Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Similar documents
Rapid Laboratories In House Tests

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Clinician Blood Panel Results

Clinician Blood Panel Results

Research Data Available

BASIC METABOLIC PANEL

NORMAL LABORATORY VALUES FOR CHILDREN

BC Biomedical Laboratories Adult Reference Ranges

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Specimen Collection Requirements

Specimen Collection Requirements

NEW RCPCH REFERENCE RANGES-

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Hamilton Regional Laboratory Medicine Program

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Hamilton Regional Laboratory Medicine Program

Supplementary materials

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

Complete Medical History

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Clinician Blood Panel Results

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

ENROLLMENT CONFIRMATION

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

ADPedKD: detailed description of data which will be collected in this registry

Kathryn Jones 8/11/2015

10 Essential Blood Tests PART 1

Get to know yourself better. Attend our health screening event.

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

What Does My Blood Test Mean

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES

Get to know yourself better. Attend our health screening event.

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

Online catalog

Results Report. Welcome to Your ABT Report!

Fullerton Healthcare Screening Centres

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Documentation Dissection

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

Blood Test Results Report

What if you could help your team realise their health goals?

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

ACCREDITATION DOCUMENT

Tables of Normal Values (As of February 2005)

Inspector's Accreditation Unit Activity Menu

* * Interpretation

H.6.G.2 Non-MAC Studies

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1

CTAD as a universal anticoagulant

Questionnaire. Traceability in EQA. Traceability

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

VITROS MicroSlide Assay Summary

COMPANY OR UNIVERSITY

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

e-figure 1. The design of the study.

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Routine Clinic Lab Studies

The Blood Chemistry Panel Explained

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Delta Check Calculation Guide

FBC interpretation. Dr. Gergely Varga

The Complete Blood Count

Occupation Agency Code Work Location Work Supervisor Duty tel. #

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

Multiphasic Blood Analysis

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Senior Executive Wellness Profile

Serodos and Serodos plus

i. Where is the participant seen?

LABORATORY SERVICES - PETS

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

GRADING CRITERIA for CMS Regulated Analytes

CASE-BASED SMALL GROUP DISCUSSION MHD II

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

Transcription:

Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln

Human Tolerance of Low Molecular Weight Polyethylene Markers page. Composition of the marker The marker is administered as a soft gel with 50 mg each of two monodisperse low molecular weight polyethylene glycols of 8 (mw = 58) and 0 (mw = 8) repeating units, 0,0 g dye brilliant blue and Capmul MCM and Polysorbate 80 as an excipient for a total quantity of 00 mg/soft gel. The soft gel capsule is composed of gelatin. The marker is swallowed under supervision.. Participants of the study The study took place between April th 0 and May 6 th 0 with participants initially. Two participants had to be expelled from the study because they had acquired a severe virus infection while the study was on going. This infection was not related to the intake of marker soft gels. Every participant was asked to give the following information. Data is summarized in Table. Date of birth Name Surname Gender Height Weight Smoker (yes / no, if yes how many cigarettes) Alcohol consumption Known allergies Blood pressure (measured on day and end of the study) Pregnancy (yes / no) Number and age of children Acute diseases present and in the past Chronic diseases present and in the past Medication Known reaction to drugs Known reaction to polyethylene glycols

Human Tolerance of Low Molecular Weight Polyethylene Markers page Table : Participant Information Participant Participant Participant Participant Participant 5 Date of Birth.0.70 0.05.58.0.6..50 7.0.67 Blood pressure 0 / 85 0/85 0 / 85 0 / 85 0/95 Gender Male Female Male Male Female Pregnancy Height 85 cm 80 cm 87 cm 98 cm 67 cm Weight 0 kg 68 kg 90 kg 08 kg 97 kg 0 cigarettes/ 5 cigarettes/ Smoker day day Alcohol consumption Rare Rare Rare Rare Allergy Children Acute diseases/ Surgery Chronic diseases ne 980 996 98 99 986 995 995 999 Appendectomy, 00 Surgical removal of gall stones, 00 High blood pressure Lung emboli, 0 High blood pressure Medication Amipril, 5 mg Micardis, 80 mg Known reaction to drugs Known reaction to Polyethylene glycol Macrolide antibiotics 0 cigarettes/ day

