Supplementary Materials for

Similar documents
pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis

Supplemental Material:

Supplementary Materials

Na/K-ATPase amplification of oxidant stress; a universal but unrecognized clinical target?

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

SUPPLEMENTARY INFORMATION

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Materials for

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Jung Han Kim, PhD Project 1 Project 2

2.5. AMPK activity

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Materials for

Supplementary Information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

ab Adipogenesis Assay Kit (Cell-Based)

Supplementary Materials for

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Attenuation of Na/K-ATPase Mediated Oxidant Amplification with pnaktide Ameliorates Experimental Uremic Cardiomyopathy

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Materials for

DEGREE (if applicable) BA MD

SUPPLEMENTAL MATERIAL. Supplementary Methods

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Expanded View Figures

Supplementary Figure 1

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Supplementary Information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplemental Materials

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure S1 Supplementary Figure S2

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Materials for

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supporting Information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Supplementary Figure 1

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Figure 1.

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Supplementary Figure 1

LPS LPS P6 - + Supplementary Fig. 1.

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Supplemental Information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Materials for

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids

Lipid (Oil Red O) staining Kit

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Material for

TRPM8 in the negative regulation of TNFα expression during cold stress

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its

Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Transcription:

advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell, Yanling Yan, Jiang Liu, Muhammad A. Chaudhry, Morghan Getty, Zijian Xie, Nader G. Abraham, Joseph I. Shapiro The PDF file includes: Published 16 October 2015, Sci. Adv. 1, e1500781 (2015) DOI: 10.1126/sciadv.1500781 Fig. S1. pnaktide distribution in 3T3L1 cells and adipose tissue. Fig. S2. pnaktide decreased large lipid droplets and oxidative stress and increased small lipid droplets in 3T3L1 adipocytes. Fig. S3. pnaktide decreased lipid accumulation and adipogenic markers in 3T3L1 adipocytes exposed to fructose. Fig. S4. pnaktide decreased lipid accumulation and adipogenic markers in 3T3L1 adipocytes exposed to glucose oxidase. Fig. S5. pnaktide decreased carbonylation and phosphorylation of Src and ERK in 3T3L1 adipocytes exposed to glucose oxidase.

RESULTS Figure S1: pnaktide distribution in 3T3L1 cells and adipose tissue. Figure S1: (A) rhodamine-labeled pnaktide was added to the culture medium as described in the method section. The drug was efficiently distributed in 3T3L1 cells and the maximum distribution was seen after 2 hours of incubation (n=4). (B) To study whether pnaktide was distributed in adipose tissue by IP injections, rhodamine-labeled

pnaktide was injected in mice. The rhodamine-labeled pnaktide was efficiently distributed in adipose tissue (n=4). Figure S2: pnaktide decreased large lipid droplets and oxidative stress and increased small lipid droplets in 3T3L1 adipocytes: In order to examine the effect of pnaktide on lipid droplets size, superoxide levels and cell toxicity 3T3L1 cells were exposed to different concentrations of pnaktide for 7 days. (A) Number of small lipid droplets from Oil Red O stained 3T3L3 cells with increasing

concentrations (0.1, 0.3, 0.5, 0.7, 1, 2, and 4 μm) of pnaktide, magnifications: 40x (n=6); (B) number of large lipid droplets from Oil Red O stained 3T3L1 cells with increasing concentrations of pnaktide, magnifications: 40x (n=6). *, p < 0.05 vs. control. (C) Superoxide measurement (marker of oxidative stress) in 3T3L1 adipocytes. * p <0.05 vs CTR. (D) MTT assay to study the cytotoxicity at increasing concentrations of pnaktide. The pnaktide treatment had no cytotoxic effects at concentrations up to 4 μm. Results are means ± SEM of six independent treatments. Figure S3: pnaktide decreased lipid accumulation and adipogenic markers in 3T3L1 adipocytes exposed to fructose treatment:

0.7 M of pnaktide was determined to be the optimal concentration for inhibiting adipogenesis in 3T3L1 cells. Therefore 3T3L1 cells were treated with fructose, a potent inducer of oxidative stress (500 M concentration) with and without pnaktide (0.7 M) every day for 7 days. (A) Effect of pnaktide on adipogenesis in mouse 3T3L1 cells. Adipogenesis was measured as the relative absorbance of Oil Red O at day 7 after inducing adipogenesis as described in the materials and methods section. * p<0.05 vs. control, # p<0.05 vs. Fr. (B) Western blot and densitometry analysis of FAS levels. Data are shown as mean band density normalized to β-actin, Results are means ± SE, n=6, * p<0.05 vs. control, # p<0.05 vs. Fr. (C) Western blot and densitometry analysis of MEST levels. Data are shown as mean band density normalized to β-actin, Results are means ± SE, n=6, * p<0.05 vs. control, # p<0.05 vs. Fr.

Figure S4: pnaktide decreased lipid accumulation and adipogenic markers in 3T3L1 adipocytes exposed to glucose oxidase treatment: To further confirm our hypothesis that pnaktide decreases oxidative stress, 3T3L1 cells were treated with glucose oxidase, another known inducer of oxidative stress (3 mu/l concentration as determined by concentration curve (data not shown)) with and without pnaktide (0.7 M) every day for 7 days. (A) Effect of pnaktide on adipogenesis in mouse 3T3L1 cells. Adipogenesis was measured as the relative absorbance of Oil Red O at day 7 after inducing adipogenesis as described in the materials and methods section. * p<0.05 vs. control, # p<0.05 vs. GO. (B) Western blot and densitometry analysis of FAS levels. Data are shown as mean band density normalized to β-actin,

Results are means ± SE, n=6, *p<0.05 vs. control, # p<0.05 vs. GO. (C) Western blot and densitometry analysis of MEST level. Data are shown as mean band density normalized to β-actin, Results are means ± SE, n=6, *p<0.05 vs. control, # p<0.05 vs. GO. Figure S5: pnaktide decreased carbonylation and phosphorylation of Src and ERK in 3T3L1 adipocytes exposed to glucose oxidase treatment:

Whole cell lysates were prepared with Nonidet P-40 buffer and western blot analysis was performed to determine protein carbonylation (A), activation of c-src (B) and activation of ERK1/2 (C). MM, maintenance medium; AM, adipogenic medium; GO, glucose oxidase. Results were expressed as Means ± SD, N=4-6/group, # p<0.05 vs. MM, ** p<0.01 vs. MM, $ p 0.01 vs. AM and AM+GO, & p<0.01 vs. AM.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback