Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry Figure S2 Supplementry Figure S3 Supplementry Figure S4 Supplementry Figure S5 Supplementry Figure S6 Supplementry Figure S7 Supplementry Figure S8 Supplementry Figure S9 Supplementry Tble S1 Supplementry Tble S2
α α+h s α+h us α ire1 α ire1 +H s α ire1 +H us α hxl1 α hxl1 +H s α hxl1 +H us Supplementry Figure S1. Overctivtion of Hxl1 does not ffect sexul differentition in C. neoformns. Ech Cryptococcus strin ws cultured in the liquid YPD medium t 30 C overnight. Next, equl concentrtions of MATα nd MAT strins were mixed nd spotted onto V8 mting medium (ph 5). Serotype A strins were co cultured on the V8 medium (ph 5.0) for 10 d. Strin informtion: α (H99), (KN99), α ire1 mutnt (), α hxl1 mutnt (YSB723), α+h s (YSB742), α+h us (YSB737), α ire1 +H s (YSB1127), α ire1 +H us (YSB1126), α hxl1 +H s (YSB1225), nd α hxl1 +H us (YSB762).
α α ire1 α RIM101oe ire1 α ADA2oe ire1 α GCN5oe ire1 15 dy Supplementry Figure S2. Overexpression of ADA2, RIM101, or GCN5 did not suppress the mting defect of the ire1 mutnt. Serotype A MATα nd MAT strins were grown in the liquid YPD medium t 30 C for 16 h. After cell counting, MATα nd MAT strins were co cultured on the V8 medium (ph 5.0) for 15 d t room temperture in the drk: α (H99) (KN99), α ire1 () ire1 (YSB550), α RIM101oe ire1 (YSB3308) ire1 (YSB550), α ADA2oe ire1 (YSB3376) ire1 (YSB550), nd α GCN5oe ire1 (YSB3372) ire1 (YSB550). Representtive edges of the mting ptches were photogrphed t 100 mgnifiction.
b c d E (6130) e h 3.5 kb 1.9 kb E (2918) ire1 ::NEO KW308* KW309* BmHI digestion B(0) B (1922) hxl1 ::NEO H 6. 2.9 kb f i KN99 YSB550* EcoRI digestion YSB550 E (4213) E (4213) ire1 ::NEO KW350* E (6785) ire1 ::NAT KW351* B(0) B (1922) H B (0) B (3495) E (12174) H ::NEO g j 8.5 kb 4.2 kb 2.5 kb H (0) crg1δ YSB1010* YSB1011* YSB1012 3.5 kb 1.9 kb α crg1δ EcoRV digestion H (1217) YSB1007 KN99 YSB850* YSB851 BmHI digestion YSB1008* YSB1009* YSB849 H (4391) hxl1 ::NEO H ire1 ::NAT H B (0) B (3237) 3.2 kb hxl1 ::NAT 1.9 kb H CPK1 H (0) H (2863) H ::NAT cpk1 ::NEO BmHI digestion k l m YSB2505* YSB2506 YSB2567 E (2695) YSB2507* YSB2508 YSB2569 3. 2.8 kb cpk1 ::NEO RAS1 E(0) E (810) 2.6 kb RAS1 1.2 kb HindIII digestion CPK1 rs1 ::NEO 0.8 kb EcoRV digestion rs1 ::NEO Supplementry Figure S3. Disruption of C. neoformns nd H in serotype A MAT KN99, ire1 mutnts nd crg1 strins nd disruption of CPK1 nd RAS1 in the ire1 mutnts. (,c,f, h, j, nd l) A digrm of disruption of the gene, H gene, CPK1 gene, nd RAS1 gene in the serotype A (MAT) KN99 strin, ire1 mutnts ( nd YSB550), crg1 mutnts (H99 crg1 nd PPW196). (b, d, e, g, i, k, nd m) The correct gene disruption ws verified by Southern blot nlysis using genomic DNAs digested with the indicted restriction enzyme. Strins mrked with sterisk were used in this study.
