Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Similar documents
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

SUPPLEMENTARY INFORMATION

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Zhu et al, page 1. Supplementary Figures

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus

Supplementary Table 1. List of primers used in this study

Supplementary Information

SUPPLEMENTARY INFORMATION

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

SUPPLEMENTARY INFORMATION

Supplemental Information. Figures. Figure S1

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

Supplemental Information. Ciliary Beating Compartmentalizes. Cerebrospinal Fluid Flow in the Brain. and Regulates Ventricular Development

* * A3027. A4623 e A3507 A3507 A3507

Supplementary Information

Supplementary Information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

AP VP DLP H&E. p-akt DLP

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY LEGENDS...

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Expanded View Figures

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

SOM Husse et al. Supplementary online material. Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Conditional and reversible disruption of essential herpesvirus protein functions

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

McWilliams et al., http :// /cgi /content /full /jcb /DC1

Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. c Human

SUPPLEMENTARY INFORMATION

Balancing intestinal and systemic inflammation through cell type-specific expression of

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

SUPPLEMENTARY INFORMATION

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation

SUPPLEMENTARY INFORMATION

Supplemental Material for. Figure S1. Identification of TetR responsive promoters in F. novicida and E. coli.

Supplementary Figures

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

Nature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years.

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Received 26 January 1996/Returned for modification 28 February 1996/Accepted 15 March 1996

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Supplementary Figure 1

100 mm Sucrose. +Berberine +Quinine

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic

Cellular components of CNS

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Supplementary Figure 1

Supplementary Materials and Methods

Supplementary Materials for

Supplemental Figure 1

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplementary Information Titles Journal: Nature Medicine

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation.

Transcription:

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI, Jason LABEAU, Donatienne TYTECA, Pierre COURTOY, Yves POUMAY, Tadashi UEMURA, Andre M. GOFFINET Supplementary figures: Supplementary Fig. 1: Targeted insertion of LacZ into Celsr2 locus. (a) Celsr2 has 34 exons (rectangles); arrows 1-9 indicate positions of primers used in RT-PCR (see Supplementary Table S1). (b) The IRES-LacZ-Neo cassette was inserted in exon 23 downstream from nucleotide 7102 (Genbank 114050894). (c) Western blot analysis of brain extracts from wild type, heterozygous, and homozygous brain. Celsr2 (top) was present in wild type and heterozygotes, and replaced by beta galactosidase (bottom) in mutant mice.

Supplementary Fig. 2: The subcommissural organ (SCO) develops normally in Celsr2 mutant mice. (a) Nissl stained coronal section at the level of the SCO at P10. (b,c) Sco-spondin immunofluorescence shows that the SCO synthesizes the glycoprotein SCO-spondin, which aggregates and forms the Reissner s fiber (arrowheads). V3: third ventricle. Scale bar : 100 µm.

Supplementary Fig. 3: Choroid plexus displays normal cilia in Celsr2 and Celsr2+3 mutant mice. Immunofluorescence for acetylated alpha tubulin reveals mono and grouped cilia on epithelial cells in choroid plexus. No difference was observed between WT (a), Celsr2 (b), and Celsr2+3 (c). Nuclei are counterstained with DAPI. Scale bar: 10 µm.

Supplementary Fig. 4: Ependymal cells differentiate normally in Celsr2 and Celsr2+3 mutant mice. (a f ): Immunofluorescence for S100 (a b ), CD24 (c d ) and vimentin (e f ) show that ependymal cell lining lateral ventricles differentiate in similar ways in WT (a,b,c,d,e,f), Celsr2 (a,b,c,d,e,f ), and Celsr2+3 (a,b,c,d,e,f ) mutant mice. (g h ): Coronal sections of mature brain stained for Doublecortin (g g ) and GFAP (h-h ). The number of Doublecortin and GFAP positive cells is increased in the subependymal layer of Celsr2 (g,h ) and Celsr2+3 (g,h ) as compared to WT (g, h) mice. (i k ): Immature neurons, stained for doublecortin (DCX). Compared to WT (i,j,k), the number of DCX positive cells is increased in the subependymal niche of Celsr2 (i,j,k ) and Celsr2+3 (i,j,k ) mutant mice. Scale bar: 50 µm in (c c, e e, and i i ), 100 µm for other panels

Supplementary Fig. 5: Ependymal cilia have normal ultrastructure. TEM micrographs of cross sections of cilia from the WT (a), Celsr2-/- (b) and Celsr2+3 (c). Mutant cilia have the typical (9+2) structure of motile cilia. Scale bar: 100 nm

Supplementary Fig. 6: Normal distribution of Z0 1. (a c) immunofluorescence showing that the subcellular localisation of ZO 1 is preserved in Celsr2 (b) and Celsr2+3 (c) mutant ependyma. The Z sections (rows 2) are at the level of red lines in horizontal sections (rows 1). Scale bar: 5 µm

Supplementary Movies 1 4: Cilia beat exhibits two types of movements in the WT tissue, namely seaweed (movie 1) and pigeon neck (movie 2), and both are preserved in Celsr2 deficient tissue ( seaweed, movie 3; pigeon neck, movie 4). Images were acquired at 200 frames/s. The playback rate of each the movie is 50 frames/sec, and each movie is made of 150 frames. Supplementary Movie 5: Movement of latex beads in lateral ventricle of WT and Celsr2 mutant tissue. In contrast to WT where beads move from the caudal to rostral pole, there is no significant displacement of beads in the mutant. Images were acquired using a standard video camera, at 25

Supplementary Table 1: RT-PCR analysis of the Celsr2 recombinant mrna Primers Targeted region Amplification of the mutant cdna 1: 5'-CGAACCTCTGGCTCTACACC-3' 188-903 + 2: 5'-GTTCTCCCTGAGGCTCTCCT-3' 3: 5'-CCAGAACGCTTTCTCTCACC-3' 3412-4252 + 4: 5'-CCACAAAGTCGTGCTTCTCA-3' 5: 5'-TCATCTCTGTAGTGCGCCTG-3' 6503-6647 + 6: 5 -ACCATGGAGGGCATCTCTCT-3 5: 5'-TCATCTCTGTAGTGCGCCTG-3' 6503-6961 + 7: 5 -AGACACAGATGGGCTTGGTC-3 5: 5'-TCATCTCTGTAGTGCGCCTG-3' 6503-7041 + 8: 5 -GCTCTCGTTACGGAAGACGAC-3 5: 5'-TCATCTCTGTAGTGCGCCTG-3' 6503-7309 _ 9: 5'-AAGGGAGGTCAGCCTGGTTG-3' 5: 5'-TCATCTCTGTAGTGCGCCTG-3' 10: 5'-CCTTATTCCAAGCGGCTTCG-3' Junction Celsr2-IRES- LacZ Neo. + cdna from Celsr2-/- was used as template to amplify fragments at different positions of Celsr2 transcript. Whereas all primer pairs located downstream of nucleotide 7071 yielded positive bands, primers flanking, or upstream of nucleotide 7071 failed to amplify any sequence. The reverse primer 10 from the IRES sequence was used together with the forward primer 6 to clone and characterize the insertion site. The sequence of the junction between Celsr2 and the cassette IRES-LacZ-Neo is provided below. Supplementary Table 2: Comparison of bead track orientation using circular statistics, Watson s U 2 test Genotypes P value WT versus Celsr2 < 0.001 WT versus Celsr2+3 < 0.001 Celsr2 versus Celsr2+3 < 0.02

Supplementary data: Partial sequence of mutant Celsr2-LacZ-Neo cdna: GTCAGTGGCACTGGCGGCTGGTCCGCCCGAGGCTGCGAAGTCGTCTTCCGTAACGAGAGCCACGTCAGC TGCCAGTGCAACCATATGACAAGCTTTGCTGTGCTTATGGATATGTCACGACGAGAGCTCGCGGTTGAG GACAAACTCAAGCTTCCCGGGCTGCAGCCAAGCTATCGAATTCCGCCCCCCCCCTCTCCCTCCCCCCCC CCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGG Underlined: exon 22 Bold: splice acceptor of exon 23 Italic: start of the IRES-LacZ-Neo sequence

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback