Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Similar documents
Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

Supplementary Table 1.

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Supplementary Information Titles

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Supplementary Figure 1.

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figures

Supplementary Figure S1

SUPPLEMENTARY INFORMATION

TLR4 links innate immunity and fatty acid induced insulin resistance

3-Thia Fatty Acids A New Generation of Functional Lipids?

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Supplementary Materials

Nature Immunology: doi: /ni Supplementary Figure 1

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk

Supplementary Materials for

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Small molecule inhibitors of PKR improve glucose homeostasis in obese,

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Metabolic Syndrome. DOPE amines COGS 163

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Protein extraction and western blot analysis Protein extraction was performed as

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1

Baf60c drives glycolytic muscle formation and improves glucose homeostasis through Deptor-mediated Akt activation

Tissue inflammation and nitric oxide-mediated alterations in cardiovascular function are major determinants of endotoxin-induced insulin resistance

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

Successful completion of Phase I clinical trial of AMPK activator O304

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Modulation of TRP channels by resolvins in mouse and human

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figure 1

2.5. AMPK activity

Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego

Nature Medicine: doi: /nm.3922

SUPPLEMENTARY INFORMATION

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

Nature Immunology: doi: /ni Supplementary Figure 1

Interplay between FGF21 and insulin action in the liver regulates metabolism

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplementary Information

Plasma exposure levels from individual mice 4 hours post IP administration at the

human epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity

Supplementary Figure 1.

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

A 2B Adenosine Receptors Prevent Insulin Resistance by Inhibiting Adipose Tissue Inflammation via Maintaining Alternative Macrophage Activation

NAFLD AND TYPE 2 DIABETES

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Transcription:

Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell, Emmanuelle St-Amand, Bruno Marcotte and André Marette. Supplementary Figures - Nature Medicine: doi:./nm.9

Supplementary Figure BLOOD SAMPLE LEGEND ο Pre-infusion sample Pre-clamp sample Clamp samples Post clamp sample H-Glucose Bolus.µCi Kg Insulin Bolus mu Kg - - ο - µg or icle µg or icle Insulin (mu kg min - ) % dextrose variable - - H-Glucose (.µci min ) + RBC (.ml h ) hour intravenous Lipid or Saline infusion (ml kg h - ) Supplementary figure. Lipid-infusion hyperinsulinemic-euglycemic clamp schema. h fasted mice were infused with lipid or saline for h. Prior to the initiation of the infusion a blood sample was drawn to determine pre-infusion glycemia and FFA's. At t= min the tracer stabilization period of the clamp procedure was begun. Immediately prior to the stabilization period a blood sample was taken to determine pre-clamp glycemia and insulinemia. The clamp was begun at t= min with infusion of insulin. Groups were administered µg of or equal volumes of vehicle immediately prior to the infusion and at t=. Nature Medicine: doi:./nm.9

Supplementary Figure a Saline Lipid Lipid + µg ml c Percent palmitate Plasma adiponectin Palm Palm + -nm Palm + -nm Nitrite production b pg ml d IL- Palmitate (nm) inos pjnk Thr/Tyr JNK Palm Palm + -nm Palm + -nm IL- ng ml - - + + + + + + - - - - CCL CCL TNF-α IL- Mθ protein (AU).... inos ND Palm Palm + -nm Palm + -nm pjnk/jnk Supplementary figure. dampens lipid-induced inflammation in macrophages. (a) Plasma adiponectin in clamped saline-vehicle, lipid-vehicle and lipid- treated mice. Data are mean ± s.e.m., and are representative of mice per group. (b) Chemokines, cytokines (c) and nitrite in media of J77A. macrophages exposed to vehicle () or palmitate (µm) for h in the presence or absence of. (d) Immunoblots for inos, pjnk Thr/Tyr, and total JNK in palmitate-treated macrophages. Quantitation of densitometry analyses are shown besides the representative gels Data are mean ± s.e.m., and are representative of independent experiments. P<., P.<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9

Supplementary Figure a b c µg g tissue.... Saline Lipid Lipid + Liver IL- Fold vehicle....9.. IL- in media Nor Fold vehicle....... -nm -nm -µm IL- mrna d IL- in media (fold veh) -nm -nm -µm LPS e pampk Thr7 AMPK Mθ protein (AU) - nm -nm -µm - µm min h h pampk/ampk f 9Z E Z E 7Z Z 7(S) (S) CO PD RvD DiHETE 9Z Z E E 7Z Z CO 7(S) (R) PD 7(S) (R) 9Z E Z E 9E Z CO Fold vehicle 7(S) RvD (S) E Z 9E (S) Z CO (S)(S)DiHETE IL- in media Nature Medicine: doi:./nm.9