b c d E (5231) JEC21 YSB2883 YSB2884 YSB2885 YSB2886* YSB2887 YSB2888 P (2377) JEC21 YSB2030* E (2591) 5.2 kb 2.5 kb ire1 ::NAT H P (3077) 3kb H H ::NAT hxl1 ::NAT EcoRI digestion ire1 ::NAT e f g h E (5231) JEC20 YSB2026* YSB2027 YSB2028 YSB2029 P (2377) 5.2 kb H PstI digestion JEC20 YSB1985* E (1191) 1. ire1 ::NEO P (1397) H ire1 ::NEO EcoRI digestion hxl1 ::NEO 1.3 kb PstI digestion H ::NEO Supplementry Figure S4. Disruption of C. neoformns nd H in serotype D JEC21 nd JEC20 strins. (, c, e, nd g) A digrm of disruption of the gene nd H gene in serotype D JEC21 (MATα) strin nd JEC20 (MAT). (b, d, f, nd h) The correct gene disruption ws verified by Southern blot nlysis using genomic DNAs digested with the indicted restriction enzyme. Strins mrked with sterisk were used in this study.
b 80 YSB2144* YSB2145* E (5231) 5.2 kb E (2591) 2.5 kb ire1 ::NAT ire1 ::NAT EcoRI digestion c P (2377) d 80 YSB2147* YSB2148* H P (3077) hxl1 ::NAT 3 kb H hxl1 ::NAT e P (2377) f PstI digestion YSB2145 KW345* KW346* H P (1397) 1.3 kb H hxl1 ::NEO hxl1 ::NEO PstI digestion Supplementry Figure S5. Deletion of C. neoformns nd H in the 80 strin nd ire1 mutnt. (, c, nd e) A digrm of disruption of the gene nd H gene in the 80 strin. (b, d, nd f) The correct gene disruption ws verified by Southern blot nlysis using genomic DNAs digested with the indicted restriction enzyme. Strins mrked with sterisk were used in this study.
b c B(0) B (4772) YSB550 YSB3193 YSB3194* YSB550 YSB3193 YSB3194* B(0) NAT B (4592) E (6902) PH3 4.7 kb 4.5 kb BmHI digestion KA PH3:KA KA rrna Supplementry Figure S6. Construction of the constitutively KA overexpressing strins in C. neoformns. () The strtegy for construction of the PH3:KA strin contining the NAT resistnce mrker (NAT R ) nd the histone H3 gene promoter (PH3). (b) The correct genotype of the PH3:KA strin in the bckground of the ire1 mutnt ws confirmed by Southern blot nlysis using genomic DNAs digested with the restriction enzyme BmHI. The membrne ws hybridised with KA specific probe, wshed, nd developed. (c) Northern blot nlysis for mesurement of KA expression in PH3:KA strins. Dt from ethidium bromide stining of rrna ws used for loding control. Strins mrked with sterisk were used in this study.
E (4230) E (3861) E (6568) b 80 YSB3492* YSB3493* NEO PH3 c YSB2145 YSB3496 YSB3497 YSB3498 YSB3499* YSB3500* 4.2 kb 3.8 kb 2.5 kb KA PH3:KA 4.2 kb 3.8 kb 2.5 kb KA PH3:KA d EcoRI digestion 80 YSB3492 * YSB3493 * e YSB2145 YSB3496 EcoRI digestion YSB3497 YSB3498 YSB3499* YSB3500* KA KA rrna rrna Supplementry Figure S7. Construction of the constitutively KA overexpressing strins from the 80 nd ire1 mutnt.() A digrm of construction of the constitutively KA overexpressing strins using H3 promoter. (b nd c) The correct genotype of the PH3:KA strin in ech bckground strin (80: YSB3492 nd YSB3493 nd ire1δ mutnt: YSB3499 nd YSB3500) ws confirmed by Southern blot nlysis using genomic DNAs digested with the restriction enzyme EcoRI. The membrne ws hybridised with KA specific probe, wshed, nd developed. (d nd e) Northern blot nlysis for mesurement of KA expression in PH3:KA strins. Dt from ethidium bromide stining of rrna ws used for loding control. Strins mrked with sterisk were used in this study.
b c H (2611) H(0) PH3:ADA2 YSB3375 YSB3376* YSB3377 YSB3378* YSB3379 ADA2 H (0) H (4969) 4.9 kb PH3:ADA2 ADA2 PH3:ADA2 YSB3375 YSB3376* YSB3377 YSB3378* YSB3379 NEO PH3 2.6 kb ADA2 PH3:ADA2 HindIII digestion d e f H(0) H (2224) PH3:GCN5 YSB3372* YSB3373* rrna PH3:GCN5 YSB3372* YSB3373* H (0) H (4582) GCN5 4.5 kb PH3:GCN5 GCN5 NEO PH3 g h i K (2052) K (3115) K (0) RIM101 K(0) K (4410) K (5473) NEO PH3 PH3:RIM101 PH3:GCN5 GCN5 2.2 kb HindIII digestion PH3:RIM101 YSB3308* YSB3309* 4.4 kb RIM101 2 kb PH3:RIM101 KpnI digestion rrna RIM101 rrna PH3:RIM101 YSB3308* YSB3309* Supplementry Figure S8. Construction of the constitutively ADA2, GCN5, nd RIM101 overexpressing strins from the ire1 mutnt. (, d, nd g) A digrm of construction of the constitutively ADA2, GCN5, nd RIM101 overexpressing strins using the H3 promoter. (b, e, nd h) The correct genotype of the PH3:ADA2, PH3:GCN5, nd PH3:RIM101 strins in the strin (PH3:ADA2: YSB3376 nd YSB3378, PH3:GCN5: YSB3372 nd YSB3373, nd PH3:RIM101:YSB3308 nd YSB3309) ws confirmed by Southern blot nlysis using genomic DNAs digested with the indicted restriction enzyme. (c, f, nd i) Northern blot nlysis for mesurement of ADA2, GCN5, nd RIM101 expression levels. Ech membrne ws hybridised with ADA2, GCN5, nd RIM101 specific probes, wshed, nd developed. Dt from ethidium bromide stining of rrna ws used for loding control. Strins mrked with sterisk were used in this study.
P (7112) b c H99 YSB2618 YSB2619* YSB2619 YSB2744* STE6 P (9967) 7.9 kb P (7929) 7. STE6 STE6:GFP STE6:GFP NEO 2 kb PstI digestion d e f E(0) E (504) E (2216) STE3/CPRα E(0) E (504) 4.5 kb 1.7 kb E (5071) 0.5 kb H99 YSB2863 YSB2864* YSB2865 STE3:GFP STE3 4 Kb 4 Kb EcoRV, HindIII digestion YSB2864 YSB3019 ire1 ::NAT YSB3020* YSB3021 YSB3022 ire1 ::NAT STE3/CP:GFP NEO EcoRV digestion g h i E(0) E (2311) CP E (5617) E(0) E (2311) E (8472) 6. 3.3 kb H99 YSB3300* YSB3301 CP:GFP CP 4 Kb EcoRV, HindIII digestion YSB3300 YSB3311* ire1 ::NAT CP:GFP NEO EcoRV digestion EcoRV, HindIII digestion Supplementry Figure S9. Construction of the STE6:GFP, STE3/CPRα:GFP, nd CP:GFP strins nd ire1 mutnt in ech Gfp strin bckground. (, d, nd g) The scheme for construction of the STE6:GFP, STE3/CPRα:GFP, nd CP:GFP strins. (b, e, nd h) The correct genotype of the STE6:GFP, STE3/CPRα:GFP, nd CP:GFP strins in the strin (STE6:GFP: YSB2618 nd YSB2619, STE3/CPRα:GFP: YSB2864 nd YSB2865, nd CP:GFP: YSB3300 nd YSB3301) ws confirmed by Southern blot nlysis using genomic DNAs digested with the indicted restriction enzyme. (c, f, nd i) Southern blot nlysis for verifiction of the ire1 mutnt in ech Gfp strin bckground. Strins mrked with sterisk were used in this study.
Supplementry Tble S1. Strins used in this study Strin Genotype Prent Reference H99 MAT ref. 1 KN99 MAT ref. 2 JEC21 MAT ref. 3 JEC20 MAT ref. 3 80 MAT ref. 4 MAT ire1 ::NAT STM#224 H99 ref. 5 YSB1000 MAT ire1 ::NAT STM#224 NEO ref. 5 YSB723 MAT hxl1 ::NAT STM#295 H99 ref. 5 YSB762 MAT hxl1 ::NAT STM#295 H NEO YSB723 ref. 5 YSB737 MAT H us NEO H99 ref. 5 YSB742 MAT H s NEO H99 ref. 5 YSB1126 MAT ire1 ::NAT STM#224 H us NEO ref. 5 YSB1127 MAT ire1 ::NAT STM#224 H s NEO ref. 5 YSB1225 MAT hxl1 ::NAT STM#295 H s NEO YSB723 ref. 5 YSB119 MAT c1 ::NAT STM#43 ur5 ACA1 URA5 YSB108 ref. 6 YSB121 MAT c1 ::NEO ur5 ACA1 URA5 YSB109 ref. 6 H99 crg1 MAT ur5 crg1 ::URA5 F99 ref. 7 PPW196 MAT ur5 crg1 ::URA5 F99 ref. 7 YSB53 MAT rs1 ::NAT STM#150 H99 ref. 6 YSB127 MAT cpk1 ::NAT STM#184 H99 ref. 8 YSB1366 MAT rim101 ::NAT STM#208 H99 ref. 9 YSB550 MAT ire1 ::NEO KN99 This study YSB850 MAT hxl1 ::NEO KN99 This study KW308 MAT ire1 ::NAT STM#224 hxl1 ::NEO This study KW309 MAT ire1 ::NAT STM#224 hxl1 ::NEO This study KW350 MAT ire1 ::NEO hxl1 ::NAT STM#56 YSB550 This study KW351 MAT ire1 ::NEO hxl1 ::NAT STM#56 YSB550 This study YSB1741 MAT PH3:KA NEO ire1 ::NAT STM#224 ref. 10 YSB3194 MAT PH3:KA NAT ire1 ::NEO YSB550 This study YSB3308 MAT PH3:RIM101 NEO ire1 ::NAT STM#224 This study YSB3309 MAT PH3:RIM101 NEO ire1 ::NAT STM#224 This study YSB3372 MAT PH3:GCN5 NEO ire1 ::NAT STM#224 This study YSB3373 MAT PH3:GCN5 NEO ire1 ::NAT STM#224 This study YSB3376 MAT PH3:ADA2 NEO ire1 ::NAT STM#224 This study YSB3378 MAT PH3:ADA2 NEO ire1 ::NAT STM#224 This study YSB1008 MAT ur5 crg1 ::URA5 ire1 ::NAT STM#125 H99 crg1 This study YSB1009 MAT ur5 crg1 ::URA5 ire1 ::NAT STM#125 H99 crg1 This study YSB1010 MAT ur5 crg1 ::URA5 ire1 ::NAT STM#125 PPW196 This study YSB1011 MAT ur5 crg1 ::URA5 ire1 ::NAT STM#125 PPW196 This study YSB2505 MAT ire1 ::NAT STM#224 cpk1 ::NEO This study YSB2507 MAT ire1 ::NAT STM#224 rs1 ::NEO This study YSB2619 MAT STE6:GFP NEO H99 This study YSB2744 MAT STE6:GFP NEO ire1 ::NAT STM#169 YSB2619 This study YSB2864 MAT STE3:GFP NEO H99 This study YSB3020 MAT STE3:GFP NEO ire1 ::NAT STM#169 YSB2864 This study YSB3000 MAT CP:GFP NEO H99 This study YSB3311 MAT CP:GFP NEO ire1 ::NAT STM#169 YSB3000 This study YSB2886 MAT ire1 ::NAT STM#273 JEC21 This study YSB2026 MAT ire1 ::NEO JEC20 This study YSB2030 MAT hxl1 ::NAT STM#58 JEC21 This study YSB1985 MAT hxl1 ::NEO JEC20 This study YSB2144 MAT ire1 ::NAT STM#273 80 This study YSB2145 MAT ire1 ::NAT STM#273 80 This study YSB2147 MAT hxl1 ::NAT STM#43 80 This study YSB2148 MAT hxl1 ::NAT STM#43 80 This study
KW345 MAT ire1 ::NAT STM#273 hxl1 ::NEO YSB2145 This study KW346 MAT ire1 ::NAT STM#273 hxl1 ::NEO YSB2145 This study YSB3596 MAT ire1 ::NAT STM#273 NEO YSB2144 This study YSB3492 MAT PH3:KA NEO 80 This study YSB3493 MAT PH3:KA NEO 80 This study YSB3499 MAT PH3:KA NEO ire1 ::NAT STM#273 YSB2145 This study YSB3500 MAT PH3:KA NEO ire1 ::NAT STM#273 YSB2145 This study Ech NAT STM# indictes the Nt r mrker with unique signture tg.
