Supplemental Methods Supplemental Table 1. Supplemental Figure 1. Supplemental Figure 2. Supplemental Figure 3. Supplemental Figure 4.

Similar documents
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

Supplementary Figure 1

Supplementary Figure 1 a

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

Supplementary Document

Supplementary Materials

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Appendix

Supplementary Figure 1a

Supplementary Materials and Methods

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figures

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Beta Thalassemia Case Study Introduction to Bioinformatics

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

SUPPLEMENTARY RESULTS

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

SUPPORTING INFORMATION

BIOLOGY 621 Identification of the Snorks

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

Nature Immunology: doi: /ni.3836

SUPPLEMENTARY INFORMATION

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

Supplementary Figure 1

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Figure 1

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

Viral hepatitis, which affects half a billion people

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Supplemental Figures: Supplemental Figure 1

Supplementary Figure S1

SUPPLEMENTAL FIGURE 1

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplementary Figure 1

Supplementary Information

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2008

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION

Isolate Sexual Idiomorph Species

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

PATIENTS AND METHODS. Subjects

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

Supplementary Data. Clinical Setup. References. Program for Embryo Donation

Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a*

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Genome-wide identification of TCF7L2/TCF4 target mirnas reveals a role for mir-21 in Wnt-driven epithelial cancer

*To whom correspondence should be addressed. This PDF file includes:

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients

SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplementary information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

The Expression of Integrins in Korean Breast Cancer Patients

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia

TLR3/TRIF signalling pathway regulates IL-32 and IFN-b secretion through activation of RIP-1 and TRAF in the human cornea

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Supporting Information

Supplementary Figures

Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.

SUPPLEMENTARY INFORMATION

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in

SUPPLEMENTARY INFORMATION

Suppression of CUL4A attenuates TGF-β1-induced epithelial-to-mesenchymal transition in breast cancer cells

Supporting Information

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3

SUPPLEMENTARY INFORMATION

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

SUPPLEMENTARY INFORMATION

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)

The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital

Transcription:

Supplemental Methods TGF-B1 ELISA Supernatants were collected from AT2 cells cultured for 1, 2, 3, or 4 days and frozen at -80 degrees C until use in the ELISA. A commercially available mouse TGF-B1 Duo Set was used according to the manufacturer s instructions (R&D Systems, Minneapolis, MN). Latent TGF- β1 was calculated by subtracting active TGF-β1 from total TGF-β1. Supplemental Table 1. Primers used for real time RT-PCR. Forward 5-3 Reverse 5-3 18s CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT Has1 GCCCTCCTCCTTCCTTCGT GTATAGCCACTCTCGGAAGTAAGATTGG Has2 TCATGGGTAACCAATGCAGTTTT TTTAGTTGCATAGCCCAGACTCAA Has3 CCTATGAATCAGTGGTCACAGGTTT TGCGGCCACGGTAGAAAA Hyal1 GTGCTGCCCTATGTCCAGAT ATTTTCCCAGCTCACCCAGA α-sma GCGTGGCTATTCCTTCGTTAC GGCCATCTCATTTTCAAATC C Spc CAGCTCCAGGAACCTACTGC CACAGCAAGGCCTAGGAAAG vimentin TTGATACCCTACAGCCCTGG AAGAGTGGCAG GG CTGGA E-cad ATG GGG CAC CAC CAT CAC CTGGGTACACG TGGGAAAC WISP-1 GTC CTG AGG GTG GGC AAC AT GGG CGT GTA GTC GTT TCC TCT Supplemental Figure 1. AT2 were 92.9 +/- 3.2% pure at isolation and 100% positive for pro-surfactant protein C in static culture after 4 days. A. Pap stain and B. anti-pro surfactant protein C staining of alveolar type II epithelium. Supplemental Figure 2. Size of sonicated Healon. Lane 1. High molecular weight hyaluronan ladder. Lane 2. Low molecular weight hyaluronan ladder. Lane 3. Blank. Lane 4. Sonicated Healon. Supplemental Figure 3. mrna expression of Wnt/beta-catenin responsive genes. A. There was a trend for CCND1 gene expression increase with stretch, which did not reach statistical significance. B. WNT10a gene expression was not significantly changed with stretch. C. TCF4 gene expression was significantly increased with stretch compared to all other groups. D. SRFP1 gene expression was significantly increased with stretch compared to static CD44-/- cells. Data are presented as mean +/- standard error. N=3 per group, *p<0.05 as calculated by one way ANOVA with Tukey post-hoc analysis. Supplemental Figure 4. TGF-β1 induced EMT is separate from mechanical stretch. A. TGF-β1 ELISA results show that there is no significant increase in active or latent TGF-β1 in stretched cultures compared to stretch. B-D. Gene expression of AT2 CD44-/- cells exposed to TGF-β1 or stretch. B. E-cadherin gene expression is not significantly changed in CD44-/- cells treated with TGF-β1. C. Vimentin gene expression is significantly increased in CD44-/- cells treated with TGF-β1 compared to statically cultured cells and stretched cells. D. Alpha-SMA gene expression was significantly increased in CD44-/- cells treated with TGF-β1 compared to statically cultured and stretched cells. E-G. Gene expression of AT2 MyD88-/- cells exposed to TGF- β1 or stretch. E. E-cadherin gene expression was significantly reduced in MyD88-/- cells treated with TGF-β1 compared to stretched cells. F. Vimentin gene expression is significantly increased in MyD88-/- cells treated with TGF-β1 compared to statically cultured cells and stretched cells. G. Alpha- SMA gene expression was significantly increased in MyD88-/- cells treated with TGF-β1 compared to

statically cultured and stretched cells. Data are presented as mean+/- standard error. N=3 per group, *p<0.05, **p<0.01, ***p<0.001 as calculated by one way ANOVA with Tukey post-hoc analysis. Supplemental Figure 5. TGF-β1 blockade does not affect stretch-induced or hyaluronan-induced EMT. Cells were stretched for 4 days according to experimental protocol, or exposed to short-fragment hyaluronan at 0.2 mg/ml for 4 days with either anti- TGF-β1 antibody treatment, or IgG control treatment. As evident from western blot detection of αsma, vimentin, and E-cadherin after 4 days incubation, TGF-β1 blockade has no consistent effect on either stretch-induced or sha-induced EMT marker expression.

Supplemental Figure 1

Supplemental Figure 2

Supplemental Figure 3.

Supplemental Figure 4.

Supplemental Figure 5.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback