Supplementary Materials for

Similar documents
Boucher et al NCOMMS B

Supplementary Materials for

Supplementary Materials for

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Materials for

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES

Supplemental Table 1. Primer sequences for transcript analysis

Supplementary Materials for

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Nature Immunology: doi: /ni eee Supplementary Figure 1

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Fig. S1. Schematic diagram of minigenome segments.

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

SUPPLEMENTARY INFORMATION

Supplementary Materials for

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supplementary Materials for

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

SUPPLEMENTARY INFORMATION

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Supplemental Figures:

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

SUPPLEMENTARY FIGURES AND TABLE

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplemental information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module

Supplementary Materials for

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Target Protein Antibody name Product number Manufacturer Species Epitope Dilution Aggrecan Anti-aggrecan AB1031 EMD Millipore Corp Rabbit

Expanded View Figures

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins

Supplementary Materials for

Supplementary. limb. bars

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplemental Material

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Supplementary Materials for

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

Nature Structural & Molecular Biology: doi: /nsmb.3218

Supplementary Figure 1

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

SUPPLEMENTARY INFORMATION

Quantitative PPARγ expression affects the balance between tolerance and immunity

Supplementary Materials for

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Supplementary Material

Supplementary Materials for

Supplemental Material:

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Project report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:

Supplemental Figure 1

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

SUPPLEMENTARY INFORMATION

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

SUPPLEMENTARY FIGURES AND TABLES

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Materials for

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Supplementary Materials for

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Supplementary Information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Transcription:

www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis Nathan Beckouche, Marine Bignon, Virginie Lelarge, Thomas Mathivet, Cathy Pichol-Thievend, Sarah Berndt, Julie Hardouin, Marion Garand, Corinne Ardidie-Robouant, Alain Barret, Gerry Melino, Hugues Lortat-Jacob, Laurent Muller, Catherine Monnot,* Stephane Germain The PDF file includes: *Corresponding author. E-mail: catherine.monnot@college-de-france.fr Published 14 July 2015, Sci. Signal. 8, ra70 (2015) DOI: 10.1126/scisignal.aaa0963 Fig. S1. Analysis of retinas and aortas from tg2 +/+ and tg2 / mice. Fig. S2. TG2 accumulation in ECM and TG2 silencing in endothelial cells. Fig. S3. Proliferation, β 1 integrin mediated sprouting, and fibronectin abundance and deposition in TG2-silenced endothelial cells. Fig. S4. VEGFR2 internalization in response to VEGF 165. Fig. S5. TG2 silencing does not affect VEGF 121 -induced signaling. Fig. S6. HS content and deposition. Fig. S7. Reexpression of wild-type and mutant TG2 in TG2-silenced endothelial cells.

Fig. S1. Analysis of retinas and aortas from tg2 +/+ and tg2 -/- mice. (A) Confocal images of retina stained with isolectin-b4 from P7 mice. The confocal images are representative of 22 tg2 +/+ - and 20 tg2 -/- -retinas analyzed in 3 independent experiments. Vascular area was quantified for tg2 +/+ or tg2 -/-. Graphs represent the mean values ± SD (N=3 independent experiments, 20 to 22 retinas analyzed, Mann-Whitney U test). NS: no significant difference. (B) TG2 expression in mouse aorta. TG2 was detected by immunofluorescence in aortic sections of 9-weeks tg2 +/+ and tg2 -/- littermates. Elastic fibers were detected by autofluorescence (A: Adventitia; M: Media; E: Endothelium). The images are representative of 3 slices obtained from 2 tg2 +/+ - or tg2 -/- -aortas. Scale bar, 25 µm. 1

Fig. S2. TG2 accumulation in ECM and TG2 silencing in endothelial cells. (A) TG2 accumulation in ECM generated by HUVECs that were co-cultured with NHDFs. The confocal images are representative of 6 images obtained from 2 independent experiments. TG2 deposition in the ECM was analyzed by immunofluorescence of cells co-cultured without (-) or with (+) NHDFs for 3 days. Arrows indicate extracellular TG2 in the ECM. Nuclei were stained with DAPI. Scale bar, 20 µm. (B) TG2 abundance in control (shct) or TG2-silenced (shtg2) HUVECs. TG2 silencing was analyzed by immunofluorescence (upper) and immunoblot (lower) of cell lysate of cells grown for 5 days. Actin was used as a loading control. The confocal images and immunoblots are representative of 20 or more technical replicates obtained from 10 or more independent experiments. Scale bar, 20 µm. 2

