Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p<.1 H O (LB) 1 µm GlcN (LB) H O (NGM) 1 µm GlcN (NGM) H O (1) 1 µm GlcN (1) 1 1 3 3 d 1 p<.1 Douling Time [min] H O () 1 µm GlcN () 1 1 3 3 LB e 1 p<.1 H O (3) 1 µm GlcN (3) 1 1 3 3 f 1 p<. H O (linded) 1 µm GlcN (linded) 1 1 3 3 g 1 p<.1 H O (HIT ac) 1 µm GlcN (HIT ac) 1 3 Supplementary Figure 1: Details of C. elegans lifespan assays Growth characteristics of E. coli OP in oth LB and NGM media, respectively, depicted a as a photometrically determined growth curve and organismal douling time (for LB media only, since no significant growth in NGM media). c-e Individual lifespan results of data summarized in Fig. 1 (p<.1, log-rank test, n=1 each). f Typical lifespan result for experimental setting where experimenter was unaware of GlcN content or control, respectively (p<., log-rank test, n=1). g Lifespan result using heat-inactivated acteria (p<.1, log-rank test, n=1). Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
Supplementary Figure a c d e f p interact. <.1 p interact. =. p interact. =.31 Food uptake [g/d] 3 1 * Food uptake [g/d] 3 1 Plasma GlcN [µmol/l] 3 1 * Plasma GlcN [µ mol/l] 3 1 ** GlcN--PO * GlcN--PO g h i j p interact. =.19 p interact. =.13 Body Mass [g] 3 1 Body Mass [g] 33 3 1 33 Fat [g] 1 1 Fat [g] 1 1 33 33 k l m n p interact =. p interact =.3 Lean Mass [g] 3 1 33 Lean Mass [g] 3 1 33 mtdna / ndna 1. ***..... mtdna / ndna 1...... p interact =. o p EE / MBM [kj/h/kg] 11 1 9 7 p=.9 1 Time [hrs] EE / MBM [kj/h/kg] 1 9 7 1 Time [hrs]
Supplementary Figure continued Supplementary Figure : Sex specific results of mouse phenotyping part 1 a Food uptake of a female (lue: p<., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and male C7BL/-NRj mice chronically exposed to GlcN (red), and respective controls (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)=., p<.1, n= 17 control mice and n= GlcN-fed mice). c Plasma levels of GlcN in female (lue: p<., Student s t-test, n= 1 control mice and n= 9 GlcN-fed mice) and d male mice (lue: p<.1, Student s t-test, n= control mice and n= 1 GlcN-fed mice) on a GlcN-containing diet in comparison to control mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)= 1.9, p=., n= 1 control mice and n= 19 GlcN-fed mice). e Hepatic levels of GlcN--phosphate in female (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice) and f male mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,1)= 1.7, p=.31, n= 1 control mice and n= 1 GlcN-fed mice). g-l Body mass (lack: interaction etween gender and treatment, two-way ANOVA, F (1,3)=.71, p=.19, n= 1 control mice and n= GlcN-fed mice), ody fat (lack: interaction etween gender and treatment, twoway ANOVA, F (1,3)=., p=.13, n= 1 control mice and n= GlcN-fed mice) and lean mass (lack: interaction etween gender and treatment, two-way ANOVA, F (1,3)= 1.1, p=., n= 1 control mice and n= GlcN-fed mice) female and male mice. m-n Relative content of mitochondrial DNA in liver specimen of m female (lue: p<.1, Student s t-test, n= control mice and n= GlcN-fed mice) and n male mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,1)= 11.39, p=.3, n= 1 control mice and n= 13 GlcN-fed mice). o-p Energy expenditure normalized to metaolic ody mass of o female (lue: p=.9, Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and p male mice calculated means for every hour during day, grey area reflects dark phase of the light cycle (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)= 3.1, p=., n= 17 control mice and n= GlcN-fed mice). Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
Supplementary Figure 3 a c f i l 1 1 1 1 Time After Glucose Injection [min] 1 1 3 1 g m d 1 p=. p=. Random 1 Fasted fed 1 1 1 1 Time After Glucose Injection [min] 1 1 3 1 e 1 Random 1 Fasted fed 1 1 1 1 Time After Glucose Injection [min] 1 1 j k * * * 1 Time after Insulin Injection [min] p interact. =.9 p interact. =. h p interact. =. p interact. =.1 3 1 1 1 Time after Insulin Injection [min] Time after Insulin Injection [min] p n interact. =.7 p interact. =.3 * * o Triglyceride/ Protein u Cholesterol 3 1 1. 1..... 1. 1... p v Cholesterol Triglyceride/ Protein 1. 1..... 1. 1... q p interact. =.7 Triglyceride/ Protein r.... w p interact. =.9 x y z p interact. =.. 1 1 1. 1. 1 1 1 1... Cholesterol 3 1 1. 1.. FFA ALT [U/I].. 1. 1.. s FFA ALT [U/I] 3 1.. 1. 1.. t ALT [U/I] 7 p interact. =.3.. 1. 1.. FFA
Supplementary Figure 3 continued Supplementary Figure 3: Sex specific results of mouse phenotyping part a Blood glucose values of female mice chronically exposed to GlcN (red) in the random fed (lue: p=., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and fasted state (lue: p=., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice). Blood glucose values of male mice chronically exposed to GlcN (red) in the random fed and fasted state (lack: interaction etween gender and treatment, two-way ANOVA, random fed: F (1,3)=., p=.9, n= control mice and n= GlcN-fed mice, fasted: F (1,3)=.3, p=., n= control mice and n= GlcN-fed mice). c-h Glucose tolerance tests in mice chronically exposed to GlcN (red). g asolute (left y-axis) and relative values (right y-axis) for the area under lood glucose curve (AUC) for female and h male mice after chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, asolute AUC: F (1,3)= 1., p=., n= 17 control mice and n= 1 GlcN-fed mice, relative AUC: F (1,3)=.3, p=.1, n= 17 control mice and n= 1 GlcN-fed mice. i-n insulin tolerance tests in mice chronically exposed to GlcN (red). i Blood glucose at asal level and 1, 3,,, 7 and 9 min after insulin injection comined for female and male mice (lue: p<., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice). Blood glucose at asal level and 1, 3,,, 7 and 9 min after insulin injection for j female and k male (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice). m asolute (left y-axis) and relative values (right y-axis) for the area under lood glucose curve (AUC) for female and n male mice after chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, asolute AUC: F (1,3)=.1, p=.7, n= 1 control mice and n= 1 GlcN-fed mice, relative AUC: F (1,3)=.1, p=.3, n= 1 control mice and n= 1 GlcN-fed mice. o-q Plasma levels of triglycerides of p female and q male mice and o oth sexes in a comined manner chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=., p=.7, n= control mice and n= GlcN-fed mice. r-t Plasma level of non-esterified/free fatty acids for oth r female and male mice comined, as well as for oth sexes each (s females; t males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.7, p=.3, n= control mice and n= GlcN-fed mice.) u-w Plasma level of total cholesterol for oth u female and male mice comined, as well as for oth sexes each (v females; w males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.3, p=.9, n= control mice and n= GlcN-fed mice.) x-z Plasma level of alanine-aminotransferase for oth x female and male mice comined, as well as for oth sexes each (y females; z males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.1, p=., n= control mice and n= GlcN-fed mice.) Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
Supplementary Figure a c d e f p interact. =.33 p interact. =.3 UDP-GlcNAc 3x1 x1 1x1 UDP-GlcNAc 3x1 x1 1x1 UDP-GlcNAc 3x1 x1 1x1 Urea 1 Urea 1 p=.7 Urea 1 g h i j k l p interact. =.3 p interact. =.11 p interact. =. Succinate x1 3x1 x1 1x1 * Succinate x1 3x1 x1 1x1 CH 3 -utanoyl-coa 3x1 x1 1x1 p=.7 CH 3 -utanoyl-coa 3x1 x1 1x1 CH 3 -crotonyl-coa.x1 1.x1 1.x1.x1 ** CH 3 -crotonyl-coa.x1 1.x1 1.x1.x1 Supplementary Figure : Sex specific results of mouse phenotyping part 3 a-c Concentrations of UDP-N-acetyl-D-glucosamine in liver samples of treated and untreated mice a oth female and male mice comined, as well as for oth sexes each ( females; males) (interaction etween gender and treatment, two-way ANOVA, F (1,1)=., p=.33, n= control mice and n= GlcN-fed mice.) d Urea plasma levels of mice chronically exposed to GlcN (red). e Urea plasma levels of female mice (lue: p=.7, Student s t-test, n= 9 control mice and n= 9 GlcN-fed mice) and f male mice (interaction etween gender and treatment, two-way ANOVA, F (1,3)=., p=.3, n= 1 control mice and n= 1 GlcN-fed mice.) g liver succinate levels of female (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice) and h male mice (interaction etween gender and treatment, twoway ANOVA, F (1,1)= 1., p=.3, n= 1 control mice and n= 1 GlcN-fed mice.) i Hepatic levels of methyl-utanoyl-coa of female (lue: p=.7, Student s t-test, n= control mice and n= GlcN-fed mice) and j male mice (interaction etween gender and treatment, two-way ANOVA, F (1,1)=.79, p=.11, n= 1 control mice and n= 1 GlcN-fed mice.) k levels of methyl-crotonyl-coa in liver specimen of control and GlcN-fed female (lue: p<.1, Student s t-test, n= control mice and n= GlcN-fed mice) and l male mice, respectively (interaction etween gender and treatment, two-way ANOVA, F (1,1)=.7, p=., n= 1 control mice and n= 1 GlcN-fed mice.). Controls are always depicted in grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
Supplementary Figure aak- ctrl GlcN ctrl GlcN pmk-1 a KO h h 1h 1h KO c aak- ctrl GlcN ctrl GlcN pmk-1 KO h h 1h 1h KO p-ampk aak- N (wt) ctrl GlcN p-ampk ( kda) ( kda) ( kda) ( kda) d e pmk-1 ctrl GlcN KO h h f pmk-1 ctrl GlcN KO h h pmk-1 N (wt) p-p3 ctrl GlcN (3 kda) ( kda) p-p3 (3 kda) ( kda) g h GlcN (h).. 1 1 3 3 GlcN (h).. 1 1 3 3 p-ampk ( kda) p3 AMPK AMPK ( kda) (3 kda) ( kda) p-p3 (3 kda) p3 (3 kda) ( kda) GlcN (h) i GlcN (h).. 1 1 3 3.. 1 1 3 3 j GlcN (h).. 1 1 3 3 p-ampk ( kda) ( kda) p-p3 (3 kda)
Supplementary Figure continued Supplementary Figure : Memrane scans of Western lots depicted in manuscript main figures a-f Immunolotting against phospho-ampk und phospho-p3 in aak--ko, pmk-1-ko and wildtype worms treated with GlcN and respective controls. Immunolotting against α-tuulin was used to normalize protein amount. g-j Immunolotting against phospho-ampk, total AMPK, phospho-p3 and total p3 in HepG-cells treated with GlcN. Immunolotting against α-tuulin was used to normalize protein amount. The memranes showing immunolotting of HepG cells were used to detect the signal of several memranes using the same antiody.
Supplementary Tale 1 RNAi Sequences F1D.1 cdna (ORF) ATGGATCTCACTGTTCCAGTTGAATATTCACGTGCCGGTAACACAACTCACAGCGGTAATGTGCATGCCATTCAAGA CGATGAGAAATTCTCGTATGGAACTGCTGGATTCCGATTCAAGTCCGAGAAGCTTCCATTCATCGTCTTCCGGTGTGC TTACGTTGCGAGTCTTCGTGCGCGGCAGCTCAACTCAGCTATCGGAGTGATGATTACAGCTTCACACAATCCATCATG TGACAATGGTGTGAAATTAGTGGATCCAAGTGGCGATATGCTCAATGAGCAGTGGGAGATATACGCGACTGAAGTTGT GAATGCTACTGATGCCGAGCTCCCAGCCGCAGTTCGAGCTCTTGAAAAACAAATTTCAGTCGGAAAGACCCAACTTTC CCGTGTCGTTTGTGGTATGGACACACGTTGCTCTGGTCCTTGTCTGATGAATGCAGCAAGAGCCGGTGCAGCGTTATT CAATGTACAATTCGATGATATCGGTGTTGTGTCGACTCCAATGCTTCATTATGCTGTCAAGGCATTCAACGAGCCAAAA TTCGCAGAGCCAACTCACGATGGATATTATTCTGCAATCGCCGATTCGTTCAAGAAGCTGTATGAAATAACTGAGGAAC CCAAAGACTCGAGATATCAACCAAAAGTCATTGTCGATTGCGCAAACGGAGTCGGTGCTCCACGGTTCAGAAATCTTC TTGAGCGAATCCCATCATCACTTCTGGAAGTTGAATTTCGTAATGAATCGGAAGAACTGAATCAGGGATGTGGTGCCG ATTTCGTTAAGATTTCGCAAAAGTTACCAGCAAACTTCTCACCGACAGCAGCAGAACCAAAATGTGCTTCATTTGATGG AGATGCCGATCGCTTGATGTACTTCCGTGCAAAGGCTTCAGAAAATTCGGAATCAAACGATGCTGAGCTGTTCGACGG TGACAAAATTGCAGTTCTGATTGTCACATACATTCGGGAGCAACTGAAGGATTACGAAAATTCCACTCCGATGGAACGT CTCCGCCTTGGTATTGTTCAAACAGCATATGCGAATGGAAGTTCAACACGCTACATTCGTGAAAAGTTGGGTATTGAGC CAATTATTGTACCTACTGGAGTCAAGCATCTGCATGAAGCTGCTTCTGAGTTCGACATTGGAATTTATTTCGAGGCCAA CGGACACGGAACTGTTGTTTTCAGCGAGATTTTCGACCGCATCATCAGAAGAACTCCAACTGAATCATTACCTCTCCGT CGTCTAGCACTTTTCTCCCGTGTCATCAATGAAACTGTTGGGGATGCTTTTGCAGATTTGCTTGCCGTGGAAGCTGTTC TCCGTCACTATGGATGGTCTATGGATGACTGGGCCGAAAAACTGTATCGAGATGTTCCGAATGTGCAGATCAAAGTTC CAGTTATTGATCGTTCCATTTTCAAAACGACGAACGCCGAGCAAACTCTTGTGAAACCTGTTGGAATTCAAAAAATGAT TGATACGGATGTTGCAAAGTACAATAATTCGAGAGCTTTCATCAGACCATCTGGCACCGAGAACATTGTTCGCGTATAC GCTGAAGCGGATACTGTTGAAAATACATTGCAACTCGGAAAATCTCTCGAACAAGTCGTTCTCAACCTTTGCAACTCGA ACTGA aat-1 (Ahringer lirary) CAAGAGCGATACATCCAGCAAGGAAAATAGCTGGCCAAATGAGTGGAACTTTAATTGGTCTTGATGCATCTGGCATG GTTCTACGAAGCCAGAAGAGTGCGGCAATGGCTGTTCCGATTGCAAGCCAGTAACTGATCTAGAAAATGAAAGTTTCT TGTTCGAGAACATGCATATTTTTTGAAGCTTGAATTCAAGCTTCTAAAATTGATGCTTCAAGAAACTCAGTACCGGGAAA TATTAAAAAAAAAAAGCTATCACACTTACTTGAATATAATTAATCAATTGATACACATCCTTTGATGCCAACAAGTAAGCA ATAGAAAGAGCTCCGGTAAGAATAACAGCGGGAATCGGTGTTTTCGTTTTTTTATTAATCATTGTCAATACAGCTGGCA TTTGTCCTTCACGAGCACCGGAATAAAAAAGTCTCGCTGAAGTGAAAATAACTCCATTAGCTGATCCAATTGTGGAACA TGCAACACAGAGTGGCATAATAAATGCGAATTTTCCATAGAGTTTATTGGCGAAAAGTACCGCTACAGCCGGGGATTC GAGCATTTCATCTGGTGAAATTGCTGTGTAGAGAGCCACATTAGTTAGCACGTAGATTACGGTACAGGATGTGATAGA GATGGCAATTGCGAGTGGAAGGTTTCTGAAAATTATGGTATAAGAAAATAAATAATATATCGTTAAATTTTTTTTACTGTT TCATAATGCAATTAGAACCTAAAATAATTTGCTAGATTAATTGACAAGTATTCTACAACAGATTAAAGTAGACCAATAAAC TACTCATAGTCAGCTCTGAAACTTTAAATAAAAACAATTGGAATGTAAAAACTGTGTTAATGTGTTTCATGTAAACTATAC AATCACTGAAACTTACCGTTTTGGGTTCTGCAACTCCTCGACGATGAAATTCAAGAAATTCCATCCAGAATAAGCGAAT AATCCAGAGTAGAAAGCAAGTGAAACTTTTGTAAAATCTTGAGATGTATTCTCAAAAATATTCTCGAATGAGTCCTTGTA CTGAGATTCACCTGAAATTTTTTATATTTTCTAAATACAGAATAGCTTAAGTGCTCACCAAAGAAAAGGAGACCAAGTCC GGTTAAAATGATAAGACACAGAGCAACAACCTTTGCAA