Expanded View Figures

Similar documents
Expanded View Figures

Expanded View Figures

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Appendix. Table of Contents

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1

Supplementary Materials for

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Supplemental Figure 1

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

SUPPLEMENTAL FIGURE LEGENDS

supplementary information

Supplementary Figures

Supplementary Materials for

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

SUPPLEMENTARY INFORMATION

USP26 regulates TGF-b signaling by deubiquitinating and stabilizing SMAD7

supplementary information

SUPPLEMENTARY INFORMATION

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

SUPPLEMENTARY INFORMATION

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Supplementary Information

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Color Key PCA. mir- 15a let-7c 106b let-7b let-7a 16 10b 99a 26a 20b 374b 19b 135b 125b a-5p 199b-5p 93 92b MES PN.

Supplemental Figure 1

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

SUPPLEMENTARY INFORMATION

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Materials

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Figure 1

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplemental Table S1

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure 1

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Materials

Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication

A post-translational modification switch controls coactivator function of histone methyltransferases G9a and GLP

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Tel: ; Fax: ;

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643

Supplemental Figure 1

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pre-made Reporter Lentivirus for NF-κB Signal Pathway

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!

SUPPLEMENTARY INFORMATION

A. Generation and characterization of Ras-expressing autophagycompetent

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Nature Methods: doi: /nmeth Supplementary Figure 1

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES AND TABLE

Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Supplementary Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Supplemental Information

SUPPLEMENTARY INFORMATION

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

SUPPLEMENTARY INFORMATION

Transcription:

Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained from U screen. 293T cells were transfected with -Luc and indicated U pools. orty-eight hours later, cells were treated with T-b for 16 h and a luciferase assay was performed. ata are mean S of triplicate samples. Table indicates relative luciferase value of each gene tested in (). Haat cells stably transduced with a hairpin targeting USP26 or vector control were stimulated with T-b for 3 h. PI1, KN1 (p21), T, LI, SM7, and USP26 mrn levels relative to PH or 18S are shown as evaluated by quantitative real-time PR. ata are mean S of triplicate samples. 293T cells were stably infected with two independent hairpins (L2 and L3) targeting USP26 and treated with T-b overnight. Whole-cell extracts were probed with the indicated antibodies. 293T cells were stably infected with three independent hairpins (L1, L2, and L3) targeting USP26. USP26 mrn levels relative to 18S are shown as evaluated by quantitative real-time PR. ata are mean S of triplicate samples. 293T cells transfected with sirn targeting USP26 or control vector were treated with T-b overnight. Whole-cell extracts were probed with the indicated antibodies. 293T cells expressing knockdown vectors targeting USP26 or control vector were treated with T-b overnight. Whole-cell extracts were probed with the indicated antibodies. ª 2017 The uthors MO reports V1

MO reports USP26 stabilizes SM7 Sarah Kit Leng Lui et al H igure V2. USP26 binds to and deubiquitinates SM7. 293T cells were transfected as indicated with P-USP26 and lag-tagged SM3 and SM7. fter 48 h, cells were lysed and immunoprecipitated with anti-lag affinity resin. Whole-cell extracts were probed with the indicated antibodies. 293T cells were transfected with P-USP26, and cells were lysed and immunoprecipitated with anti-p affinity resin. Whole-cell extracts were probed for SM3. 293T cells were transfected as indicated with P-USP26 and lag-tagged SM7. fter 48 h, cells were treated with T-b for 1 h and lysed. lag-tagged proteins were immunoprecipitated with anti-lag affinity resin and whole-cell extracts were probed with the indicated antibodies. 293T cells were transfected as indicated with P-USP26 and lag-tagged SM6. fter 48 h, cells were treated with T-b and lysed. lag-tagged proteins were immunoprecipitated with anti-lag affinity resin and whole-cell extracts were probed with the indicated antibodies. 293T cells transfected with L-SM7, P-USP26, control vector, and H-tagged ubiquitin. ollowing immunoprecipitation of SM7, lysates were resolved by SS P and probed with the indicated antibodies. ndogenous ubiquitination assay. 293T cells transfected with L-SM7, P-USP26, or control vector. ollowing immunoprecipitation of SM7, lysates were resolved by SS P and probed with the indicated antibodies. 293T cells were transfected as indicated with P-USP26, lag-tagged SM7, and Myc-tagged SMUR2. fter 48 h, cells were lysed and immunoprecipitated with anti-lag affinity resin overnight, eluted with anti-lag peptide, and re-immunoprecipitated with anti-myc affinity resin. Whole-cell extracts were probed with the indicated antibodies. H 293T cells were transfected as indicated with P-USP26, H-tagged SM7, and Myc-tagged SMUR1. fter 48 h, cells were lysed and immunoprecipitated with anti-lag affinity resin overnight, cleaved with an anti-lag peptide, and re-immunoprecipitated with anti-myc affinity resin. Whole-cell extracts were probed with the indicated antibodies. V2 MO reports ª 2017 The uthors

Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports igure V3. Regulation of the T-b by USP26 in breast cancer and M cell lines. M7 cells transfected with sirn targeting USP26 or control vector were treated with T-b overnight. Whole-cell extracts were probed with the indicated antibodies (top panel). orresponding USP26 mrn levels relative to 18S are shown as evaluated by quantitative real-time PR (bottom panel). ata are mean S of triplicate samples. M-M-231 (), U373 (), and PT () cells stably expressing lentiviral knockdown vectors targeting USP26 or control vector were treated with T-b overnight. Whole-cell extracts were probed with the indicated antibodies (top panel). orresponding USP26 mrn levels relative to 18S are shown as evaluated by quantitative real-time PR (bottom panel). ata are mean S of triplicate samples. PT cells stably transduced with a hairpin targeting USP26 or vector control were stimulated with T-b for 3 h. T, LI, and SM7 mrn levels relative to 18S are shown as evaluated by quantitative real-time PR. ata are mean S of triplicate samples. M-M-231 cells stably expressing lentiviral knockdown vectors targeting USP26 or control vector were treated with transfected with L-SM7 (1 lg). Wholecell extracts were probed with the indicated antibodies. * denotes background band. U373 cells stably expressing lentiviral knockdown vectors targeting USP26 or control vector were treated with transfected with L-SM7 (1 lg). Whole-cell extracts were probed with the indicated antibodies. * denotes background band. ª 2017 The uthors MO reports V3

MO reports USP26 stabilizes SM7 Sarah Kit Leng Lui et al igure V4. xpression of SM7 and USP26 following T-b induction in breast cancer and M cell lines. The breast cancer cell lines M7 (), M-M-231 (), T47 (), and L51 () were stimulated with T-b for 1 and 3 h. USP26 mrn (left panel) and SM7 (right panel) levels relative to 18S are shown as evaluated by quantitative real-time PR. ata are mean S of triplicate samples. The glioblastoma cancer cell lines U373 (), PT (), and 172 () were stimulated with T-b for 1 and 3 h. USP26 mrn (left panel) and SM7 (right panel) levels relative to 18S are shown as evaluated by quantitative real-time PR. ata are mean S of triplicate samples. V4 MO reports ª 2017 The uthors

Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports igure V5. orrelation of T-b pathway components with overall survival in M. Validation of the USP26 antibody for immunohistochemistry. 293T cells stably infected with knockdown vectors targeting USP26 were analyzed by immunohistochemistry for USP26 expression. Representative images are shown. To prepare sections, cell pellets were fixed in formalin and embedded in paraffin. Red staining indicates positive immunoreactivity. Scale bars: 50 lm. Kaplan Meier curves of glioblastoma patients (n = 329) with TRI (), TRII (), TRIII (), and SM7 () (RMRNT). P-value was obtained by log-rank test. ª 2017 The uthors MO reports V5