Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2 concentration for medial basal hypothalamus (MBH), anterior pituitary and brown adipose tissue (BAT). Supplementary Material and Methods Fig. 1. Figures show representative data from anterior pituitary and from BAT-RNA of controls at different cycles (A,B) or different cdna concentration at selected number of cycles (C). D.E: figures showing correlation between a cdna of experimental gene and house keeping gene from sedentary (blue rombos) compared to exercised rats (red squares) of one representative experiment.
Supplementary Material and Methods, Table 1. Oligonucleotides and RT-PCR conditions GENE ID SIZE SENSE ANTISENSE START STOP Tm C HPRT NM_12583.2 458 CCTCAGTCCCAGCGTCGTGA TGGGGCTGTACTGCTTGACCA 75-94 512-532 64 CYC 2 NM_1711.1 53 CGAGCTGTTTGCAGACAAAGTTCC GATGGGGTGGGGGTGCTCTC 18-131 591-61 64 PPII NM_118991.1 45 CTGGATCGCATACAAAAA GGACAGCCAAATAATTGCT 2984-32 2585-263 55 Dio2 NM_3172.3 19 GATGCTCCCAATTCCAGTGT AGGCTGGCAGTTGCCTAGTA 81-82 962-981 64 TRH-R1 NM_1347.3 35 ACCCAGAGAAGCAGGCAGCGTGACA GATCCGCCACAGCCAGACTCACCAG 24-28 529-553 69 UCP-1 NM_12682.2 396 GGATCAAACCCCGCTACACTG CAGGATCCGAGTCGCAGAAAA 627-647 13-123 58 MBH Anterior Pituitary BAT GENE CYCLES cdna CYCLES cdna CYCLES cdna MgCl 2 HPRT 24 2 µl 1.5 mm CYC 2 21 6 µl 2 4 µl 21 2 µl 1.5 mm G3PDH 26 2 µl 1.5 mm PPII 29 4 µl 29 4 µl 1.5 mm Dio2 3 4 µl 28 4 µl 26 2 µl 1.5 mm TRH-R1 29 4 µl 1.5 mm TSH-β 21 4 µl 1.5 mm UCP-1 18 2 µl 1.5 mm
Cyclophilin (a.u.) Cyclophilin (a.u.) Cyclophilin (a.u.) Arbitrary Unists Arbitrary units Arbitrary units A) 1 8 6 4 2 8 7 6 5 4 3 2 RNA from Anterior Pituitary Dio2 TSH-β 18 2 22 24 26 28 3 32 Number of cycles 1 1 2 3 4 TSHβ (a.u.) 8 6 4 2 3 25 2 15 1 16 18 2 22 24 26 28 3 32 Number of cycles Sed Ex RNA from BAT B) C) D) Dio2 UCP- 1 5 5 15 25 Dio2 (a.u.) 8 6 4 2 E) 2 15 1 5 Dio2 26c CYC 21c HPRT 24c UCP-1 18c 1 2 3 4 μl cdna Sed Ex Naive X 2 4 UCP-1 (a.u.)
Supplementary Figure 1. Effect of voluntary exercise, or of repeated restraint, on body weight gain (BWg) and food intake. Wistar male rats were introduced into a plastic restraint tube in prone position (Res), or in an empty cage (controls: C), for 3 min /day during 1-14 days. Male rats from other cohort were kept during the night in individual cages containing (Exercise: Ex) or not a running wheel (sedentary: Sed) and returned with their cage mates during light period. Each time point of each paradigm was repeated in 2 independent experiments (total 1 animals/group). a,b) Body weight was measured on days stated in abscissa and compared to the weight of each rat on day. Graphs represent the cumulative weight gain; Repeated measures ANOVA (Supplementary Table 1), followed by post-hoc hoc significance between experimental and control groups (C or Sed) of same day p<.5. c) Relative food intake (average grams of chow/day/kg of body weight) for the 2 weeks. d) Food efficiency calculated as BWg /1 g of chow consumed during two weeks. e) Cumulative food intake (g) was measured on days 3, 7 and 14 during night and day periods for sedentary and exercised rats; significant differences against day period (PostHoc: p<.1). f,g) Correlation plots between food intake (g) and water intake (ml) or amount of exercise performed during 1,3,7 or 14 days. significant differences against controls (post-hoc: p<.1, p<.1). Supplementary figure 2. Variations in WAT and BAT weights, and serum leptin of animals exposed to restraint or exercise. Treatments described in legend of Fig.1 a) Subcutaneous (sc) white adipose tissue (WAT) from interscapulum (localized above BAT), from epididymus (ε) or from retroperitoneum (ρ) was excised and weighed fresh; figure depicts values calculated as % of particular controls of each independent experiment (=1%, represented as horizontal line); only values after 14 days restraint (Res) are shown. b) Correlation plots between values of scwat weight (in % of sedentary) and average number of revolutions (Rev) after 7 or 14 days (d) of exercise. c) Slices from scwat stained with hematoxylin and eosin. d) Variations in BAT weight after 1-14 days of exercise, or 14 days of restraint; e) correlation plots between BAT weight and revolutions at 7 or 14 days of exercise; f) stained slices of BAT (as c). g) Leptin serum concentration determined by ELISA after 14 days of exercise or restraint. h) correlation plots between WAT weight and procrh mrna or corticosterone serum levels (i); j) correlation plots between epididymal WAT (εwat) weight and serum
corticosterone of exercise and pair fed rats; k) correlation plots between WAT weight and total T3 at 7 and 14 days of exercise; l) correlation plots between serum corticosterona and PVN protrh after 14 days of restraint or of pair feeding (m). Values of ANOVAs or regression analyses in Supplementary Tables 1 and 2; post-hoc significance: x p<.5, p<.5, p<.5.
