Kathryn Jones 8/11/2015
|
|
- Sandra Cooper
- 5 years ago
- Views:
Transcription
1 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry with Nutri on Seminars, North 24th Ave., Suite 603, Phoenix, AZ Although products produced by Bio cs Research Corpora on are suggested throughout this presenta on, the opinions expressed are not those of Bio cs Research Corpora on, their distributors or their employees. The U.S. Food and Drug Administra on (FDA) have not evaluated statements made herein; the informa on is not intended to diagnose, treat or prevent disease. The informa on described in this report is provided only for degreed health care professionals and students currently enrolled in a degree gran ng school. Kathryn Jones 8/11/2015 THE PATIENTS RESULTS ARE LOCATED IN THE GRAPH OPPOSITE THE LABORATORY RANGE. THE RESULTS INDICATED ARE REPORTED USING THE OPTIMAL RANGE GLUCOSE Laboratory Range: mg/dl Op mal Range: mg/dl 85 mg/dl HEMOGLOBIN A1C Laboratory Range: < 5.7 % Op mal Range: % 4.7 % Hemoglobin A1c is decreased, rule out the Folate deficiency: check for > MCV and/or > MCH BUN (BLOOD UREA NITROGEN) Laboratory Range: 6-24 mg/dl Op mal Range: mg/dl 13 mg/dl CREATININE Laboratory Range: mg/dl Op mal Range: mg/dl 0.6 mg/dl SODIUM Laboratory Range: mmol/l Op mal Range: mmol/l 135 mmol/l
2 2 of 8 8/11/2015 2:25 PM POTASSIUM Laboratory Range: mmol/l Op mal Range: mmol/l 5.2 mmol/l Potassium is increased, rule out the Adrenal cor cal hypofunc on: check for < cor sol Diarrhea Prescribed diure cs CHLORIDE Laboratory Range: mmol/l Op mal Range: mmol/l 102 mmol/l CO2 Laboratory Range: mmol/l Op mal Range: mmol/l 27 mmol/l CALCIUM Laboratory Range: mg/dl Op mal Range: mg/dl 9.8 mg/dl TOTAL PROTEIN Laboratory Range: g/dl Op mal Range: g/dl 6.9 g/dl ALBUMIN Laboratory Range: g/dl Op mal Range: g/dl 4.7 g/dl TOTAL GLOBULIN Laboratory Range: g/dl Op mal Range: g/dl 2.2 g/dl Total Globulin is decreased, rule out the Hypochlorhydria: check for > BUN, chloride <, phosphorus < Diges ve inflamma on: check for gastrin >, CRP > HgB and/or HcT <
3 3 of 8 8/11/2015 2:25 PM ALKALINE PHOSPHATASE X Alkaline Phosphatase is decreased, rule out the Thyroid hypofunc on: check for TSH > Zinc deficiency: check for abnormal zinc taste test Progesterone deficiency: check for progesterone < AST (SGOT) Laboratory Range: 0-45 IU/L Op mal Range: IU/L 14 IU/L ALT (SGPT) Laboratory Range: 0-45 IU/L Op mal Range: 0-30 IU/L 12 IU/L CHOLESTEROL Laboratory Range: mg/dl Op mal Range: mg/dl 173 mg/dl TRIGLYCERIDES Laboratory Range: mg/dl Op mal Range: mg/dl 39 mg/dl Triglycerides is decreased, rule out the Thyroid hyperfunc on: check for TSH < Autoimmune phenomenon: check for triglycerides < in rela on to the total cholesterol and HDL > in rela on to the total cholesterol, also check for systemic toxicity HDL CHOLESTEROL Laboratory Range: > 39 mg/dl Op mal Range: mg/dl 69 mg/dl LDL CHOLESTEROL Laboratory Range: 0-99 mg/dl Op mal Range: mg/dl 96 mg/dl TSH Laboratory Range: uiu/l Op mal Range: uiu/l 2.23 uiu/l
4 4 of 8 8/11/2015 2:25 PM FREE T-4 Laboratory Range: ug/dl Op mal Range: ug/dl 0.92 ug/dl Free T-4 is decreased, rule out the Thyroid hypofunc on: check for TSH >, T-3 < Anterior pituitary hypofunc on: check for TSH < FREE T-3 Laboratory Range: pg/ml Op mal Range: pg/ml 2.2 pg/ml Free T-3 is decreased, rule out the Thyroid hypofunc on: check for TSH >, T-4 < Anterior pituitary hypofunc on: check for TSH < WBC TOTAL Laboratory Range: x10e3/ul Op mal Range: x10e3/ul 4.7 x10e3/ul WBC Total is decreased, rule out the Chronic viral infec on: check for lymphocyte % >, viral load >, viral ters >, CRP > Chronic bacterial infec on: check for neutrophil % >, nanobacteria > CRP > Free radical pathology Co-factor anemia: check for abnormal MCV/MCH, transaminases < RED BLOOD COUNT (RBC) Laboratory Range: x10e6/ul Op mal Range: x10e6/ul 4.38 x10e6/ul HEMOGLOBIN (HGB) Laboratory Range: g/dl Op mal Range: g/dl 12.7 g/dl Hemoglobin (HgB) is decreased, rule out the Iron anemia: check for MCV and or MCH < with < serum iron and/or ferri n, HcT < Microscopic internal bleeding: check for re culocyte count >, blood in urine or stool Adrenal cor cal hypofunc on: check for potassium >, cor sol < Co-factor anemia: check for abnormal MCV and/or MCH, transaminases < Hereditary anemia Free radical pathology HEMATOCRIT (HCT) Laboratory Range: % Op mal Range: % 41.2 %
5 5 of 8 8/11/2015 2:25 PM MCV Laboratory Range: fl Op mal Range: fl 94.5 fl MCV is increased, rule out the Vitamin B-12/folate anemia: check for MCH >, urinary methylmalonic acid >, LDH isoenzyme #1 >, uric acid < Hereditary anemia Free radical pathology Some cases of dehydra on: check for albumin >, total protein >, chloride >, MCH > Some cases of hypochlorhydria: check for total globulin >, phosphorus <, BUN > MCH Laboratory Range: pg Op mal Range: pg 29.1 pg PLATELETS Laboratory Range: x10e3/ul Op mal Range: x10e3/ul 190 x10e3/ul NEUTROPHIL PERCENT Laboratory Range: % Op mal Range: % 42.7 % LYMPHOCYTE PERCENT Laboratory Range: % Op mal Range: % 46.9 % Lymphocyte Percent is increased, rule out the Viral infec on: check for WBC total > in the acute phase or WBC total < in the chronic phase Some cases of free radical pathology, more o en < than > Lymphocy c leukemia: check for alkaline phosphatase >, alkaline phosphatase placental isoenzyme >, transaminases >, LDH > WBC total > or <, HgB and HcT < MONOCYTE PERCENT Laboratory Range: 4-13 % Op mal Range: 0-9 % 9 % EOSINOPHIL PERCENT Laboratory Range: 0-7 % Op mal Range: 0-3 % 0.6 % BASOPHIL PERCENT Laboratory Range: 0-3 % Op mal Range: 0-1 % 0.6 %
6 6 of 8 8/11/2015 2:25 PM DHEA-S X DHEA-s is decreased, rule out the Adrenal cor cal hypofunc on: check for cor sol <, potassium > Alzheimer s disease Rheumatoid arthri s: check for uric acid >, ANA > Secondary ovarian hypofunc on BASED ON THE BLOOD CHEMISTRY DATA PROVIDED, THE FOLLOWING SUPPLEMENTAL SUPPORT SHOULD BE CONSIDERED. THE SUPPLEMENTS ARE PRINTED IN THE PRIORITY OF NEED AS DETERMINED BY THE COMPUTER ALGORITHM AND YOUR HEALTH CARE PROVIDER. Recommenda on Indicators Dosage Frequency 5-MTHF Plus Forte 7 1 tablet Breakfast ADB-5 Plus 7 2 tablets Breakfast, Lunch Bio-Glycozyme Forte 7 2 capsules Breakfast, Dinner EFAs 7 3 capsules Breakfast, Dinner Pure Water glasses Breakfast, Lunch, Dinner Immuno-gG 4 1 capsule Breakfast, Lunch, Dinner BioDoph-7 Plus 4 2 capsule On Empty Stomach B Lozenges 4 1 lozenge DHEA 3 10 mg Breakfast Breakfast, Lunch, Dinner * Allow to dissolve in the mouth. 5-MTHF PLUS FORTE Each tablet contains 5 mg of Methylfolate, 50 mcg of methylcobalamin and 25 mcg of SOD and Catalase. Designed to support folate anemia, increased homocysteine and problems associated with depression, fibromyalgia, obesity, chronic headaches, tension, insomnia and ea ng disorders. ADB-5 PLUS Combines, vitamins, minerals, porcine adrenal and other nutrients. Use as adjunc ve support for adrenal cor cal hypofunc on. BIO-GLYCOZYME FORTE Broad-spectrum product designed to provide adjunc ve support for hypoglycemia, reac ve hypoglycemia, general fa gue, highly refined diets and carbohydrate sensi vity. EFAS Essen al fa y acids. Op mal EFAs, Sun-Flax, Mixed EFAs, EFA Sirt-Supreme, Fax Seed Oil or BioMega-3 can be used. PURE WATER IMMUNO-GG Source of immunoglobulin G from colostrum with arginine and lysine. Use as adjunc ve support for reduced secretory IgA, virus, leaky gut and other condi ons involving GI inflamma on.