Human Tolerance of Low Molecular Weight Polyethylene Markers page Participant 6 Participant 7 Participant 8 Participant 9 Participant 0 Date of Birth 0.08.75 7.0.65 0.08.50.05.58.0.8 Blood pressure 00/70 60/00 0 / 85 0/80 0/85 Gender Female Female Female Male Female Pregnancy Height 68 cm 70 cm 68 cm 7 cm 68 cm Weight 7 kg 70 kg 80,5 kg 7 kg 7 kg 0 cigarettes / 5 cigarettes / Smoker day day Alcohol consumption Rare Rare Allergy Latex Fruit, Hay fever Penicillin, Nickel 007 998 987 0 005 00 Children Acute diseases/ Surgery Chronic diseases Medication Known reaction to drugs Known reaction to Polyethylene glycol C-Section, 005 Streptococcus myocarditis, 99 Knee TEP, 0 C-Section, 007 C-Section, 987 High blood pressure Micardis, 80 mg Amiodipin, 5mg Cymbalta, Iron, Vitamin D

Human Tolerance of Low Molecular Weight Polyethylene Markers page 5. Operational and Organizational structure Participants were given soft gel each on the following dates (7 soft gels in total):. th of April 0. th of April 0. 8 th of April 0. 5 th of April 0 5. nd of May 0 6. 9 th of May 0 7. 6 th of May 0 Participants were not asked to be sober when blood was collected. Blood samples were drawn after administering the soft gels on the same day on the following dates ( blood collections in total):. th of April 0. 8 th of April 0. nd of May 0. 6 th of May 0 Blood samples were investigated for the following analytes: Heparin plasma o Sodium (=Na) o Potassium (=K) o Glucose (=GLU) o Urea (UREA) o Creatinine (=CREA) o Total protein (=TP o Bilirubin (=BIL) o LDH (LDH) o AST (AST) o ALT (AST) o γ-gt (=GGT) o Alkaline phosphatase (=AP) o HDL (HDL) o Triglycerides (=TRI) o Cholesterol (=CHOL) o C-reactive protein (=CRP) EDTA blood: o Full blood count incl. differentiation of leucocytes

Human Tolerance of Low Molecular Weight Polyethylene Markers page 6. Results.. Clinical signs of side reactions to marker soft gels There was no side reaction like nausea, allergic reactions, increase of blood pressure etc. observed in the course of the study... Laboratory investigations There was no significant change of laboratory parameters observed in this study that could be directed to a side reaction to the marker soft gel. Data are summarized in table table.

Human Tolerance of Low Molecular Weight Polyethylene Markers page 7 Table : Laboratory data of participant WBC.5-9.8 / nl 7.9 8.9 9. 9. Ery.7 -.8 / pl 5. 5. 5. 5. Hemoglobin. -.5 g / dl 5.7 5. 5. 5. Hematocrit - % 5. 5.. 6. MCV 8. - 99.8 fl 88.0 88.0 88.0 9.0 MCH 7. - pg 0.6 0.0 0.0 9.8 MCHC.8 -.9 g / dl.8...7 Platelets 0-60 / nl 0.0.0 7.0 0.0 Basophilic <.5 % 0.6 0.7. 0.9 Eosinophilic 0. - 6.6 %.. 5.8 5. Neutrophilic - 7.8 % 65.6 6.9 58.8 6. Lympho 6. - 5 %.6.9 5.6. Mono.6-8. % 5.5 6.0 6.5 7. Large unstained cells <.5 %.5...5 AP 55-05 U / l 96 9 9 86 BIL 0. -. mg / dl 0.59 0.5 0.5 0.7 CHOL <90 mg / dl 6 9 7 CRP <.0 mg / l.6 5.9 6.6 6. TP 6.6-8. g / dl 7.6 7.7 7.7 7. GGT <0 U / l 7 60 65 59 GLU 60-99 mg / dl 87 99 0 00 AST <5 U / l ALT <5 U / l 5 HDL >0 mg / dl 5.7 8. 58. 55. UREA 5-0 mg / dl 9.7 8 8.6 0.7 K.6 -.8 mg / dl.77.7..59 CREA 0.8-0.95 mg / dl 0.75 0.8 0.7 0.76 LDH <50 U / l 7 88 88 7 NA 5-5 mg / dl 8 8 0 TRI <50 mg / dl 0 85 06