Supplementry Tble S2. Primers used in this study Primer Nme Sequence (5 3 ) Comment B79 TGTGGATGCTGGCGGAGGATA Screening primer on ACT promoter B1026 GTAAAACGACGGCCAGTGAGC M13 forwrd (extended) B1027 CAGGAAACAGCTATGACCATG M13 reverse (extended) B1454 AAGGTGTTCCCCGACGACGAATCG NSL B1455 AACTCCGTCGCGAGCCCCATCAAC NSR B1886 TGGAAGAGATGGATGTGC NSL NEO B1887 ATTGTCTGTTGTGCCCAG NSR NEO B4017 GCATGCAGGATTCGAGTG H3 promoter left flnking primer 1 B4018 GTGATAGATGTGTTGTGGTG H3 promoter right flnking primer 2 B354 GCATGCAGGATTCGAGTG GFPht NEO left flnking primer 1 B5665 GGTGGCGGTGGCTCTGTGAGC GFPht NEO left flnking primer 2 B1648 AGGAATACGAGGTTTATCGG screening primer (for serotype A) B1644 GCCCCATCATCATAATCAC left flnking primer 1 (for serotype A) B1645 GCTCACTGGCCGTCGTTTTACACTATGTGTCCATCTGAGGC left flnking primer 2 (for serotype A) B1646 CATGGTCATAGCTGTTTCCTGAGTGAGTTGAGGGAGGAAAG right flnking primer 1 (for serotype A) B1647 GAAGAAGAGCGTCAAGAAGG right flnking primer 2 (for serotype A) B1683 AGCATTAGGGGTGTAGGTG Southern blot probe primer 1 (for serotype A) B1880 AACTCTTCTCAGCCTTCGG H screening primer (for serotype A) B1881 GTTTGAGGCTGGTAAAAAGG H left flnking primer 1 (for serotype A) B1882 GCTCACTGGCCGTCGTTTTACATGGGGAATGAAAGCGTG H left flnking primer 2 (for serotype A) B1883 CATGGTCATAGCTGTTTCCTGAAGGGGCGAGAGTAGTTCAG H right flnking primer 1 (for serotype A) B1884 GACTGTAAAGGAGGGCATAAG H right flnking primer 2 (for serotype A) B1885 CGTTCTCCGTCTTGATAGC H Southern blot probe primer 1 (for serotype A) B2167 CAAGGTTGACGAGATGAGTATG screening primer (for serotype D nd 80) B2168 CTTTCTTTTTCCGCCTACC left flnking primer 1 (for serotype D nd 80) B2169 TCACTGGCCGTCGTTTTAC GTCGCCGAGAGAATAAAATC left flnking primer 2 (for serotype D nd 80) B2170 CATGGTCATAGCTGTTTCCTG TGAGTTGAGGGAGGAAAGTC right flnking primer 1 (for serotype D nd 80) B2171 AAGGACACTATCCGTTCCG right flnking primer 2 (for serotype D nd 80) B4948 GATTTGGGTCGGAGATTC Southern blot probe primer 1 (for serotype D nd 80) B4769 GGAGTGAAAGCAGGAGTTG H screening primer (for serotype D nd 80) B4770 CCATCGTTCGGTATGCTAC H left flnking primer 1 (for serotype D nd 80) B4771 TCACTGGCCGTCGTTTTACAGTGGAAATAGGTGCGATG H left flnking primer 2 (for serotype D nd 80) B4772 CATGGTCATAGCTGTTTCCTGTTGGAAGGGAGGAAATGC H right flnking primer 1 (for serotype D nd 80) B4773 GGGTTAGTAGGAAGAAGTAGGC H right flnking primer 2 (for serotype D nd 80) B4774 CGTTGGCGAAGGACAATAC H Southern blot probe primer 1 (for serotype D nd 80) B3550 TCCCAATCTACTGACCTATCG KA 5 screening primer (H3 