Juvenile and Chronic Myelo-Monocytic Leukemia Haematopoietic stem cell Lympho-myeloid progenitor cell MEP CFU-GM lymphoid progenitor cell BFU-E CFU-MK CFU-E erythro CFU-M CFU-G CFU-T CFU-B MGK red blood cell platelet monocyte granulocyte T cell B cell NK
MDS/MPN of the WHO classification Clonal diseases of the HSC No BCR-ABL or Ph1 Bone marrow blast cells < 20% 1. Chronic myelomonocytic leukemia 2. Juvenile myelomonocytic leukemia 3. Atypical chronic myeloid leukemia, 4. Refractory anemia with ring sideroblasts and thrombocytosis 5. MDS/MPN unclassifiable Excluded in 2009 : PDGFBR rearrangement and eosinophilia
JMML An agressive myeloid malignancy of chilhood MPN / MDS in the WHO classification - Infant or young child (0-6), male > female, with fever and pallor, - Circulating WBC count > 10G/L; Peripheral monocytosis > 1 G/L - A few circulating myeloid precursor cells - Splenomegaly, hepatomegaly - Sometimes : skin rash, cough, bloody stools - Lack of BCR-ABL - Less than 20% blast cells in the bone marrow
JMML An agressive myeloid malignancy of chilhood Increased HbF for age Cytogenetic abnormality (monosomy 7, 25%) Hypersensitivity of myeloid progenitor cells to GM-CSF (not to IL-3 or G-CSF) AML4 / AML5 or spontaneous improvement Treatment : ABMT (EFS 52%)
Genetic syndromes that predispose to JMML Neurofibromatosis, type I (NF1) : prone to JMML in the first decade - Autosomal dominant disorder (or spontaneous) - At least 6 café au lait macules, - At least 2 neurofibromas or 1 plexiform neurofibroma, - Lisch nodules (iris hamartomas), axillary or inguinal freckling, and/or optic gliomas - NF1 encodes neurofibromin protein, a GTPase activating protein for Ras - Enhances the hydrolysis of the active, GTP-bound conformation of Ras - In the bone marrow of children with JMML: loss of the wild type allele - Mouse models of nf1 conditional deletion reproduce the disease
Genetic syndromes that predispose to JMML Noonan syndrome (NS) - Autosomal dominant (or spontaneous) disorder - Facial dysmorphism, short stature, webbed neck, cardiac anomalies, - Varying levels of impaired cognition, - Self-resolving myeloproliferative disorder in infancy that resembles JMML - Germine mutations in PTPN11 (former SHP2) in 50% of cases - Encodes a non-receptor protein tyrosine phosphatase (also SHP2) - That connects tyrosine kinase receptors to Ras - Other Noonan : germline mutations in SOS1, a RAS-GEF (Guanine nucleotide-exchange factor) KRAS
Gene mutations in JMML Mutually exclusive mutations in CBL Yp SHP2 Grb2 SOS1 Ras-GDP Ras-GTP NF1 PTPN11 35% NF1 25% N/KRAS 20% CBL 10% AKT STAT5 Other in SOS1, FLT3, ASXL1 Raf MEK No TET2 mutation ERK
CMML a disease of the lederly defined by only one positive criteria MPN / MDS in the WHO classification Clonal disease of HSC with monocytosis - Persistant monocytosis (> 1 G/L) - Lack of Ph1 or Bcr-Abl - Blood and bone marrow blast cells < 20% - Cell dysplasia, at least one cell line
Molecular abnormalities identified in human CMML 1 Cytogenetic abnormalities : 15-40% 2 Uniparental disomy : ~50 % 3 Mutations in Epigenetic genes : TET2 ; ASXL1 ; AML1/RUNX1; IDH1/2; EZH2; UTX Signalling : N/KRAS; CBL; FLT3-ITD, JAK2; NOTCH2 /NCST / MALM Splicing : SRSF2; ZRSR2; J2AF35; SF3B1 4 Deregulated expression of TIF1, mirna, CJUN, CFOS
Molecular abnormalities identified in human CMML (GFM 175 patients) IDH/TET2 pathway: 72% mutations
Molecular abnormalities identified in human CMML No specific mutation High frequency of TET2/IDH pathway mutations (> 70%) Combinations of mutations in signaling, epigenetic, splicing More mutations to identify (NGS)
Molecular abnormalities identified in human CMML Yoshida Nature 2011
Increasing complexity from myeloproliferative neoplasms to myeloproliferative / myelodysplastic diseases CML TE PV MF CMML BCR-ABL JAK2* hz JAK2* HZ JAK2* other TET2* - IDH1/2* other TET2 rare JAK2 rare
Clonal expansion occurs in the CD34 + /CD38 - compartment 29 MUTATIONS IN 17 PATIENTS 52 MUTATIONS IN 46 PATIENTS # CLONES AML1 ASXL1 CBL JAK2 KRAS NRAS TET2