Supplementary figure. selectively induces skeletal muscle IL-. (a) IL- protein in liver from clamped saline-vehicle, lipid-vehicle and lipid- treated mice. Data are mean ± s.e.m., and are representative of mice per group. (b) IL- protein in media of T7i brown adipocytes treated with vehicle (), norepinephrine (Nor, µm) or ( nm) for h. Data are mean ± s.e.m. of independent experiments. (c) IL- mrna (h) and (d) IL- protein in media of J77A. macrophages treated with, or LPS (ng/ml). Data are mean ± s.e.m. of independent experiments. (e) Immunoblots of pampk Thr7 and total AMPK in J77A. macrophages treated with or. Quantification of densitometry analyses are shown below the representative gels. Data are mean ± s.e.m. of independent experiments.(f) IL- in media of CC myotubes treated with or nm of, PD, RvD or (S) (S) DiHETE (DiHETE) for h. Data are mean ± s.e.m. of independent experiments. Chemical structures of, PD, RvD and (S) (S) DiHETE are shown to the left. Structures shared with are colored red while strucutures colored in blue represent a common feature that is the same distance from the methyl end but not the carboxyl terminal of the fatty acid chain due to a difference in chain length. For all figures P<., P<., P<. vs vehicle calculated using analysis of variance. Nature Medicine: doi:./nm.9

Supplementary Figure a Glycemia (mm) - - - - Glycemia (mm) b GIR (mg kg min ) 7 - - - - 7 GIR (mg kg min ) Pre-clamp glycemia c Time (min) - - - - d Time (min) Glucose infusion rate Fold increase in Rd % suppression of HGP pg g tissue - - - - Peripheral insulin action Hepatic insulin action Muscle IL- e f - - - - g pstat Ser77 pampk Thr7 Liver protein (AU) STAT... Relative expression Muscle protein (AU) AMPK pstat/stat Ppargc Pck Gpc pampk/ampk Nature Medicine: doi:./nm.9

Supplementary figure. IL- is required for the glucoregulatory actions of. (a) Pre-clamp glycemia (left) and clamp glucose excursion (right), (b) glucose infusion rate (GIR) (left) and mean GIR for the final min of clamp (right) in wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. (c) Peripheral insulin action expressed as fold increase in Rd during the clamp (left) and hepatic insulin action expressed as percent suppression of hepatic glucose production (HGP; right), (d) Skeletal muscle IL- content (e) Immunoblots for pstat Ser77 and total STAT and (f) relative mrna expression of Ppargc, Pck and GPc normalized to GAPDH in liver from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. (g) Immunoblots for pampk Thr7 and total AMPK in gastrocnemius muscle from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. Quantification of densitometry analyses for immunoblots is shown below the representative gels. Dotted lines indicate that lanes were run on the same gel but were noncontiguous. -, wild-type saline-infused vehicle, n = mice. -, wild-type saline-infused, n = mice. -, IL- null saline-infused vehicle, n = mice. -, IL- null saline-infused, n= mice. Data are mean ± s.e.m, P<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9

Supplementary Figure a pakt Ser7 Akt b Fold vehicle -nm -nm -µm IL- in media c pampk Thr7 AMPK CC protein (AU) nm nm pampk/ampk µm -nm -nm -µm d e pstat Ser77 STAT pg ml - - -LV -LP Plasma TNFα Supplementary figure. mediated activation of AMPK is IL- independent. (a) Immunoblot for pakt Ser7 and total Akt in liver from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated mice. Dotted line indicates that lanes were run on the same gel but were noncontiguous. (b) IL- in media and (c) immunoblots for pampk Thr7 and total AMPK in CC myotubes treated with vehicle () or for min. Quantification of densitometry analyses is shown below representative gels. Data are mean ± s.e.m. of independent experiments. (d) Plasma TNF-α from clamped saline (S) or lipid-infused (L) IL- null () mice treated with vehicle (V) or (P). Data are mean ± s.e.m. -, IL- null saline-infused vehicle, n =. -, IL- null saline-infused, n =. -LV, IL- null lipid-infused vehicle, n =. -LP, IL- null lipid-infused, n =. (e) Immunoblot of pstat ser77 and total STAT in liver of vehicle () or acute -treated genetically obese diabetic db/db mice. P<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9

Supplementary Figure a c e pg mg ewat Glycemia (mm) GIR (mg kg min ) Pre-clamp glycemia Time (min) Glycemia (mm) pg mg ewat,,, GIR (mg kg min ) Time (min) Glucose infusion rate f pg ml b Insulin (ng ml ) d pg µg protein Pre-clamp Post-clamp Muscle IL- pg ml ng ml 9 Plasma IL- Nature Medicine: doi:./nm.9

Supplementary figure. Chronic therapy improves insulin sensitivity in db/db mice. (a) Pre-clamp glycemia (left) and clamp glucose excursion (right), (b) Pre and post-clamp insulin and (c) glucose infusion rate (GIR) (left) and mean GIR for the final min of clamp (right) in vehicle (veh) and chronic -treated 7 week old genetically obese diabetic db/db mice. (d) Skeletal muscle (left) and plasma (right) IL- content, (e) Chemokines and cytokines in epididymal white adipose tissue (ewat) and (f) plasma of clamped vehicle (veh) and chronic -treated genetically obese diabetic db/db mice. Data are mean ± s.e.m., and are representative of mice per group. P<. calculated using student's t-test. Nature Medicine: doi:./nm.9