promoter replcement for serotype A) B3551 CGTAGGGTATGTCTCTGATGAG KA left flnking primer 1 (H3 promoter replcement for serotype A) B4270 CACTCGAATCCTGCATGCGGTGGCAAAAGTCTTGAGGA KA left flnking primer 2 (H3 promoter replcement for serotype A) B4264 CAAGACCTCAAAGACACCG KA right flnking primer 1 (H3 promoter replcement for serotype A) B4271 ACCACAACACATCTATCACATGGCATACCCTTCAAGAAT KA right flnking primer 2 (H3 promoter replcement for serotype A) B3555 CAAGCAGGGACAGTAACAAC KA Southern blot probe primer 1 (for serotype A) B4978 AGGCAGTCTGGAGTGTCATC KA Northern blot probe primer 1 (for serotype A) B2182 TCAGCAGCAGCAGGTAAAC ADA2 5 screening primer (H3 promoter replcement for serotype A) B2183 GGATGATGGAATCGTATGC ADA2 left flnking primer 1 (H3 promoter replcement for serotype A) B6399 CACTCGAATCCTGCATGCACTCGTTTGTTGATGCCTTT ADA2 left flnking primer 2 (H3 promoter replcement for serotype A) B6400 ACCACAACACATCTATCACATGACTGTCACGCAGAGGAA ADA2 right flnking primer 1 (H3 promoter replcement for serotype A)
B2187 TTCATCTGGAGGACGAGTG ADA2 right flnking primer 2 (H3 promoter replcement for serotype A) B4269 CCCAGACCGTTTTGAATG ADA2 Southern blot probe primer 1 (for serotype A) B2183 GGATGATGGAATCGTATGC ADA2 Southern blot probe primer 2 (for serotype A) B2187 TTCATCTGGAGGACGAGTG ADA2 Northern blot probe primer 1 (for serotype A) B6400 ACCACAACACATCTATCACATGACTGTCACGCAGAGGAA ADA2 Northern blot probe primer 2 (for serotype A) B2986 CACGGCAACTTATGCTCTC RIM101 5 screening primer (H3 promoter replcement) B2982 CATCAGTCTTGCTTCTTCTGC RIM101 left flnking primer 1 (H3 promoter replcement) B6201 CACTCGAATCCTGCATGCCTTGGCCTTGCTGTTAACTT RIM101 left flnking primer 2 (H3 promoter replcement) B6202 ACCACAACACATCTATCACATGGCTTACCCAATTCTCCC RIM101 right flnking primer 1 (H3 promoter replcement) B6203 AGCACCAAAAGGTTCAGC RIM101 right flnking primer 2 (H3 promoter replcement) B4980 ACTCGGTGTTGGTGAAACGG RIM101 Southern blot probe primer 1 B4980 ACTCGGTGTTGGTGAAACGG RIM101 Northern blot probe primer 1 B6170 GCCAAATCTTCTCAGCACTC RIM101 Northern blot probe primer 2 B6401 CAAAAATGGCGTCAGGTC GCN5 5 screening primer (H3 promoter replcement) B6402 CAATGATGAATGACCACGAC GCN5 left flnking primer 1 (H3 promoter replcement) B6403 CACTCGAATCCTGCATGCAGCAGAAACGGAAAGGCTTA GCN5 left flnking primer 2 (H3 promoter replcement) B6404 ACCACAACACATCTATCACATGGCGCCAAAACCACGTCGT GCN5 right flnking primer 1 (H3 promoter replcement) B6405 TCAGAGTGGGTAGATTCGC GCN5 right flnking primer 2 (H3 promoter replcement) B6406 CGTCTTCGTCTTCATTGC GCN5 Southern blot probe primer 1 B6402 CAATGATGAATGACCACGAC GCN5 Southern blot probe primer 2 B6405 TCAGAGTGGGTAGATTCGC GCN5 Northern blot probe primer 1 B6406 CGTCTTCGTCTTCATTGC GCN5 Northern blot probe primer 2 B6632 TGGCGGAGAAACAGTAGAG KA 5 screening primer (H3 promoter replcement for 80) B6633 GGCAACCCTCATCTACTGAC KA left flnking primer 1 (H3 promoter replcement for 80) B6634 CACTCGAATCCTGCATGCCCCGGGCCTTTTTACCCTTT KA left flnking primer 2 (H3 promoter replcement for 80) B6635 ACCACAACACATCTATCACATGAAATGGCGAGTGAGGCG KA right flnking primer 1 (H3 promoter replcement for 80) B6644 CACTATTACCCACAAGCGG KA right flnking primer 2 (H3 promoter replcement for 80) B6637 AAGTCGTTCCTCCTCAGTG KA Southern blot probe primer 1 (for 80) B5661 CAGTCTAACTTTTGGCAGTGG STE6:GFP tgging left flnking primer 1 B5662 GCTCACAGAGCCACCGCCACCCTCCCATTCTCCCGTCTTCATCA STR6:GFP tgging left flnking primer 2 B5663 GCCACTCGAATCCTGCATGCATTATAGAGGTTGTCTTGC STE6:GFP tgging right flnking primer 1 B5664 GCTCGGGTAAGATACTGAGG STE6:GFP tgging right flnking primer 2 B5660 GAGGGTTGCCTTTGTTTG STE6:GFP tgging screening primer B5741 TTGGTTTCATAGCCCTGC STE6:GFP tgging Southern blot probe primer B5897 TTTTCATCGGAGTCCCTG STE3/CPRα:GFP tgging left flnking primer 1 B5898 GCTCACAGAGCCACCGCCACCAACGACAGCACGCTCGACCGA STE3/CPRα:GFP tgging left flnking primer 2 B5899 GCCACTCGAATCCTGCATGCTTCCACGATGGTTGATGTAAA STE3/CPRα:GFP tgging right flnking primer 1 B5900 GACAAGAATGCGATGTGG STE3/CPRα:GFP tgging right flnking primer 2 B4790 CTTCTACCTCTGCCTCTTCAC STE3/CPRα:GFP tgging screening primer B5959 CGTCTCCCATCTCACTTTG STE3/CPRα:GFP tgging Southern blot probe primer B5943 TATGATTCTTCCGCTCGC CP:GFP tgging left flnking primer 1 B5902 GCTCACAGAGCCACCGCCACCAACCATTGATGAGCTAGTCTT CP:GFP tgging left flnking primer 2 B5903 GCCACTCGAATCCTGCATGCAATGTCCATTTGTTGGGACCG CP:GFP tgging right flnking primer 1 B5904 GACCAAGCAAGAAGAAGATG CP:GFP tgging right flnking primer 2 B4792 CCATCTGTCATCGCTTTG CP:GFP tgging dignostic primer B4793 CAGTGGTAGCAGAGGAATAGG CP:GFP tgging Southern blot probe primer B1894 TTTTACGCTTTTTGCAGATTCCGCCAAA MFα1 primer 1 for Northern blot B1895 GACCACTGTTTCTTTCGTTCT MFα1 primer 2 for Northern blot J94 CGCCTTCACTGCCATCTTC MFα1 primer 1 for qrt nlysis J95 ACAAAGGGTCATGCCACCGG MFα1 primer 2 for qrt nlysis B679 CGCCCTTGCTCCTTCTTCTATG ACT1 primer 1 for qrt nlysis B680 GACTCGTCGTATTCGCTCTTCG ACT1 primer 2 for qrt nlysis
