Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
|
|
- Curtis Stephens
- 5 years ago
- Views:
Transcription
1 Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide Kuwabara, Tetsushi Nakao, Masataka Nishiga, Shunsuke Usami, Masayasu Izuhara, Fumiko Nakazeki, Yuya Ide, Satoshi Koyama, Naoya Sowa, Naoya Yahagi, Hitoshi Shimano, Tomoyuki Nakamura, Koji Hasegawa, Noriaki Kume, Masayuki Yokode, Toru Kita, Takeshi Kimura, and Koh Ono
2 Supplementary Table S1 Serum lipid profiling of WT and mir-33b KI +/+ mice by HPLC Lipoprotein Major (Fraction No.) Diameter Sub-class (Fraction No.) WT (n=4) KI +/+ (n=5) TC (mg/dl) ± ± 3.91* CM (1-2) >8nm.73 ± ± 6* VLDL (3-7) 3-8nm 3.93 ± ±.41 LDL (8-13) 16-3nm 1.86 ± ±.78 large LDL (8) 3.1 ± ±.24 medium LDL (9) 2.85 ± ±.21 small LDL (1) 1.77 ± ±.18 very small LDL (11-13) 2.73 ± ±.26 HDL (14-2) 8-16nm 57.2 ± ± 3.23* very large HDL (14-15) 2.3 ±.68 ±.14* large HDL (16) ± ± 1.38** medium HDL (17) 24.9 ± ± 1.29* small HDL (18) 8.45 ± ±.47 very small HDL (19-2) 3.5 ± ±.25 TG (mg/dl) 22.4 ± ± 2.66 Values are mean ± SEM. Blood was obtained from chow-fed 8 weeks old male mice, after 4 h fasting. The serum was analyzed by HPLC, as described in material and methods. *p<5, **p<1 compared with WT mice. TC, total cholesterol; TG, triglyceride; CM, chylomicrons; VLDL, very low-density lipoprotein; LDL, low-density lipoprotein; HDL, high-density lipoprotein.
3 a Human SREBF1 SREBF2 SREBP-1 mir-33b SREBP-2 mir-33a Mouse Srebf1 Srebf2 SREBP-1 SREBP-2 mir-33(a) mir-33a; GUGCAUUGUAGUUGCAUUGCA mir-33b; GUGCAUUGCUGUUGCAUUGC b 133bp 24bp 166bp 475bp 21bp 89bp 112bp Human SREBF1 Ex.15 Ex.16 mir-33b Ex.17 Ex bp 168bp 166bp 41bp 21bp 98bp 112bp Mouse Srebf1 Ex.15 Ex.16 Ex.17 Ex.18 Exon 16 1 GAGAGACCCCTGCCCAGGGCAGCTCTGCACTCCTTCAAGGCTGCCCGGGCCCTGCTGGGC 6 1 GAGAGACCCCTGCCCAGGGCAGCTCTGTACTCCTTCAAGGCTGCCCGGGCTCTGCTGGAC 6 61 TGTGCCAAGGCAGAGTCTGGTCCAGCCAGCCTGACCATCTGTGAGAAGGCCAGTGGGTAC CACAGAAAGGTGGAATCTAGCCCAGCCAGCCTGGCCATCTGTGAGAAGGCCAGTGGGTAC 12 Exon CTGCAGGACAGCCTGGCTACCACACCAGCCAGCAGCTCCATTGACAAGGCCGTGCAGCTG CTGCGGGACAGCTTAGCCTCTACACCAACTGGCAGTTCCATTGACAAGGCCATGCAGCTG TTCCTGTGTGACCTGCTTCTTGTGGTGCGCACCAGCCTGTGGCGGCAGCAGCAGCCCCCG CTCCTGTGTGATCTACTTCTTGTGGCCCGTACCAGTCTGTGGCAGCGGCAGCAGTCACCA GCCCCGGCCCCAGCAGCCCAGGGCACCAGCAGCAGGCCCCAGGCTTCCGCCCTTGAGCTG GCTTCAGTCCAGGTAGCTCACGGTACCAGCAATGGACCCCAGGCCTCTGCTCTGGAGCTG 3 31 CGTGGCTTCCAACGGGACCTGAGCAGCCTGAGGCGGCTGGCACAGAGCTTCCGGCCCGCC CGTGGTTTCCAACATGACCTGAGCAGCCTGCGGCGGTTGGCACAGAGCTTCCGGCCTGCT 36 Exon ATGCGGAGG ATGAGGAGG 369 Supplementary Figure S1. Scheme of SREBFs and mir-33s and homologies in exons 16 and 17 of SREBF1 between human and mouse. (a) mir-33b is lacking in intron of mouse Srebf1. Mature sequences of mir-33a and mir-33b are indicated in the inset. (b) There are high homologies in exons 16 and 17 between human SREBF1 and mouse Srebf1 (82.6% of nucleotides and 79.7% of amino acids).
4 a WT ES clones 5 probe 35.2 kb (WT allele) 19.6 kb (Targeted allele) 1.7 kb (WT allele) 3 probe 4.8 kb (Targeted allele) Neo probe 6.6 kb b mir-33a (A.U.) * *** ES clone for injection c Srebf1 (A.U.) 2. d Srebf2 (A.U.) e f Srebf1 (A.U.) mir-33b (A.U.) Brain Heart Liver Kidney Sub WAT Epi WAT Gastrocnemius Brain Heart Liver Kidney Sub WAT Epi WAT Gastrocnemius Supplementary Figure S2. Generation of mir-33b knock-in mice. (a) Southern blotting analysis of genomic DNA from ES cells that were successfully targeted by a KI vector. Representative images are shown. (b-d) Quantitative real-time PCR analysis of mir-33a (b), Srebf1 (c) and Srebf2 (d) in the liver of 8-wk-old WT, KI +/- and KI +/+ male mice (n=6). Values are mean ± s.e.m. *p < 5 ***p < 1 by one-way analysis of variance. (e, f) Quantitative real-time PCR analysis of Srebf1 (e) and mir-33b (f) in 8-wk-old KI +/+ male mice (n=3). Values are mean ± s.e.m. Sub WAT indicates subcutaneous white adipose tissue. Epi WAT indicates epididymal white adipose tissue.