Human Tolerance of Low Molecular Weight Polyethylene Markers page 8 Table : Laboratory data of participant WBC.5-9.8 / nl 9..9. 0.7 Ery.7 -.8 / pl.6.7..6 Hemoglobin. -.5 g / dl.7..7. Hematocrit - %. 0.0 8.. MCV 8. - 99.8 Fl 89.0 86.0 89.0 89.0 MCH 7. - Pg 9.7 8.6 9.7 8.7 MCHC.8 -.9 g / dl.... Platelets 0-60 / nl 5.0 7.0 5.0.0 Basophilic <.5 % 0.6 0.6 0.6 0.7 Eosinophilic 0. - 6.6 %.7...0 Neutrophilic - 7.8 % 57. 57.9 58.6 55. Lympho 6. - 5 %.9.8.6. Mono.6-8. % 6.9 7.0 6. 6.0 Large unstained cells <.5 %.6..9.7 AP 55-05 U / l 96 87 9 9 BIL 0. -. mg / dl 0.6 0. 0.5 0.7 CHOL <90 mg / dl 76 8 60 69 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7. 7.6 7 7.6 GGT <0 U / l 0 0 GLU 60-99 mg / dl 6 8 8 6 AST <5 U / l 0 ALT <5 U / l 6 6 HDL >0 mg / dl 67. 6 66.5 65.9 UREA 5 0 mg / dl 0.5 5.8 6.8 6. K.6 -.8 mg / dl.0.5.8.8 CREA 0.8-0.95 mg / dl 0.76 0.7 0.78 0.77 LDH <50 U / l 65 75 7 69 NA 5-5 mg / dl 9 TRI <50 mg / dl 6 09 9 58

Human Tolerance of Low Molecular Weight Polyethylene Markers page 9 Table : Laboratory data of participant WBC.5-9.8 / nl 6. 6.0 7.8 7.0 Ery.7 -.8 / pl..0.. Hemoglobin. -.5 g / dl....8 Hematocrit - % 0. 7.8 8.6 0.7 MCV 8. - 99.8 fl 98.0 9.0 9.0 95.0 MCH 7. - pg...0. MCHC.8 -.9 g / dl. 5...9 Platelets 0-60 / nl 96.0 87.0 0.0 80.0 Basophilic <.5 % 0.7 0.9 0.9 0.8 Eosinophilic 0. - 6.6 %.9.6.9. Neutrophilic - 7.8 % 6. 6. 6. 7. Lympho 6. - 5 % 7.6 8. 8.6 0.5 Mono.6-8. %..9.5. Large unstained cells <.5 %. 0.9.0 0.9 AP 55-05 U / l 9 8 7 BIL 0. -. mg / dl 0.99.9.57.56 CHOL <90 mg / dl 77 79 76 80 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7. 7. 7. 6.9 GGT <0 U / l 0 0 0 GLU 60-99 mg / dl 8 9 9 9 AST <5 U / l 5 6 7 ALT <5 U / l 6 6 6 8 HDL >0 mg / dl 6. 6.6 66.7 66 UREA 5-0 mg / dl 8.6 0.. 5. K.6 -.8 mg / dl.5.6.05.05 CREA 0.8-0.95 mg / dl 0.7 0.86 0.7 0.7 LDH <50 U / l 55 79 9 66 NA 5-5 mg / dl 7 8 9 0 TRI <50 mg / dl 65 6 68 68