Fig. S3. Proliferation, 1 integrin-mediated sprouting, and fibronectin abundance and deposition in TG2-silenced endothelial cells. (A) Number of nuclei was quantified in sprouts from HUVECs in fibrin gels containing increasing concentrations of VEGF 165 and calculated as percentage of values from 5 ng/ml VEGF 165. Graph represents the mean of values ± SEM (N=2 independent experiments, 24 to 48 sprouts analyzed, Mann-Whitney U test). (B) 1 integrindependent sprouting. Control (shct) or TG2-silenced (shtg2) HUVECs seeded on Cytodex beads were cultured with either 10 µg/ml control IgM (Control IgM) or 10 µg/ml 1 integrin blocking antibody (Beta1 blocking Ab). Mean of total length of sprouts per bead was normalized 3

to the mean of shct treated with control IgM. Graph represents the mean of normalized values ± SEM. The fold values (x2 and x2.1) represent the ratio between control IgM and 1 blocking Ab conditions for shct and shtg2, respectively (N=4 independent experiments, 71 to 97 sprouts analysed, Mann-Whitney U test). (C) Fibronectin protein was detected by immunoblot in total lysates of shct and shtg2 HUVECs cultured for 4 days (top panel). Actin was used as a control (bottom panel). Immunoblot was representative of 3 independent experiments. Relative amount is the ratio of fibronectin on actin normalized to the maximal ratio. Graphs represent the mean of values ± SEM (N=3 independent experiments, Mann-Whitney U test). NS: no significant difference. (D) Fibronectin deposition was analyzed by immunofluorescence on cells cultured in 2D. Nuclei were stained with DAPI. The confocal images are representative of 4 technical replicates obtained from 5 independent experiments. Scale bar, 20 µm. (E) Fibronectin deposition was analyzed by immunofluorescence performed on aortic ring sprouts from tg2 +/+ and tg2 -/- mice. Endothelial cells were stained with isolectin-b4. The images are representative of 2 to 4 technical replicates obtained from 5 tg2 +/+ - or tg2 -/- -rings. Scale bar, 100 µm. 4

Fig. S4. VEGFR2 internalization in response to VEGF 165. Confocal images showing colocalization of VEGFR2 (green) and EEA1 (red) in endosomes in control (shct) and TG2- silenced (shtg2) HUVECs after 5 minutes stimulation with 50 ng/ml VEGF 165 (N=3 independent experiments, 141 to 164 cells analyzed, Student s t-test).). NS: no significant difference. Scale bar, 20 µm. 5

Fig. S5. TG2 silencing does not affect VEGF 121 -induced signaling. Relative phosphorylation is the ratio of phosphorylated to total protein. Ratios were normalized by calculating them as percentages of the maximal ratio. Graphs represent the mean of values ± SEM. (A) Phosphorylation of VEGFR2 at Tyr 951, Src and Akt. (B) Phosphorylation of VEGFR2 at Tyr 1175 and ERK1/2 (N=4 independent experiments, Welch s t-test). 6

Fig. S6. HS content and deposition. (A) Quantification of total sulfated glycosaminoglycans in control (shct) and TG2-silenced (shtg2) HUVECs (N=4 independent experiments, Mann- Whitney U test). NS: no significant difference. (B) Nontreated (-) and heparitinase digested (+) HSPGs from total cell lysates of control and TG2-silenced cells grown for 5 days and analyzed by immunoblotting with 10E4 and 3G10 antibodies. 10E4 recognizes an epitope including N- sulfated glucosamine residues present in many human HS chains. 3G10 recognizes human HS neo-epitope, namely desaturated hexuronate present at the non-reducing end of HSPGs after heparitinase digestion. Immunoblots are representative of 3 independent experiments. (C) Deposition of perlecan and TG2 (TG2) and colocalization (merge) or deposition of HS-bearing components (HS) were analyzed by immunofluorescence in control and TG2-silenced cells grown for 4 days. Nuclei were stained with DAPI. The confocal images are representative of 3 independent experiments. Scale bar, 20 µm. 7

Fig. S7. Re-expression of wild-type and mutant TG2 in TG2-silenced endothelial cells. Control (shct) and TG2-silenced (shtg2) HUVECs were shown as controls. Re-expression of wild-type TG2 (TG2) or forms of TG2 with mutations in the heparan sulfate (HS) binding site (TG2 R262S, TG2 R263S, TG2 K265S ) or the catalytic site (TG2 C277S ) in shtg2 HUVECs was analyzed by immunofluorescence. Nuclei were stained with Dapi. The confocal images are representative of 3 independent experiments. Scale bar, 20 µm. 8