CMML : clonal amplification at the stem cell level Stem cells? LMMP Progenitors? Mature cells Normal MPN CMML
TIF1 (Transcription Intermediary Factor 1 ) TIF1 involved in zebrafish erythropoiesis (severe anemia in «moonshine» mutant) human erythropoiesis (ex vivo differentiation of CD34+ cells) TIF1 knock-out embryonic lethal in mice Me H3K4 3 Acetylated lysines 1127 AA RING B1 B2 Coiled-coil TSS RBCC ou TRIM TIF Signature Sequence PHD Bromo Features of chromatin remodeling protein TIF1 - belongs to a group of four proteins (TIF1 ) - modulates the TGF- signaling pathway - is a transcriptional co-regulator (TAL1/PU1)
Ageing Tif1 / mice develop a CMML-like disease Peripheral blood Spleen 4 3 Ctrl / n=9 n=9 * Ctrl / Ctrl / Monocytes (k/mm 3 ) 2 1 n=11 n=23 n=12 n=23 n=12 n=20 ** Mac1-Alexa647 3% 44% 51% 1% 1 cm Weeks 0 1-1313 14-26 27-39 40 Gr1-FITC
TIF1 gene promoter is methylated in 35-50% of CMML -139 GGGAGGACGTCCGTGCGTACGTGCGCGTGCCGCAACCGCCCTCCTTCAAACGCGCGACGCG unconverted -139 GGGAGGAYGT TYGTGYGTA YGTGYGYGTGT YGTAAT YGTTT TT TTTTAAA YGYGYGA YGYG 35% of patients non methylated partially methylated totally methylated Control TIF1 low TIF1 normal expression (Subset # 1) (Part of subset # 2)
TIF1 expression level does not predict decitabine efficacy 300 mrna expression (relative) 250 200 150 100 50 0 Cumulative probablility of survival 1.0 0.8 Cumulative Probability of Survival 0.6 0.4 0.2 0.0 0.0 0.2 0.4 0.6 0.8 1.0 Low TIF1 low TIF1g high TIF1g Normal TIF1 17 15 11 7 2 0 18 14 11 9 3 1 0 6 12 18 24 30 0 6 12 18 24 30 Months Months Control Subset # 1 Subset # 2
Gene mutations in TET2, ASXL1, AML1 do not affect survival Cumulative Probability of Survival 1.0 0.8 0.6 0.4 0.2 0.0 TET2 Mutated Wild-type 13 10 9 7 3 25 22 16 12 4 ASXL1 Mutated Wild-type 19 15 11 7 2 19 17 14 12 5 Cumulative Probability of Survival 0.0 0.2 0.4 0.6 0.8 1.0 AML1 Mutated Wild-type AML1 WT AML1 MUT 10 7 6 3 1 Mutated 28 24 18 15 6 Wild-type 27 24 18 15 6 0 10 7 6 3 1 1 0 6 12 18 24 30 0 6 12 18 24 30 Months 0 6 12 18 24 30 Months
CJUN level correlates with response CMYB level correlates with survival Cumulative probablility of survival Cumulative Probability of Survival 1.0 0.0 0.2 0.4 0.6 0.8 1.0 0.8 0.6 0.4 0.2 0.0 Low P = 0.06 High 16 15 14 10 2 0 19 14 8 6 3 1 Months CJUN 1.0 low CJUN high CJUN 0.8 Cumulative Probability of Survival 0.6 0.4 0.2 0.0 0.0 0.2 0.4 0.6 0.8 1.0 Low P = 0.01 High 17 16 13 12 5 0 18 13 9 4 1 Months CMYB low MYB high MYB 30 0 6 12 18 24 30 0 6 12 18 24 30
Chronic myelomonocytic leukemia Persistant monocytosis (> 1000/µL) Why do these patients die?
The best recognized prognostic factor is blast cell count Diagnostic feature CMML1 CMML2 Peripheral blood monocytes Left shift and myelocytes Peripheral blood blasts Bone marrow blasts Dysplasia t(9;22) or BCR-ABL PDGFRA/B > 1 G/L < 10% < 5% < 10% 0, one, more No No > 1 G/L > 10% 5-19% 10-19% 0, one, more No No
Cells counted as «monocytes» in the peripheral blood include 2 populations Healthy donor CMML patient UPN TET2 mutation(s) in the two cell populations Side scatter Cell number CD14 Forward scatter CD14 47 54 71 72 79 81 85 96 100 136 153 107 171 174 180 194 207 211 216 None R1214W; L1420FS Q652X Mutation splice donor site exon 6 + L1855FS R544X ; E1492FS None E320X ; R1359H K450X ; I1163FS H1219Y F1104FS, D1384V None T1883FS None Q1501FS ; G1861R Q591X None L615FS ; K1422FS K1005FS ; S1324FS S354FS ; L615FS
The immunosuppressive properties of the CMML immature granulocytes Monocytes CD14+/CD24- Macrophage M-CSF Exosomes IL-13 -défensines HNP1-3 STAT3 STAT6 CD14-/CD24+ Granuleux immatures Lymphocyte
Take home messages 1 JMML / CMML are distinct diseases 2 JMML is a RAS pathway disease with hypersensitivity to GM-CSF 3 CMML is a TET2 disease with many different mutations 4 Epigenetic changes in addition to mutations (TIF1, mirna) 5 Immunosuppressive dysplastic granulocytes To further explore the disease pathogenesis : eric.solary@igr.fr