Food intake (g) Water intake (ml) Total Revolutions BWg (g) BWg (g) Food Itk (g)/kg BW BWG(g)/1g food a) b) c) d) 4 3 2 1 Sed - - - Ex 1 4 8 12 days 35 25 15 5-5 C Res 2 4 6 11 days 65 55 45 35 1 12 1 Sed Ex PF C Res 8 6 4 2 1 τ e) f) 25 2 15 1 5 Sed Ex Sed Ex Night 3 7 14 Day 4 3 2 1 Sed (.94) Ex (.96) 1 2 3 Food Intake (g) d1 d3 d7 d14 g) 6 4 2 1 2 Food Intake (g)
WAT Cort ProTRH Serum leptin (ng/ml) procrh Cort (% sed) ewat BAT weight (g) % of sed 1 3 7 14 Res14 Rev/day WAT weight (g) % of sed Rev/day a 125 1 75 sc ε ρ x x b 7 5 3 d 7 d 14 c Sedentary Exercised 5 1 3 7 14 R14 Ex (days) 1 5 75 1 scwat d e f 1 75 5 25 Ex (days) 7 55 4 25 1 d 7 d 14 5 75 1 BAT (g) (% sed) Sedentary Exercised g k 125 1 75 5 25 1 8 6 4 2 d7 d14 Ex 25 5 75 1 125 T3 h 15 125 1 75 5 d7 d14 5 1 εwat l 2 15 1 5 -.74 i Res 2 1 5 1 15 WAT (% sed) m 75 1 125 protrh 8 6 4 2 j 6 45 3 15 Pair Fed -.81 25 5 Cort Ex PF.65 2 Cort
Supplementary Table 1. Data of statistical analyses. One or two way (1W, 2W) analyses of variance (ANOVA) were performed with the values of the relative mrna levels, calculated as % of each experiment s control, or serum concentrations of genes and hormones described in column one, of groups described in column 2. Data of 2 independent experiments/day/paradigm were pooled for analysis. Data of body weight or food intake of various days / rat was analyzed by ANOVA of repeated measures. n.m.= not measured. Supplementary Table 2. One or two way (1W, 2W) analyses of variance (ANOVA) were performed with the values of the relative mrna levels, calculated as % of each experiment s control, or serum concentrations of genes and hormones described in column titled variable, of groups described in column titled groups. Data of 2 independent experiments were pooled for analysis. When comparing different variables as Ex and Exα, 2W ANOVA considered each control group independently for comparison with groups of that experiment. Ex α= animals sacrificed 3 hours after the onset of the dark cycle. Supplementary Table 3. Dynamics of the esponse of the HPA axis to repeated restraint or wheel running (exercise). Animals were treated as described in legend Fig.1. Relative levels of mrna, dissected from the paraventricular nucleus of the hypothalamus, were evaluated by RT-PCR and signal of each cdna calculated as ratio of cyclophilin cdna. Corticosterone (cort) serum values quantified by RIA; adrenal weight (Adr.w, g) weighed fresh. Values of different variables in each experiment were calculated as % of mean values of their controls and pooled for statistics. ANOVA data in supplementary Table 1, post-hoc: p<.1. x p <.5, p<.5. n.m.= not measured.
Variable Groups Type of statistical test Food intake (g) Exercised 2W, treatment: F 2,119 = 9, p=.2; time: F 3,119 = 541, p<.1; interaction: F 1,18 =11, p=.1 Restraint 1W, F 1,86 = 21, p<.1 Food intake (Kg BW) Restraint 2W, first week: F 1,2 = 33, p=.8, 2nd week: F 1,35 = 14, p=.6 Exercised 2W, first week: F 1,56 = 26, p<.1, 2nd week: F 2,58 = 28, p<.1 Water intake (ml) Restraint n.m. Exercised 2W, treatment: F 1,56 =84, p=.1 Body Weight Gain (g) Sedentary Exercised 2W, treatment: F 1,18 =27, p<.1 ; days: F 9,162 =9.7, p<.1; interaction: F 9,162 =3.54, p=.5 Controls 2W, treatment: F 1,26 =2.82, p<.1 ; days: F 5,13 =43.3, p<.1 Food Efficiency (BWg/1g chow) Restraint Sedentary Exercised 2W, treatment: F 1,58 =34.64, p<.1; days: F 1,58 = 6.8, p =.11 Controls 2W, treatment: F 1,86 =17.54, p<.1; days: F 1,86 = 4.3, p =.41 Restraint BAT Weight (g) Restraint 1W, F 1,2 =6.4, p=.2 Exercised 2W, treatment: F 1,73 =34, p=.1; days: F 3,73 =4, p=.12; interaction: F 3,73 =3.6, p=.17 WAT Weight (g) Exercised 2W, subcutaneous fat, treatment: F 1,85 = 6.7, p =.11; epididymal fat (εwat), treatment: F 1,53 = 16, p=.2 Adrenals (g) Restraint 1W, F 2,46 =37.6, p <.1 Corticosterone (ng/ml) Restraint 1W, F 3,45 = 23, p <.1 procrh (PVN) Restraint 1W, F 2,36 = 4.3, p =.21 CRH-R1 (PVN) Restraint 1W, F 3,5 = 7.9, p =.2 GR (PVN) Restraint 1W, F 3,55 = 3.7, p =.17 ProTRH (PVN) Restraint 2W, treatment: F 1,65 =12.4, p=.8 controls Restraint 1W, F 3,45 = 5.8, p =.2 TSH (ng/ml) Exercised 1W, F 1,65 =14, p=.1 Leptin (14d) (Supplem Fig. 1) Exercised 1W, F 2,46 =37.6, p <.1 Restraint 1W, F 1,2 = 15.8, p =.7 Exercised 1W, F 1,19 = 19.5, p =.3 (2W Ex + Sed : treatment: F 1,39 =35, p=.1, no interaction)
Variable Groups Statistical Analysis protrh PVN Restraint 2W, treatment: F 1,65 =12.4; p=.8 Figure 1 Exercise 2W, treatment: F 1,73 =12.4; p=.1 TSH (ng/ml) Restraint 1W, F 3,45 = 5.8, p =.2 Exercise 2W, treatment: F 1,68 =5.6; p=.2 Body Weight Gain (g) Pair Fed and Exercise 1W, F 2,48 = 15.1, p<.1 Epididymal Fat Weight (g) Exercise 2W, treatment: F 2,55 = 6.5, p=.3 Retroperitoneal Fat Weight (g) Exercise 2W, treatment: F 2,43 = 9.4, p=.1 Interescapular Fat Weight (g) Pair Fed and Exercise 2W, treatment: F 2,63 = 8.5, p=.1 Figure 2 BAT Weight (g) Exercise 2W, treatment: F 2,73 = 7, p=.2 Triglycerides (mg/dl) Exercise 2W, treatment: F 3,32 = 5.6, p=.4 Leptin (ng/ml) Exercise 2W, treatment: F 3,53 = 7.3, p<.1 Corticosterone (ng/ml) Pair Fed 2W, treatment: F 3,54 = 16.2, p<.1 protrh PVN Pair Fed and Exercise 2W, treatment: F 3,44 = 19, p<.1 TSH (ng/ml) Exercise 1W, F 2,39 = 1.3, p=.3 T4/TSH Pair Fed and Ex α 2W, treatment: F 3,32 = 5.1, p=.6 ft4/tsh Pair Fed 2W, treatment: F 3,32 = 5.2, p=.6 T4/T3 Pair Fed 2W, treatment: F 3,33 = 3.8, p=.2 D2 mrna MBH Exercise 2W, F 1,21 = 4.31, p=.5 TRH-R1 mrna Pituitary Exercise 1W, F 1,1 = 7.2, p<.2 Figure 3 D2 mrna BAT Exercise 2W, treatment: F 3,4 = 4.8, p=.6 D2 Activity BAT Pair Fed 1W, F 2,35 = 3.4, p=.4 D1 Activity Liver Pair Fed 1W, F 2,17 = 6.5, p=.9 protrh PVN (ISH) Exercise Unpaired t-test, p=.2 Figure 4 procrh DMH Exercise 1W, F 2,17 = 12.5, p=.1 protrh DMH Ex α 2W, treatment: F 3,26 = 7.8, p=.1
% of Controls procrh CRH-R1 GR Corticosterone (88 ± 13 ng/ml) Adrenal (32 ±.8 mg) Restraint Control 1 ± 6 1 ± 5 1 ± 4 1 ± 12 1 ± 1 day 116 ± 11 115 ± 7 333 ± 41 n.m. 7 days 113 ± 4 152 ± 1 96 ± 11 161 ± 26 n.m. 14 days 94 ± 5 134 ± 9 x 8 ± 6 114 ± 17 153 ± 3 Exercise Sedentary 1 ± 4 1 ± 11 1 ± 5 1 ± 3 1 ± 5 1 day 84 ± 7 n.m. n.m. 84 ± 16 12 ± 8 3 days 16 ± 4 n.m. n.m. 199 ± 12 111 ± 4 7 days 122 ± 5 n.m. n.m. 89 ± 32 81 ± 1 14 days 97 ± 12 9 ± 9 89 ± 6 116 ± 4 99 ± 12