Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling 1, J. Andrew Pospisilik 1, G. Gregory Neely 1, Ralf-Harun Zwick 3, Verena Sigl 1, Guido Forni 4, Manuel Serrano 5, Vassilis G. Gorgoulis 2 and Josef M. Penninger 1 1
Supplementary Figure 1. Lung-specific deletion of Map2k7 affects JNK activation in the KRas G12D -driven lung tumors. (a) Targeting strategy of the Map2k7 locus. Genomic structure of the murine Map2k7 locus, targeting construct, targeted allele before and after Flp-mediated excision of the Neo-cassette (open arrow heads indicate FRT sites) and after Cre-mediated recombination are shown. Exons 3-10 were flanked with LoxP sites (black arrow heads). H HindIII, B BamHI, P PstI, X XbaI, RV EcoRV; DTA diphtheria toxin gene for negative selection; Neo neomycin gene for positive selection. (b) K5-Cre mediated deletion of Map2k7 in the epidermis (K5-Cre Map2k7 fl/fl ) leads to eye open at birth EOB phenotype. (c) Southern blot analysis of EcoRV digested genomic DNA isolated from the skin of control K5-Cre;Map2k7 fl/ and K5- Cre;Map2k7 fl/ littermate mice. The size of the wild type (wt) and flox (fl) allele and the deleted allele ( ) are indicated. (d) Schematic of KRas G12D induction in Lox-Stop-Lox (LSL) KRas G12D transgenic mice. Note the G12D mutation is located in the first exon (*). (e) 2
Southern blot analysis of EcoRV digested genomic DNA of lung tumors from KRas;Map2k7 +/ and KRas;Map2k7 fl/ mice after inhalation of AdCre. The mutant and wild type alleles are indicated. (f) Western blot analysis to monitor activation and expression of MKK4, MKK7, various MAPK kinases and Akt in lungs from KRas;Map2k7 +/ KRas;Map2k7 fl/ and KRas;Map2k7 fl/ mice 6 weeks post-adcre-infection. Data from three individual mice are shown for each genetic cohort. (g) ELISA for phosphorylated (P) cjun in lysates from lung tumors from KRas;Map2k7 fl/ and KRas;Map2k7 fl/ mice 6 and 9 weeks post-adcre-infection. Data are shown as means ± s.e.m. (n=5 per group) * P > 0.05; Student s t-test. 3
Supplementary Figure 2. Loss of MKK7 accelerates KRas G12D -driven lung cancer. (a) Analysis of lung tumor progression in Map2k7 fl/ and Map2k7 fl/ mice harboring the inducible Lox-Stop-Lox-KRas G12D oncogene (KRas;Map2k7 fl/. Mice were treated with AdCre (2.5 x 10E7 PFU) and sacrificed at the indicated time points. Representative histologies show increased tumor burden in KRas;Map2k7 fl/ mice and accelerated progression: hyperplasia in KRas;Map2k7 fl/+ and atypical adenomatous hyperplasia (AAH) in KRas;Map2k7 fl/ mice 4 weeks postinfection (Arrows indicate hyperplastic region and AAH), adenomas 6 weeks postinfection (Arrowheads denote adenomas) and adenomas in KRas;Map2k7 fl/+ as well as an adenocarcinoma in KRas;Map2k7 fl/ mice 9 weeks postinfection. H&E staining. Magnifications 10x. (b) Histology of whole lungs from KRas;Map2k7 fl/ and KRas;Map2k7 fl/ littermate control mice 9 weeks post-adcre-infection. Whereas the KRas;Map2k7 fl/ control lung shows hyperplasia and adenomas but also a substantial fraction of normal lung tissue, the KRas;Map2k7 fl/ lung is already almost completely obstructed with adenocarcinomas. Scale bars, 500 m (a) and 2mm (b). 4
Supplementary Figure 3. Enhanced proliferation in MKK7 mutant lung tumors. (a) Grading scheme for analyzing lung tumors: Hyperplastic lesions retain the basic woven lung architecture but show an accumulation of cells. Atypical adenomatous hyperplasia (AAH) have additional cellular and nuclear atypia. For quantification hyperplastic lesions and AAH were combined. Adenomas lost the typical architecture and form a compact cell mass with regular cell nuclei and are well circumcised and compress surrounding tissue. Adenocarcinomas are defined as structures with greater cytological atypia, increased frequency of mitosis, more papillary structures, prominent nucleoli and may show invasion of surrounding stroma, bronchioles. These lesions also show large, pleiomorphic nuclei (arrow) and tumor giant cells (double arrow). Magnification x20. Lower panel shows 5
