NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

Similar documents
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

T H E J O U R N A L O F C E L L B I O L O G Y

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Studying apoptosis in DT40 cells

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Osteoblast Play an Essential Role in Periodontal Bone Loss Through Activation of

Supplementary Materials

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Prediction of invasiveness of hepatic tumor cells

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Supplementary figure legends

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on

SUPPLEMENTARY INFORMATION

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Tbk1-TKO! DN cells (%)! 15! 10!

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplemental Figure 1

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Material

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

SUPPLEMENTARY FIGURES AND TABLE

A. Generation and characterization of Ras-expressing autophagycompetent

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Supplementary material Legends to Supplementary Figures Figure S1. Figure S2. Figure S3.

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Supplementary Materials for

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supporting Information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

LPS LPS P6 - + Supplementary Fig. 1.

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Supplementary Figure S1 Supplementary Figure S2

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

Supplementary Materials and Methods

Supplementary Materials for

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Supplementary Materials

SUPPLEMENTARY INFORMATION

Figure S1, Beyer et al.

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

T H E J O U R N A L O F C E L L B I O L O G Y

supplementary information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

ciap using fragment based drug discovery

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

Nature Medicine: doi: /nm.4078

Rapid parallel measurements of macroautophagy and mitophagy in

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.

Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes

Supplementary Materials for

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

Supplementary Table 1. List of primers used in this study

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Transcription:

NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following oligonucleotides were used to amplify NLRX1 and β-actin: NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin 5'-GTGGGGCGCCCCAGGCACCA-3 (forward) 5'-CTCCTTAATGTCACGCACGATTTC-3 (reverse) Tattoli et al. Figure S1

A C HIF activation (fold) AP-1 activation (fold) 25 2 15 1 5 4 35 3 25 2 15 1 5 CTR CTR PMA HIF NLRX1 NLRX1 B p53 activation (fold) 6 5 4 3 2 1 CTR p53 NLRX1 Supplementary Figure 2: NLRX1 overexpression does not trigger AP-1-, p53- or HIFdependent pathways. HEK293T epithelial cells were transfected with increasing amounts (1, 1 and 25 ng) of NLRX1 expression vector together with AP-1- (A), p53- (B) and hypoxia inducible factor- (HIF) (C) luciferase-reporter constructs. Different positive controls were used, depending of the luciferase-reporter construct used: PMA (A; 1 and 1ng/ml) or p53 (B) and HIF-1α (C) expression vectors (transfection of 2 or 2 ng). Data show the mean ± s.e.m of duplicates and is representative of three independent experiments. CTR, control. Tattoli et al. Figure S2

% Caspase-3 Activation 4 35 3 25 2 15 1 5 -NLRX1 +NLRX1 % caspase-8 Activation 4 35 -NLRX1 3 +NLRX1 25 2 15 1 5 CTR Staurosporine CTR TNF+CHX Supplementary Figure 3: NLRX1 overexpression does not significantly alter apoptosis. HeLa cells were transfected overnight with NLRX1 and stimulated for 2 hours with either 2 µm staurosporine (left panel) or TNF (1 ng/ml) plus cycloheximide (CHX;,5 µg/ml) (right panel). Activation of caspase-3 and caspase-8 were quantified by immunofluorescence using antibodies that detect the cleaved caspase-3 and cleaved caspase-8 in cells over-expressing or not NLRX1. The expression of NLRX1 was determined using an antibody against the FLAG epitope. For each experiment, a minimum of 2 cells were quantified, and the results presented are representative of three independent experiments. Tattoli et al. Figure S3

A B Supplementary Figure 4: Kinetics of reactive oxygen species production following Shigella infection or TNFα stimulation for up to 3h in cells over-expressing NLRX1. HeLa cells were transfected overnight with pcdna3 or NLRX1 vectors and infected for 3 hours with Shigella (left panel) or stimulated for 3 hours with 1 ng/ml TNFα (right panel). ROS production was measured using a redox-sensitive dye (CM-H 2 DCFDA) on live cells, followed by flow cytometry analysis. (B) Time-course analysis of ROS production induced by Shigella (left panel) and TNFα (right panel) in cells transfected with pcdna3 or NLRX1, as in (A). The results presented are representative of three independent experiments. Tattoli et al. Figure S4

NLRX1 NF-κB p65 DAPI Merge NLRX1/NF-κB p65 Supplementary Figure 5: HeLa cells grown on glass coverslips were transfected overnight with NLRX1 expression vector and infected with Shigella or stimulated with 1 ng/ml TNFα for 1 hour. NLRX1 over-expressing cells were stained using a monoclonal anti-flag antibody, and a polyclonal anti-nf-κb p65 antibody was used to assess the cellular localization of this NF-κB subunit. Cells in which the NF-κB is activated display nuclear localization of NF-κB p65. DAPI was used to stain nuclei. Such experimental set-up was used to perform quantification analyses presented in Figure 4C-D. Note that for quantification purposes, fields were picked randomly and > 5 cells (from 3 independent experiments) per condition/time point were analyzed for NLRX1 over-expression and NF-κB p65 nuclear translocation. Tattoli et al. Figure S5

% cells with nuclear NF-kB p65 8 7 6 5 4 3 2 Shigella infection 1 NLRX1 ΔN-ter +cells NLRX1 ΔN-ter -cells 15 3 45 6 12 (time) % cells with nuclear NF-kB p65 1 9 8 7 6 5 4 3 TNF stimulation 2 NLRX1 ΔN-ter +cells 1 NLRX1 ΔN-ter -cells 15 3 45 6 12 (time) Supplementary Figure 6: NLRX1 localization to the mitochondria is critical for the modulation of Shigella- and TNF-dependent NF-κB activation. HeLa cells grown on glass coverslips were transfected overnight with NLRX1 ΔN-ter expression vector and infected with Shigella (left) or stimulated with 1 ng/ml TNFα (right) for various times, as indicated. The nuclear translocation of NF-κB p65 subunit (as an indicator of the activation of the NFκB pathway) was evaluated by immunofluorescence in cells over-expressing NLRX1 ΔN-ter (NLRX1 ΔN-ter +cells) or not (NLRX1 ΔN-ter -cells). Data show the mean ± s.e.m of three independent experiments, and for each condition and time point, a minimum of 5 cells were counted. Tattoli et al. Figure S6