Human Tolerance of Low Molecular Weight Polyethylene Markers page 0 Table 5: Laboratory data of participant WBC.5-9.8 / nl 7.5 7.9 7.6 6.9 Ery.7 -.8 / pl.6.6.9.8 Hemoglobin. -.5 g / dl..8.6. Hematocrit - % 0.7 9.9.8 0. MCV 8. - 99.8 fl 88.0 87.0 90.0 8.0 MCH 7. - pg 0.5 0. 9.9 9.6 MCHC.8 -.9 g / dl.6.6. 5. Platelets 0-60 / nl.0 6.0 8.0.0 Basophilic <.5 %.0 0.7. 0.7 Eosinophilic 0. - 6.6 %...6. Neutrophilic - 7.8 % 58. 57. 56.9 58. Lympho 6. - 5 % 0..6 0. 7.7 Mono.6-8. % 6. 5.7 7.0 7.7 Large unstained cells <.5 %...0. AP 55-05 U / l 7 50 50 7 BIL 0. -. mg / dl 0.76 0.8 0.77 CHOL <90 mg / dl 7 6 79 6 CRP <.0 mg / l 5.9 9. 5.8 8.7 TP 6.6-8. g / dl 7. 7.5 8 7. GGT <0 U / l 9 9 0 GLU 60-99 mg / dl 86 8 9 89 AST <5 U / l 9 0 7 ALT <5 U / l 0 9 6 9 HDL >0 mg / dl..6 9.9.8 UREA 5-0 mg / dl 75. 77.5 85. 7 K.6 -.8 mg / dl.68.5 5.07.5 CREA 0.8-0.95 mg / dl.8...9 LDH <50 U / l 6 7 7 5 NA 5-5 mg / dl 8 8 TRI <50 mg / dl 95 80

Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 6: Laboratory data of participant 5 WBC.5-9.8 / nl 9.9 8.6 0. 0.6 Ery.7 -.8 / pl.8.8.9 5. Hemoglobin. -.5 g / dl.8.7 5.0 5. Hematocrit - %.5.7.0 6. MCV 8. - 99.8 fl 9.0 9.0 90.0 90.0 MCH 7. - pg 0.5 0.6 0.6 9.8 MCHC.8 -.9 g / dl..6.9. Platelets 0-60 / nl.0 07.0 5.0.0 Basophilic <.5 % 0.5 0.6 0.5 0.9 Eosinophilic 0. - 6.6 %.... Neutrophilic - 7.8 % 8. 6.8 8.9 6. Lympho 6. - 5 %. 5..9. Mono.6-8. %.6.0..8 Large unstained cells <.5 %.... AP 55-05 U / l 9 5 56 BIL 0. -. mg / dl 0.9 0.7 0. 0.7 CHOL <90 mg / dl 9 9 5 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7. 7. 7 7. GGT <0 U / l 0 8 GLU 60-99 mg / dl 7 8 77 8 AST <5 U / l 5 ALT <5 U / l 6 0 7 5 HDL >0 mg / dl 5.6 8. 7.5 56. UREA 5-0 mg / dl. 8.7 5.6 5.7 K.6 -.8 mg / dl.9.7.78. CREA 0.8-0.95 mg / dl 0.7 0.7 0.76 0.7 LDH <50 U / l 7 80 60 06 NA 5-5 mg / dl 9 0 9 TRI <50 mg / dl 8 0 07 0

Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 7: Laboratory data of participant 6 WBC.5-9.8 / nl 8.9 6.7 7.5 6.6 Ery.7 -.8 / pl...5. Hemoglobin. -.5 g / dl.5.6..8 Hematocrit - % 0.6 7. 0.7 7. MCV 8. - 99.8 fl 9 90.0 9.0 9.0 MCH 7. - pg 0.5 0. 9.8. MCHC.8 -.9 g / dl..8.9. Platelets 0-60 / nl 0 65.0 8.0 6.0 Basophilic <.5 % 0.9 0.9 0.7 0.8 Eosinophilic 0. - 6.6 %..9.8. Neutrophilic - 7.8 % 6.6 5.7 5. 5.7 Lympho 6. - 5 % 8.6 9. 8.9 7. Mono.6-8. % 5. 5.0 5. 5.5 Large unstained cells <.5 %..0.7 AP 55-05 U / l 59 5 57 55 BIL 0. -. mg / dl 0.5 0. 0.5 0.58 CHOL <90 mg / dl 7 78 8 6 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7.8 7.5 7.5 7. GGT <0 U / l GLU 60-99 mg / dl 9 8 79 78 AST <5 U / l ALT <5 U / l 9 6 9 8 HDL >0 mg / dl 65.5 65. 6.8 65.7 UREA 5-0 mg / dl.6 8. 8. 7. K.6 -.8 mg / dl.56..6.9 CREA 0.8-0.95 mg / dl 0.68 0.7 0.7 0.69 LDH <50 U / l 8 8 8 86 NA 5-5 mg / dl 90 8 9 8 TRI <50 mg / dl 67 9 79

Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 8: Laboratory data of participant 7 WBC.5-9.8 / nl 6. 5. 5. 6. Ery.7 -.8 / pl.8.8.9 5.0 Hemoglobin. -.5 g / dl...0. Hematocrit - % 0. 0.7.7.7 MCV 8. - 99.8 fl 8.0 86.0 86.0 87.0 MCH 7. - pg 9.7 9.9 8.7 8. MCHC.8 -.9 g / dl 5..9.5.7 Platelets 0-60 / nl 55.0 56.0 57.0 75.0 Basophilic <.5 % 0. 0.8 0.7 0.8 Eosinophilic 0. - 6.6 %.7 5.6..7 Neutrophilic - 7.8 % 5. 8.6 5.5 57.9 Lympho 6. - 5 % 5. 7. 5.0.6 Mono.6-8. %....0 Large unstained cells <.5 %.0..0.9 AP 55-05 U / l 8 8 85 BIL 0. -. mg / dl 0.5 0.5 0.9 0.6 CHOL <90 mg / dl 7 7 7 89 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7. 7. 7.5 7.7 GGT <0 U / l 6 5 GLU 60-99 mg / dl 8 95 9 89 AST <5 U / l 0 9 ALT <5 U / l 8 8 5 9 HDL >0 mg / dl 55.9 60. 58.6 56.8 UREA 5-0 mg / dl. 8.6 5..5 K.6 -.8 mg / dl.66.6.7.86 CREA 0.8-0.95 mg / dl 0.7 0.7 0.65 0.67 LDH <50 U / l 9 08 8 97 NA 5-5 mg / dl 6 7 9 5 TRI <50 mg / dl 79 9 0 5

Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 9: Laboratory data of participant 8 WBC.5-9.8 / nl.9.9..6 Ery.7 -.8 / pl.7.7.5.8 Hemoglobin. -.5 g / dl.9..8. Hematocrit - % 5.0 7.6.7 7. MCV 8. - 99.8 Fl 95.0 0.0 98.0 99.0 MCH 7. - Pg..6..0 MCHC.8 -.9 g / dl.0..0.5 Platelets 0-60 / nl.0 0.0 9.0 09.0 Basophilic <.5 % 0. 0. 0. 0.5 Eosinophilic 0. - 6.6 %..8..7 Neutrophilic - 7.8 % 5.5 5.0 9. 8.9 Lympho 6. - 5 % 7.0 9. 0.. Mono.6-8. % 6.0 5.6 5.5 5.0 Large unstained cells <.5 %.0.9.5.6 AP 55-05 U / l 85 79 8 78 BIL 0. -. mg / dl 0.57 0.5 0.56 0.5 CHOL <90 mg / dl 7 75 78 60 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 7. 7. 7. 7. GGT <0 U / l 6 7 GLU 60-99 mg / dl 9 9 95 99 AST <5 U / l 6 ALT <5 U / l 8 5 9 HDL >0 mg / dl 9. 9.8 89. 89. UREA 5-0 mg / dl 6. 5 5. 6 K.6 -.8 mg / dl..69..5 CREA 0.8-0.95 mg / dl 0.7 0.8 0.69 0.7 LDH <50 U / l 7 7 05 09 NA 5-5 mg / dl 0 9 8 9 TRI <50 mg / dl 77 6 08 9

Human Tolerance of Low Molecular Weight Polyethylene Markers page 5 Table 0: Laboratory data of participant 9 WBC.5-9.8 / nl 5. 5.9 5.7.7 Ery.7 -.8 / pl.9 5.0 5..8 Hemoglobin. -.5 g / dl 5. 6.5 6. 5.6 Hematocrit - %. 7. 8. 5. MCV 8. - 99.8 fl 90.0 9.0 9.0 9.0 MCH 7. - pg.6.8 0.6. MCHC.8 -.9 g / dl.9.9.5.6 Platelets 0-60 / nl 99.0 57.0 9.0 69.0 Basophilic <.5 % 0... 0.9 Eosinophilic 0. - 6.6 % 0.6. 0.6 0.9 Neutrophilic - 7.8 % 65.5 6. 57.9 58.0 Lympho 6. - 5 % 7.8 7.8.5. Mono.6-8. %. 5.7 5.5 5.9 Large unstained cells <.5 %.5.0..0 AP 55-05 U / l BIL 0. -. mg / dl 0.98 0.99 0.8 0.95 CHOL <90 mg / dl 7 9 6 9 CRP <.0 mg / l <0. <.0 <.0 <.0 TP 6.6-8. g / dl 6.9 6.8 6.8 6.9 GGT <0 U / l 0 50 5 5 GLU 60-99 mg / dl 97 87 8 86 AST <5 U / l 7 8 ALT <5 U / l 7 6 9 9 HDL >0 mg / dl 6 6.8 6.9 6. UREA 5-0 mg / dl.5.7.9 K.6 -.8 mg / dl.6.07.75. CREA 0.8-0.95 mg / dl.5... LDH <50 U / l 8 6 7 57 NA 5-5 mg / dl 0 7 7 8 TRI <50 mg / dl 0 89 77

Human Tolerance of Low Molecular Weight Polyethylene Markers page 6 Table : Laboratory data of participant 0 WBC.5-9.8 / nl 8.0 6.8 8.0 6.0 Ery.7 -.8 / pl.5.6.5.6 Hemoglobin. -.5 g / dl.9.9.5.0 Hematocrit - % 0.... MCV 8. - 99.8 fl 90.0 9.0 9.0 9.0 MCH 7. - pg. 0. 9.7 0.6 MCHC.8 -.9 g / dl.5.0.7. Platelets 0-60 / nl 0.0 5.0 6.0 95.0 Basophilic <.5 % 0. 0.9 0.. Eosinophilic 0. - 6.6 %. 5.0.0.7 Neutrophilic - 7.8 % 60. 5. 57.0 5.9 Lympho 6. - 5 %..8.0.8 Mono.6-8. %.7 5.8 5.0 6. Large unstained cells <.5 %.7..5.9 AP 55-05 U / l 8 8 85 76 BIL 0. -. mg / dl 0.5 0.6 0.8 0.7 CHOL <90 mg / dl 0 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP 6.6-8. g / dl 8. 7.7 8 8. GGT <0 U / l 0 GLU 60-99 mg / dl 88 9 8 69 AST <5 U / l 7 8 8 7 ALT <5 U / l 7 7 7 6 HDL >0 mg / dl 6 59.8 60. 6.8 UREA 5-0 mg / dl. 9.8 0.5 7.8 K.6 -.8 mg / dl.68.0.65.97 CREA 0.8-0.95 mg / dl 0.67 0.7 0.68 0.78 LDH <50 U / l 8 77 00 79 NA 5-5 mg / dl 0 0 0 TRI <50 mg / dl 55 5 79 50