7 7 of 8 8/11/2015 2:25 PM BIODOPH-7 PLUS Each capsule contains a proprietary blend of probio cs and probio cs. Use as adjunc ve therapy for decreased secretory IgA, to s mulate phagocytosis, for gastric inflamma on/mucous and diarrhea. B LOZENGES Each lozenge contains 2000 micrograms of hydroxocobalamin, 2 mg of P-5-P and 800 micrograms of calcium folinate (folic acid). Use as adjunc ve support for B-12 anemia, chronic fa gue, inflamma on and neuromuscular problems. DHEA Use where DHEA insufficiency can be demonstrated via bio-assay. Pa ent Informa on First Name: Kathryn Gender: Female Age: 31 High Al tude: No Pre-Menopausal: No Last Name: Jones Height: 5' 8" Weight: 135 lbs. On Blood Thinners: No Estrogen Replacement: No Assessment Informa on Test Name Pa ent Value Laboratory Range Op mal Range Glucose 85 mg/dl mg/dl mg/dl Hemoglobin A1c 4.7 % < 5.7 % % BUN (Blood Urea Nitrogen) 13 mg/dl 6-24 mg/dl mg/dl Crea nine 0.6 mg/dl mg/dl mg/dl Sodium 135 mmol/l mmol/l mmol/l Potassium 5.2 mmol/l mmol/l mmol/l Chloride 102 mmol/l mmol/l mmol/l CO2 27 mmol/l mmol/l mmol/l Calcium 9.8 mg/dl mg/dl mg/dl Total Protein 6.9 g/dl g/dl g/dl Albumin 4.7 g/dl g/dl g/dl Total Globulin 2.2 g/dl g/dl g/dl Alkaline Phosphatase AST (SGOT) 14 IU/L 0-45 IU/L IU/L ALT (SGPT) 12 IU/L 0-45 IU/L 0-30 IU/L Cholesterol 173 mg/dl mg/dl mg/dl Triglycerides 39 mg/dl mg/dl mg/dl HDL Cholesterol 69 mg/dl > 39 mg/dl mg/dl LDL Cholesterol 96 mg/dl 0-99 mg/dl mg/dl TSH 2.23 uiu/l uiu/l uiu/l Free T ug/dl ug/dl ug/dl Free T pg/ml pg/ml pg/ml WBC Total 4.7 x10e3/ul x10e3/ul x10e3/ul Red Blood Count (RBC) 4.38 x10e6/ul x10e6/ul x10e6/ul Hemoglobin (HgB) 12.7 g/dl g/dl g/dl
8 8 of 8 8/11/2015 2:25 PM Hematocrit (HcT) 41.2 % % % MCV 94.5 fl fl fl MCH 29.1 pg pg pg Platelets 190 x10e3/ul x10e3/ul x10e3/ul Neutrophil Percent 42.7 % % % Lymphocyte Percent 46.9 % % % Monocyte Percent 9 % 4-13 % 0-9 % Eosinophil Percent 0.6 % 0-7 % 0-3 % Basophil Percent 0.6 % 0-3 % 0-1 % DHEA-s
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationSMITH, JOHN D.C. Functional Health Report. Practitioner Copy JANE DOE. Lab Test on Jul 31, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 5 This report shows customized recommendations based on the blood test
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationGastrointestinal Markers
Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More information& CBC Analysis. Getting the Most from the. Session 3. Foundations of Functional Blood Chemistry Analysis Session 3 Dr.
Functional Blood Chemistry & CBC Analysis Session 3 Li L:iver and Gallbladder Markers SGOT/AST, SGPT/ALT & GGTP Getting the Most from the Liver Panel http://www.fmtown.com 1 Liver Panel Reference Ranges
More informationCount y of Dupage. The Empower Wellness Screening Program. Thoughtfully designed to help you take control of your health
Count y of Dupage The Empower Wellness Screening Program Thoughtfully designed to help you take control of your health Stay Healthy! TAKE A POSITIVE STEP. YOUR HEALTH IS WORTH IT! Empowerment: Understanding
More informationKildeer CCSD 96. The Empower Wellness Screening Program. Thoughtfully designed to help you take control of your health
Kildeer CCSD 96 The Empower Wellness Screening Program Thoughtfully designed to help you take control of your health Stay Healthy! TAKE A POSITIVE STEP. YOUR HEALTH IS WORTH IT! Empowerment: Understanding
More informationWSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:
WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationProvider: TONY BOGGESS DO 1310 S Main St Ann Arbor, MI Account No: Results
DOB: 03.17.1969 Fasting: Yes ACC/AHA Risk Score: BMI: 28.9 Info: 1310 S Main St Ann Arbor, MI 48104 Requisition No: Received Date & Time: 09.09.2017 11:46 AM Collection Date & Time: 09.08.2017 NOT GIVEN
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationFunctional Blood Chemistry & CBC Analysis
Functional Blood Chemistry & CBC Analysis Session 10 Inflammation Markers The 19 Deadly Sins of Heart Disease 1. Excess LDL 2. Excess Total cholesterol 3. Low HDL 4. Excess Triglycerides 5. Oxidized LDL
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationAscend Clinical Reference Ranges (July 2018) Chemistry
24 Hour Urine Creatinine mg/24 hr 800-2000 (Male) Kinetic Alkaline Picrate (Jaffe Reaction) for 24 hour Urine Creatinine Clearence (Creatinine ml/min/1.73m^2 Clearance) 600-1800 (Female) 85-125 (Male)
More informationComplete Guide to Thyroid Blood Testing
BLOOD TESTING AND VALUES Complete Guide to Thyroid Blood Testing I often get asked.. What tests do I need? Why did my Doctor not order these tests? I ve just suppplied you with a complete list of the tests
More informationM Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationBLOOD WORK: A USEFUL TOOL FOR MONITORING HIV
BLOOD WORK: A USEFUL TOOL FOR MONITORING HIV A PUBLICATION FROM Information, Inspiration and Advocacy for People Living With HIV/AIDS MAY 2007 Lab tests, or blood work, can give important clues about your
More informationLABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
More informationAscend Clinical Reference Ranges (November 2018) Chemistry
24 Hour Urine Creatinine mg/24 hr 800-2000 (Male) 600-1800 (Female) Kinetic Alkaline Picrate (Jaffe Reaction) for Creatinine 24 hour Urine Creatinine Clearence (Creatinine ml/min/1.73m^2 85-125 (Male)
More informationCardiovascular Health
WellnessFX Results - Josh Trent Cardiovascular Health Your cardiovascular system is made up of your heart and blood vessels, and is responsible for transporting oxygen, nutrients, hormones, and waste products
More informationCommunity health day. General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m.
Community health day General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m. Health screenings to be offered include: Chemistry profile...$20 TSH (thyroid
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationBasic Blood Chemistry, by Sharlene Peterson CLASS: G610
Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.
More informationA. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters
A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationHEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationSMALL GROUP DISCUSSION
MHD II, Seesion II Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session II JANUARY 15, 2014 Recent Review highlighting disease process in Case 2: Fasano A, Catassi, C. NEJM 2012; 367: 2419-26 STUDENT
More informationCLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)
ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain
More informationLaboratory Testing for the Primary Care Optometrist
General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:
Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380
More informationChapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.
Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationSpecific Panels. Celiac disease panel. Pancreas Panel:
Specific Panels Celiac disease panel Anti Endomysium IgA Anti Endomysium IgG Anti Gliadin IgA Anti Gliadin IgG Anti Transglutaminase IgA Anti Transglutaminase IgG Total IgA Total IgG Stool analysis +Sudan
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationBloodwork Results for: Doe, Jane (02/25/2018)
Bloodwork Results for: Doe, Jane (02/25/2018) Name Optimal Range Reference Range Units Result C-Reactive Protein (CRP) 0-1.5 0-3 4 Eosinophils 0-3 0-4 % 7.8 LDL-cholesterol 0-120 0-99 mg/dl 106 Lymphocytes
More informationJoin Us Live in Houston, Texas! February 18-19, 2017 Integrative & Functional Medicine Approach to Blood Chemistry Interpretation
Dr. Wayne Sodano DC, DABCI, DACBN, CFMP, BCTN Director of Medical Education Join Us Live in Houston, Texas! February 18-19, 2017 Integrative & Functional Medicine Approach to Blood Chemistry Interpretation
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationUnderstanding your blood results:
Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationThe Primary Functional Diagnosis of the G.I. & Biliary System
Functional Physiology, Dysfunctions, and Assessments of the G.I. and Gallbladder a 3-part Webinar Series The Functional Diagnosis Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More information