adenocarcinomas of different differentiation status at higher magnification (x40). Inlets depict normal and abnormal mitosis, arrows heads show invasion into bronchioles and blood vessels. (b) Immunostaining for the proliferation marker Ki67 in lungs 4 and 6 weeks post-adcreinfection. Hyperplastic regions (4 wk) and adenomas (6 wk) are outlined. (c) Immunohistochemistry of lung tumors from KRas;Map2k7 fl/ and KRas;Map2k7 fl/ mice 4 and 6 weeks post-adcre-infection. H&E stained lung sections and section stained for the apoptosis marker, cleaved Caspase 3, are shown. Note that we failed to detect active Caspase 3 in both MKK7-expressing and MKK7-deficient lung tumors. Scale bars, 100 m and 20 m (a), 50 m (b), and 100 m (c). 6
Supplementary Figure 4. Genetic dissection of JNK isoform functions in KRas G12D -driven lung tumors. (a-b) Kaplan Meier analysis of overall survival of Mapk8 -/- (JNK1 -/- ) (a) and Mapk9 -/- (JNK2 -/- ) (b) mice harboring a conditional activated KRas G12D oncogene (n = at least 7 mice per genotype, Log rank test; no statistically significant differences were found). (c) Expression of JNK and p53 in Mapk8 -/- Mapk9 +/- compound mutant KRas G12D -induced tumors. -actin is shown as loading control. 7
Supplementary Figure 5. Characterisation of primary pneumocytes cultures and KRas V12D -driven lung tumors. (a-b) Immunohistochemistry of primary pneumocytes cultures (a) and primary KRas G12D - driven lung tumors (b) stained with CC10 to detect Clara cells and SP-C marking type II pneumocytes. Mammary epithelial cells (MECs) are shown as negative control. Scale bars, and 100 m. 8
Supplementary Figure 6. Gene profiling of primary pneumocytes. (a,b) Gene profiling of primary pneumocytes from KRas;Map2k7 fl/ and KRas;Map2k7 fl/ mice treated with AdCre-GFP in vitro. (a) Almost 100% of cultured primary pneumocytes show green fluorescence after AdCre-GFP infection (MOI~100). Western blot analysis revealed efficient loss of MKK7 protein 72 hours after AdCre-GFP infection. (b) Gene clustering from 3 individual pneumocyte cultures isolated from KRas;Map2k7 fl/ and KRas;Map2k7 fl/ littermates. The dendrogram was generated using hierarchical clustering. Levels of expression are represented on a scale from green (lowest expression) to red (highest expression). 9
Supplementary Figure 7. DNA damage and p53 mrna espression in KRas V12D -driven lung tumors. (a) Immunohistochemical analysis of the prototypic DDR markers phosphorylated and phosphorylated (P) Chk2 in lung tumors from KRas;Map2k7 fl/ H2AX and KRas;Map2k7 fl/ mice 6 and 8 weeks post-adcre-infection. Magnifications x400. Statistical evaluation of the labeling index (% positive cells) showed no difference between the genotypes (right panels). Data are shown as means ± s.e.m (Student s t-test). (b) Presence of DNA damage as marked by 53BP1 foci and H2AX foci in transformed pneumocytes but not in control nontransformed pneumocytes in lungs from wild, KRas;Map2k7 fl/ and KRas;Map2k7 fl/ mice 6 weeks post-adcre-infection. Arrows indicate BP531 foci (red) and yh2ax foci (green). DAPI (blue) was used as couterstain. Magnifications x1000. (c) Immunohistochemical 10
analysis of p53 protein expression in lung tumors from mice 6 and 8 weeks post-adcreinfection. Magnifications x400. Note that p53 positive nuclear immunostaining is also more intense (thick arrow) in control KRas;Map2k7 fl/ versus KRas;Map2k7 fl/ mice (thin arrow). The bar graphs denote p53 expression in arbitrary units (%) based on both staining intensity (%) and labeling index (%). Data are shown as means ± s.e.m. * P > 0.01 (Student s t-test). (d) RT-PCR analysis of Mkk7 and p53 mrna levels in lung tumors 6 weeks post-adcreinfection. Data are shown as means ± s.e.m. (n = 5 for each group) *** P > 0.001 (Student s t- test). Scale bars, and 50 m. 11
Supplementary Figure 8. In vitro induction of KRas G12D triggers proliferation but not induce DNA damage. (a-b) Analysis of DNA damage in primary pneumocytes from LSL-KRas G12D mice treated with Ad-GFP and Ad-Gre-GFP in vitro. (a) Primary pneumocytes from LSL-KRas G12D mice were infection with AdGFP and AdCre-GFP stained with anti-53bp1 antibody 6 days later. The bar graph denotes average numbers of 53BP1 foci per cell of the indicated genotype. - irradiation (8Gay, 2h) of pneumocytes serves as positive control for the formation of 53BP1- foci. Data are shown as means ± s.e.m. (b) Western blot analysis of phosphorylated (P) ERK (short and long exposure), total ERK, p53 and H2AX from primary pneumocytes cultures 2 and 4 days after AdGFP and AdCre-GFP infection. (c) FACS analysis of ethidium bromide (EtBr) stained primary pneumocytes cultures 2 and 4 days after AdGFP and AdCre-GFP infection. Percent of cells in S/G2/M-phase are given. Data are representative of at least 3 experiments and are shown as means ± s.e.m. (n = 4 for each group) * P > 0.05 (Student s t- test). Scale bars, and 5 m. 12
Supplementary Figure 9. MKK7 is activated by genotoxic stress and regulates cell cycle progression. (a-c) Effect of Mkk7 knock-down in the human lung tumor cell line A549. C, scrambled control sirna; 7, Mkk7 sirna. (a) JNK kinase assay after treatment with doxorubicin (Dox; 1 M) for the indicated time points. Lysates are shown to control for Mkk7 knock-down. (b) FACS analysis of ethidium bromide (EtBr) stained A549 cells treated as in (a). Percent of cells in S/G2/M-phase are given for the indicated time points. Data are representative of at least 3 experiments. (c) qpcr analysis for p53 mrna expression in A549 cells following doxorubicin treatment (Dox; 1 M). Data are shown as means ± s.e.m. (d) Efficient, stable knock-down of Mkk7 in A549 using shrna (psiren). (e) Western bolt analysis of MKK7 and phosphorylated (P) MKK7 in human non-small-cell-lung-carcinomas (NSCLC) and adjacent healthy tissues. 13
Supplementary Figure 10. MKK7 deficiency does not alter tumor burden but tumor grading in a p53 negative background. (a) Representative histology of lung tumors in KRas;Map2k7 fl/+ and KRas;Map2k7 fl/ mice on a Tp53 +/+, Tp53 +/- and Tp53 -/- background 6 weeks post-adcre-infection. Insets show highest grade lesion of the respective lung. (b) Distribution of pulmonary lesions in KRas;MKK7 fl/ and KRas;MKK7 fl/ mice in the various p53 backgrounds 6 weeks post-adcre-infection (n=8 per genotype). Grading was according to Supplementary Figure 3a. Data are shown as means ± s.e.m. * P > 0.05; ** P > 0.01 (Student s t-test). Scale bars, 10 μm for inlets and 2 mm for whole lung pictures. 14
Supplementary Figure 11. Generation of mice with mammary glandspecific deletions of MKK7. (a) Whole mount analysis of mammary glands from 6-weeks-old Map2k7 fl/fl and MMTV- Cre;Map2k7 fl/ (Map2k7 mam ) littermate females showing that loss of MKK7 in mammary epithelial cells does not affect the development of the epithelial tree during puberty. Of note, loss of MKK7 also did not affect formation of a lactating mammary gland during pregnancy. (b-d) Deletion of Map2k7 in mammary epithelial cells. (b) Immunostaining for MKK7 in mammary tissue of Map2k7 fl/fl and Map2k7 mam mice show intense MKK7 staining in ductal epithelial as well as myoepithelial cells only in the control Map2k7 fl/fl glands. (c) Western blot analysis of MKK7 in purified mammary epithelial cells. In (d) -actin is