JOHE12039 CTGTAGAAGATGTGAGTTTGGG CPK1 left flnking primer 1 JOHE12040 CTGGCCGTCGTTTTACTGATTGATGAGAGATACGGG CPK1 left flnking primer 2 JOHE12041 GTCATAGCTGTTTCCTGGGCGGAGAAATAGAGGTTG CPK1 right flnking primer 1 JOHE12042 CGCACAAGAAGTAAGAGGTG CPK1 right flnking primer 2 JOHE12043 GGCTATGGACCGTATTCAC CPK1 screening primer JOHE12045 TATCTCACAAGCCACTCCC CPK1 Southern blot probe primer 1 JOHE12046 ATGCTGCTCACCGTTAGTC CPK1 Southern blot probe primer 2 JOHE11600 AAGACTGGTTCAGCAGAGC RAS1 left flnking primer 1 JOHE11601 CTGGCCGTCGTTTTACCTAAATGGGGATGGTTCG RAS1 left flnking primer 2 JOHE11602 GTCATAGCTGTTTCCTGAAACATCCGCCAAGCAAC RAS1 right flnking primer 1 JOHE11603 GAGCAAAATGAGGAACTTGG RAS1 right flnking primer 2 JOHE11604 TGTGCTTTACCAGGCAGTCG RAS1 screening primer JOHE11606 CACACTCTTTGTCCTTCCG RAS1 Southern blot probe primer 1 JOHE11607 ACCGTATTCTTCTTG ACC G RAS1 Southern blot probe primer 2
References 1. Perfect, J. R., Ketbchi, N., Cox, G. M., Ingrm, C. W. & Beiser, C. L. Kryotyping of Cryptococcus neoformns s n epidemiologicl tool. J. Clin. Microbiol. 31, 3305 3309 (1993). 2. Nielsen, K. et l. Sexul cycle of Cryptococcus neoformns vr. grubii nd virulence of congenic nd isoltes. Infect. Immun. 71, 4831 4841 (2003). 3. Kwon Chung, K. J., Edmn, J. C. & Wickes, B. L. Genetic ssocition of mting types nd virulence in Cryptococcus neoformns. Infect. Immun. 60, 602 605 (1992). 4. Lin,., Hull, C. M. & Heitmn, J. Sexul reproduction between prtners of the sme mting type in Cryptococcus neoformns. Nture 434, 1017 1021 (2005). 5. Cheon, S. A. et l. Unique evolution of the UPR pthwy with novel bzip trnscription fctor, Hxl1, for controlling pthogenicity of Cryptococcus neoformns. PLoS Pthog. 7, e1002177 (2011). 6. Bhn, Y. S., Hicks, J. K., Giles, S. S., Cox, G. M. & Heitmn, J. Adenylyl cyclse ssocited protein Ac1 regultes virulence nd differentition of Cryptococcus neoformns vi the cyclic AMP protein kinse A cscde. Eukryot. Cell 3, 1476 1491 (2004). 7. Wng, P., Cutler, J., King, J. & Plmer, D. Muttion of the regultor of G protein signling Crg1 increses virulence in Cryptococcus neoformns. Eukryot. Cell 3, 1028 1035 (2004). 8. Bhn, Y. S., Geunes Boyer, S. & Heitmn, J. Ssk2 mitogen ctivted protein kinse kinse kinse governs divergent ptterns of the stress ctivted Hog1 signling pthwy in Cryptococcus neoformns. Eukryot. Cell 6, 2278 2289 (2007). 9. Jung, K. W. et l. Systemtic functionl profiling of trnscription fctor networks in Cryptococcus neoformns. Nt. Commun. 6, 6757 (2015)
10. Jung, K. W., Kng, H. A. & Bhn, Y. S. Essentil roles of the Kr2/BiP moleculr chperone downstrem of the UPR pthwy in Cryptococcus neoformns. PLoS ONE 8, e58956 (2013).