other genes from the lignin synthesis pathway was much more expressed in younger than in older already lignified internodes (Guillaumie et al., 2008). Downregulation of COMT-like genes in other grasses, such as maize, wheat and ryegrass, has shown decrease in lignin concentration and increase in IVNDFD (Piquemal et al., 2002; Ma and Xu, 2008; Tu et al., 2010). Downregulation of CCoAOMT in alfalfa and Arabidopsis reduced lignin content, with a significant reduction in guaiacyl (G) units and almost no effect on syringyl (S) unit yield, leading to an increased S G ratio (Chen et al., 2006; Do et al., 2007). Lignin biosynthesis can also be modulated by other genes. It has been demonstrated that downregulation of CAD in Festuca arundinacea decreases lignin content and increases DM digestibility 7Æ2 9Æ5% (Chen et al., 2003). Also, a greater decrease in lignin content (50%) was reported for transgenic tobacco plants with downregulation of CAD and CCR expression (Chabannes et al., 2001). In our study, we did not see an association between expression of CAD, CCR, 4CL and PAL with the rate of decline in stem fibre digestibility of guineagrass genotypes. As mentioned before, because of the existence of multiple genes coding for these proteins, it is possible that some members of the multigene families not amplified with our primers have different profiles of expression than described here. Rapid decrease in fibre digestibility limits the nutritional value of tropical forages. Increase in mrna expression of enzymes from the lignin synthesis pathway may be responsible for the decrease in fibre digestibility. This study demonstrates that genotypes with fast decrease in NDF digestibility of the stems with advance in maturity also have different patterns of C4H and CCoAOMT expression, with earlier increase in the expression of these two genes than genotypes with low decrease in NDF digestibility. The results from this study have possible implication for forage breeding or development of transgenic technologies in forage plants. Acknowledgments The study was funded by FAPESP (Fundação de Amparo a Pesquisa do Estado de São Paulo). References ALLISON C.D. (1985) Factors affecting forage intake by range ruminants: a review. Journal of Range Management, 38, AOAC. (1997) Official methods of analysis, 16th edn. Gaithersburg: Association of Official Analytical Chemists. ARAUJO A.C.G., NOBREGA Ó J.M., POZZOBON M.T. and CARNEIRO V.T.C. (2005) Evidence of sexuality in induced tetraploids of Brachiaria brizantha (Poaceae). Euphytica, 144, BARRIERE ARRIÈRE Y., MECHIN É V., LAFARGUETTE F., MANICACCI D., GUILLON F., WANG H., LAURESSERGUES D., PICHON M., BOSIO M. and TATOUT C. (2009) Toward the discovery of maize cell wall genes involved in silage maize quality and capacity to biofuel production. Maydica, 54, BREGARD RÉGARD A., BELANGER G., MICHAUD R. and TREMBLAY F. (2001) Biomass partitioning, forage nutritive value, and yield of contrasting genotypes of timothy. Crop Science, 41, BURTON G.W. and MONSON W.G. (1988) Registration of Tifton 78 bermudagrass. Crop Science, 28, BUXTON D.R. and REDFEARN D.D. (1997) Plant limitations to fiber digestion and utilization. Journal of Nutrition, 127, 814S 818S. CAMPBELL M.M. and SEDEROFF R.R. (1996) Variation in lignin content and composition. Plant Physiology, 110, CARNEVALLI R.A., DA SILVA S.C., BUENO A.A.O., UEBELE M.C., BUENO F.O., HODGSON J., SILVA G.N. and MORAIS J.P.G. (2006) Herbage production and grazing losses in Panicum maximum cv. Mombaça under four grazing managements. Tropical Grasslands, 40, CASLER M.D. and CARPENTER J.A. (1989) Morphological and chemical responses to selection for in vitro dry matter digestibility in smooth bromegrass. Crop Science, 29, CASLER M.D. and VOGEL K.P. (1999) Accomplishments and impact from breeding for increased forage nutritional value. Crop Science, 39,

12 Expression of genes from the lignin synthesis pathway 53 CHABANNES M., BARAKATE A., LAPIERRE C., MARITA J.M., RALPH J., PEAN M., DANOUN S., HALPIN C., GRIMA-PETTENATI J. and BOUDET A.M. (2001) Strong decrease in lignin content without significant alteration of plant development is induced by simultaneous downregulation of cinnamoyl CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) in tobacco plants. Plant Journal, 28, CHEN F. and DIXON R.A. (2007) Lignin modification improves fermentable sugar yields for biofuel production. Nature Biotechnology, 25, CHEN L., AUH C.K., DOWLING P., BELL J., CHEN F., HOPKINS A., DIXON R. and WANG Z.Y. (2003) Improved forage digestibility of tall fescue (Festuca arundinacea) by transgenic down-regulation of cinnamyl alcohol dehydrogenase. Plant Biotechnology Journal, 1, CHEN F., REDDY M.S.S., TEMPLE S., JACKSON L., SHADLE G. and DIXON R.A. (2006) Multi-site genetic modulation of monolignol biosynthesis suggests new routes for formation of syringyl lignin and wall-bound ferulic acid in alfalfa (Medicago sativa L.). Plant Journal, 48, CHERNEY D.J.R., CHERNEY J.H. and LUCEY R.F. (1993) In vitro digestion kinetics and quality of perennial grasses as influenced by forage maturity. Journal of Dairy Science, 76, CHOMCZYNSKI P. and SACCHI N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry, 162, CLAESSENS A., MICHAUD R., BELANGER G. and MATHER D. (2005) Leaf and stem characteristics of timothy plants divergently selected for the ratio of lignin to cellulose. Crop Science, 45, DO C.T., POLLET B., THEVENIN J., SIBOUT R., DENOUE D., BARRIERE Y., LAPIERRE C. and JOUANIN L. (2007) Both caffeoyl Coenzyme A 3-O-methyltransferase 1 and caffeic acid O-methyltransferase 1 are involved in redundant functions for lignin, flavonoids and sinapoyl malate biosynthesis in Arabidopsis. Planta, 226, GILL J.L. (1978) Design and analysis of experiments in the animal and medical sciences. Ames, IA: Iowa State Univ. Press. GOERING H.K. and VAN SOEST P.J. (1970) Forage fiber analysis (apparatus, reagents, procedures, and some applications). Washington, DC: USDA Agric. Handb U.S. Gov. Print. Office. GRIFFIN J.L. and JUNG G.A. (1983) Leaf and stem forage quality of big bluestem and switchgrass. Agronomy Journal, 75, GUILLAUMIE S., SAN-CLEMENTE H., DESWARTE C., MARTINEZ Y., LAPIERRE C., MURIGNEUX A., BARRIE RERE Y., PICHON M. and GOFFNER D. (2007) MAIZEWALL. Database and developmental gene expression profiling of cell wall biosynthesis and assembly in maize. Plant Physiology, 143, GUILLAUMIE S., GOFFNER D., BARBIER O., MARTINANT J.P., PICHON M. and BARRIERE ARRIÈRE Y. (2008) Expression of cell wall related genes in basal and ear internodes of silking brown-midrib-3, caffeic acid O-methyltransferase (COMT) down-regulated and normal maize plants. BMC Plant Biology, 8, HACKER J.B. and MINSON D.J. (1981) The digestibility of plant parts. Herbage Abstracts, 51, HEATH R., HUXLEY H., STONE B. and SPANGENBERG G. (1998) cdna cloning and differential expression of three caffeic acid O-methyltransferase homologues from perennial ryegrass (Lolium perenne). Journal of Plant Physiology, 153, HILL G.M., GATES R.N. and BURTON G.W. (1993) Forage quality and grazing steer performance from Tifton 85 and Tifton 78 bermudagrass pastures. Journal of Animal Science, 71, ISKANDAR H.M., SIMPSON R.S., CASU R.E., BONNETT G.D., MACLEAN D.J. and MANNERS J.M. (2004) Comparison of reference genes for quantitative realtime polymerase chain reaction analysis of gene expression in sugarcane. Plant Molecular Biology Reports, 22, JANK L., SAVIDAN Y.H., SOUZA M.T.C. and COSTA J.C.G. (1994) Avaliação do germoplasma de Panicum maximum introduzida da África. I: Produção forrageira. Brazilian Journal of Animal Science, 23, JONES C.A. (1985) C 4 grasses and cereals, growth, development and stress response. New York: John Wiley & Sons. JUNG H.G. and CASLER M.D. (2006) Maize stem tissues: cell wall concentration and composition during development. Crop Science, 46, JUNG H.G. and DEETZ D.A. (1993) Cell wall lignification and degradability. In: Jung H.G. (Ed) Forage cell wall structure and digestibility, pp Madison, WI, USA: ASA, CSSA, SSSA. LIVAK K.J. and SCHMITTGEN T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 )DDCT method. Methods, 25, MA Q.H. and XU Y. (2008) Characterization of a caffeic acid 3-O-methyltransferase from wheat and its function in lignin biosynthesis. Biochimie, 90, MINSON D.J. (1990) Forage in ruminant nutrition. San Diego, CA: Academic Press. MUIR J.P. and JANK L. (2004) Guineagrass. In: Moser L.E. (Ed) Warm-season (C4) grasses, pp Madison, WI, USA: ASA, CSSA, SSSA. NEEL J.P.S., FELDHAKE C.M. and BELESKY D.P. (2008) Influence of solar radiation on the productivity and nutritive value of herbage of cool-season species of an understorey sward in a mature conifer woodland. Grass Forage Science, 63, NELSON C.J. and MOSER L.E. (1994) Plant factors affecting forage quality. In: Fahey G.C. Jr (Ed.) Forage quality, evaluation and utilization, pp Madison, WI, USA: ASA, CSSA and SSSA. NORDHEIM-VIKENIKEN H., VOLDEN H. and JORGENSEN M. (2009) Effects of maturity stage, temperature and photoperiod on growth and nutritive value of timothy (Phleum pratense L.). Animal Feed Science and Technology, 152, PINCON INÇON G., MAURY S., HOFFMANN L., GEOFFROY P., LAPIERRE C., POLLET B. and LEGRAND M. (2001) Repression of O-methyltransferase genes in transgenic

13 54 S. S. Stabile et al. tobacco affects lignin synthesis and plant growth. Phytochemistry, 57, PIQUEMAL J., CHAMAYOU S., NADAUD I., BECKERT M., BARRIERE ARRIÈRE Y., MILA I., LAPIERRE C., RIGAU J., PUIGDOMENECH P., JAUNEAU A., DIGONNET C., BOUDET A.M., GOFFNER D. and PICHON M. (2002) Downregulation of caffeic acid O-methyltransferase in maize revisited using a transgenic approach. Plant Physiology, 130, RALPH J., LUNDQUIST K., BRUNOW G., LU F., KIM H., SCHATZ P.F., MARITA J.M., HATFIELD R.D., RALPH S.A., CHRISTENSEN J.H. and BOERJAN W. (2004) Lignins: natural polymers from oxidative coupling of 4- hydroxyphenylpropanoids. Phytochemistry, 3, REID R.L., JUNG G.A. and THAYNE W.V. (1988) Relationships between nutritive quality and fiber components of cool season and warm season forages: a retrospective study. Journal of Animal Science, 66, RIBOULET C., GUILLAUMIE S., MECHIN É V., BOSIO M., PICHON M., GOFFNER D., LAPIERRE C., POLLET B., LEFEVRE EFÈVRE B., MARTINANT J.P. and BARRIERE ARRIÈRE Y. (2009) Kinetics of phenylpropanoid gene expression in maize growing internodes: relationships with cell wall deposition. Crop Science, 49, SEWALT V.J.H., NI W.T., BLOUNT J.W., JUNG H.G., MASOUD S.A., HOWLES P.A., LAMB C. and DIXON R.A. (1997) Reduced lignin content and altered lignin composition in transgenic tobacco down-regulated in expression of L-phenylalanine ammonia-lyase or cinnamate 4-hydroxylase. Plant Physiology, 115, STABILE S.S., SALAZAR D.R., JANK L., RENNO ENNÓ F.P. and SILVA L.F.P. (2010) Characteristics of nutritional quality and production of genotypes of guineagrass harvested in three maturity stages. Brazilian Journal of Animal Science, 39, TILLEY J.M. and TERRY R.A. (1963) A two-stage technique for the in vitro digestion of forage crops. Journal of the British Grassland Society, 18, TU Y., ROCHFORT S., LIU Z., RAN Y., GRIFFITH M., BADEN- HORST P., LOUIE G.V., BOWMAN M.E., SMITH K.F., NOEL J.P., MOURADOV A. and SPANGENBERG G. (2010) Functional analyses of caffeic acid O-methyltransferase and cinnamoyl-coa-reductase genes from perennial ryegrass (Lolium perenne). Plant Cell, 22, VAN SOEST P.J. (1994) Nutritional ecology of the ruminant. Ithaca: Cornell University Press. VAN SOEST P.J., ROBERTSON J.B. and LEWIS B.A. (1991) Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. Journal of Dairy Science, 74, YUAN J.S., REED A., CHEN F. and STEWARD C.N. JR (2006) Statistical analysis of real-time PCR data. BMC Bioinformatics, 7,