5 a b c d mir-33b (A.U.) mir-33a (A.U.) Srebf1 (A.U.) Srebf2 (A.U.) e 15 f 15 ABCA1 (%) 1 5 * ABCG1 (%) 1 5 * Supplementary Figure S3. The expression levels of mir-33s and Srebfs in KI macrophages. (a-d) Quantitative real-time PCR analysis of mir-33b (a), mir-33a (b), Srebf1 (c) and Srebf2 (d) in peritoneal macrophages from 8-wk-old WT and KI +/+ male mice (n=3). Values are mean ± s.e.m. N.D., not determined. (e, f) Densitomeric analysis of ABCA1 (e) and ABCG1 (f) in peritoneal macrophages from 8-wk-old WT and KI +/+ male mice. (n = 4). Values are mean ± s.e.m. *p < 5 by Student s t-test.
6 a b c Liver weight (g) 2. ** Liver weight (g) 2. ** Srebf1 (A.U.) ** Vehicle T91317 Vehicle T91317 Vehicle T91317 Supplementary Figure S4. Liver weight and Srebf1 expression of T91317-treated mice. (a) Liver weight of vehicle or T91317-treated 8-wk-old KI +/+ male mice. Values are the means ± s.e.m. (n = 6, **p<1 by Student s t-test). (b) Liver weight of vehicle or T91317-treated 8-wk-old WT male mice (n=4, **p<1 by Student s t-test). (c) Quantitative real-time PCR analysis of Srebf1 in the liver of vehicle or T91317-treated 8-wk-old WT male mice (n=4, **p< 1 by Student s t-test).
7 a b c ABCA1 (%) ** Mature SREBP-1 (%) 15 1 *** * 5 SRC1 (%) * d e f PCK1 (%) CREB (%) 1 5 G6Pase (%) 1 5 Supplementary Figure S5. The expression levels of cholesterol and glucose metabolic genes. The protein expression levels of ABCA1 (a), SREBP-1 (b), SRC1 (c), PCK1 (d), CREB (e) and G6Pase (f) in the liver of 8-wk-old WT, KI +/- and KI +/+ male mice by densitometry. The expression levels were normalized with β-actin or TF2B expressions. The expression levels of WT mice were set at 1%. Values are mean ± s.e.m. *p < 5, **p<1 ***p < 1 compared with WT by one-way analysis of variance (a-d; n=6, e and f; n=3).
8 Insulin LXR ligand SREBF1c mir-33b LXRE SRE SREBF1c mrna mir-33b SRE SREBP-1 responsive gene FASN, ACC, SCD1 Supplementary Figure S6. Proposed feedback mechanism to regulate SREBP-1 level by intronic mir-33b.
9 2b 35.2 kb 19.6 kb 1.7 kb 4.8 kb 6.6 kb 2c 3 bp 2d 3 bp 1 bp 5 bp 2 bp 1 bp 5 bp 4a ABCA1 Precursor SREBP-1 2 kd 116 kd 97 kd 4b SRC1 2 kd 116 kd short exposure 116 kd 97 kd PCK1 CREB 36 kd 31 kd Mature SREBP-1 long exposure β-actin 42 kd CPT1a 97 kd G6Pase 36 kd 31 kd β-actin 42 kd AMPKα 97 kd 5a TF2B 36 kd 2 kd 42 kd 116 kd β-actin 42 kd ABCA1 ABCG1 β-actin S2a 35.2 kb 19.6 kb 1.7 kb 6.6 kb 4.8 kb Supplementary Figure S7. Scans of the original blots in figure 2b, 2c, 2d, 4a, 4b, 5a and S2a.
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSrebp2: A Master Regulator of Sterol and Fatty Acid Synthesis
Srebp2: A Master Regulator of Sterol and Fatty Acid Synthesis Blair B. Madison Division of Gastroenterology, Washington University School of Medicine, Saint Louis, MO 63110. Corresponding Author: Blair
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationAdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationBalancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationCommensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis
Supplementary Information Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation in Atherosclerosis Kazuyuki Kasahara 1,, Takeshi Tanoue 3, Tomoya Yamashita 1,*, Keiko
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationFigure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationTransgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
More informationA. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype
Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationThe ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat
The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat Tomomi Yamazaki, 1 Kyoko Kishimoto, and Osamu Ezaki 1,2 Department of Nutritional Science, National Institute of Health
More informationSupplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplementary Figure 1 Role of Elovl6 in mammalian fatty acid synthesis and hepatic insulin sensitivity. (a) Schematic representation of the pathways
ε Supplementary Figure Role of Elovl6 in mammalian fatty acid synthesis and hepatic insulin sensitivity. (a) Schematic representation of the pathways controlling long chain fatty acid synthesis. Elovl6
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationA total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in
Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationSUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationOil Palm Phenolics and Diabetes: Lessons from the Nile Rat
Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Julia Bolsinger, Andrzej Pronczuk, Ravigadevi Sambanthamurthi, KC Hayes Hayes Laboratory and MPOB 5/21/213 The Nile grass rat (Arvicanthis niloticus)
More information