shown as a protein loading control. (d) Southern blot analysis of Map2k7 in purified mammary epithelial cells. (e) Primary mammary epithelial cells from Map2k7 fl/fl (fl) and Map2k7 mam ( ) mice were grown in growth medium (GM), starved over night (starv.) or stimulated with anisomycin (Anis.; 10 g/ml) or TNF (10ng/ml) for the time points indicated. Phosphorylation of JNK and cjun, indicative of pathway activation, were determined by Western blot. Total MKK7, JNK, and cjun protein are shown to control for the MKK7 deletion and protein expression levels. Scale bars, 5mm (a) and 50μm (b). 15
Supplementary Figure 12. NeuT-driven mammary cancer. (a) Representative histology of mammary cancers that developed in 180 day-old NeuT;MKK7 mam (n=21) and NeuT;MKK7 mam littermate females. H&E stained sections are shown. Scale bars, 100μm. 16
Supplementary Figure 13. MKK7 regulates p53 in MECs. (a-e) Analysis of p53 activation in primary mammary epithelial cells purified from MKK7 fl/fl mice and treated in vitro with AdGFP and AdCre to generate Map2k7 fl/fl (fl) and Map2k7 ( ) cells. (a) JNK kinase assay after treatment with doxorubicin (Dox; 1 M) and TNF (10ng/ml) for the indicated time points. (b) FACS analysis of ethidium bromide (EtBr) stained mammary epithelial cells treated as in (b). Percent of cells in S/G2/M-phase are given for the indicated time points. Data are representative of at least 3 experiments. (c) qpcr analysis of mrna expression of previously defined p53 target genes in Map2k7 fl/fl (fl) and Map2k7 ( ) mammary epithelial cells treated for 8 hours with Dox (1 M). Data are shown as means ± s.e.m. * P > 0.05 (Student s t-test). (d) qpcr analysis for p53 mrna expression in Map2k7 fl/fl (fl) and Map2k7 ( ) mammary epithelial cells following doxorubicin treatment (Dox; 1 M). Data are shown as means ± s.e.m. (e) Mammary epithelial cells were 17
treated as in (b) in presence of the proteasome inhibitor MG132 (30 M) and p53 levels were monitored by Western Blot. (f) RT-PCR analysis of Mkk7 and p53 mrna levels in sizematched 3mm 3 mammary gland tumors from mice with the indicated genotype. n = 5 for each group. * P > 0.001 (Student s t-test). (g) Western blot analysis for phosphorylated (P) p38 and total p38 levels in NeuT-driven breast tumors. -actin is shown as loading control. 18
Supplementary Figure 14. Model of MKK7 during tumorigenesis. Model of tumor suppressive function by MKK7. Oncogenic stress activates the DNA damage response leading to MKK7-JNK mediated stabilization of p53 in early lesions. How MKK7 senses oncogenic stress and DNA damage needs to be further investigated (dashed arrows). 19
Supplementary Table 1. List of RT-PCR primers. β-actin forward primer 5 - GCTCATAGCTCTTCTCCAGGG -3 β-actin reverse primer 5 -CCTGAACCCTAAGGCCAACCG -3 MKK7 forward primer 5 TCCAGATCCCACCAAGCCTGACTATG -3 MKK7 reverse primer 5 AATGACTGGAAGTCCCCTGAGAAGCC -3 p53 forward primer 5 GTGTCACGCTTCTCCGAAGACT -3 p53 reverse primer 5 GCCCTGAAGTCATAAGACAGCA-3 p21 (Cdkn1a) forward 5 GTGGCCTTGTCGCTGTCTT -3 primer p21 (Cdkn1a) reverse 5 GCGCTTGGAGTGATAGAAATCTG -3 primer Puma forward primer 5 CCGCCTGATGCCCTCCGCTGTAT -3 Puma reverse primer 5 CGGGCCCACTCCTCCTCCTCCAC -3 Noxa forward primer 5 ACTTTGTCTCCAATCCTCCG -3 Noxa reverse primer 5 GTGCACCGGACATAACTGTG-3 Mdm2 forward primer 5 TTCGGCCTTCTCCTCGCTGTCGTC -3 Mdm2 reverse primer 5 TGGCGTAAGTGAGCATTCTGGTGA -3 Gadd45γ forward primer 5 GACTTTGGCGGACTCGTAGA -3 Gadd45γ reverse primer 5 ACTCTGGAAGAAGTCCGTGG -3 p27 forward primer 5 CGTGAACATGTTGTTGAGGC-3 p27 reverse primer 5 GCAGAAGAGCTGCTACGTGA-3 Supplementary Table 2. List of shrna sequences MKK7_Bamh1_Top gatccgcaaatcaagtggacaagaaattcaagagatttcttgtccacttgatttgcttttttacgcgtg MKK7_EcoR1_Bottom aattcacgcgtaaaaaagcaaatcaagtggacaagaaatctcttgaatttcttgtccacttgatttgcg