Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Size: px
Start display at page:

Download "Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT"

Transcription

1 Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg) by tail vein (n=5 males/group, 11 week old). Four days after the injection, mice were fasted for 2 h at the end of the dark cycle, and blood was collected. Plasma lipid levels were measured enzymatically as described in the Methods. () Lipoprotein profiles of Ldlr -/ mice treated with control IgG or REGN15 P<.5, P<.1. Fig. S2. Decreased VLDL-TG secretion in ngptl3 -/- and REGN15-treated mice. () ngptl3 -/- mice and littermate controls (n=5 /group, 1-13 weeks old) were fed ad libitum and VLDL secretion was measured at the end of dark cycle as described in the Methods (Right). ngptl3 -/- mice and littermate controls were synchronized for 3 days with daytime fasting (7: am-7:pm) and nighttime refeeding (7: pm-7: am) (N=4-6 males/group, 6-9 weeks). On day 4, the livers were collected after a 24-hr fast (fasted) or at the end of the dark cycle (refed). Tissue lipid levels were measured as described in the Methods (Left). () VLDL-TG secretion is reduced in REGN5-treated Ldlr -/- mice. Ldlr -/- mice were treated exactly as described in Fig. 5. lood was drawn at the indicated time after Triton WR1339 (5 mg/kg) administration. Plasma was isolated and TG was measured (n=5 males/group, 1 week old). (C) VLDL-TG secretion in fasting mice. WT mice were fasted overnight and REGN15 or control antibody was injected at 8: am. Two hours later, Triton WR1339 (5 mg/kg) was injected into the tail vein and blood was collected and plasma TG levels measured at the indicated times. (D) REGN15 decreased VLDL-TG secretion in WT mice fed a fat-free diet. The feeding of WT mice was synchronized as described in the legend to Fig.5 except that the mice were refed a fat-free diet. On day 4, mice were refed at 7: am and injected with either control antibody or REGN15 at 9: am (n=5 male mice/group, 24 weeks old). Two hours after the injection, Triton WR1339 (5 mg/kg) was injected into 1

2 the tail vein. lood samples were drawn from the tail veins at the indicated time points. Plasma was isolated and TG was measured as described in the Method. P<.5, P<.1, P<.1 Fig. S3. Fatty acid uptake and clearance in REGN15-treated mice. () TG and NEF levels in REGN15-treated mice. () Uptake of NEF in tissues of mice treated with REGN15. WT mice were entrained to a synchronized feeding regimen as described in Fig. 5. On day 4, mice were refed at 7: am and injected 2 hours later with control antibody or REGN15 (1 mg/kg) (n=5 male mice/group, 1 weeks old). fter 2 hours, blood was collected and TG and NEF were measured. Mice were then injected with 1µci 3 H-bromopalmitate and 1µci of 14 C-palmitate. Tissues were collected and analyzed as described in Methods. (C) Tritiated palmitate turnover in REGN15-treated mice. Tritiatedpalmitate complexed with fatty acid free S was infused into the tail vein of the mice over 5 min as described in the Methods. The appearance of radioactivity was monitored in blood samples obtained every min for 7 min. 2

3 Figure S1 Triglyceride (µg/fraction) WT Ldlr -/- WT Ldlr -/- WT Ldlr-/- Cholesterol (mg/dl) VLDL LDL HDL Cholesterol (µg/fraction) 4 NEF (meq/l) 8 VLDL LDL HDL po-48 (.U) Fractions po-1 (.U) Fractions

4 Figure S /+ ngptl3 -/- Hepatic Triglyceride (mg/g) 8 4 +/+ ngptl3 -/- C D E Fasted Refed

5 Figure S3 Triglyceride (mg/dl) romopalmitate Uptake (dpm x 1 3 /1 mg) NEF (meq/l) Heart Liver WT T Muscle Lung Palmitate Uptake (dpm x 1 3 /1 mg) C 14 C-Palmitate (dpm/5 µl plasma) Heart Liver WT T Muscle Lung anti-ngptl Infuse

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

BCH 447. Triglyceride Determination in Serum

BCH 447. Triglyceride Determination in Serum BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Triglyceride determination

Triglyceride determination Triglyceride determination Introduction: - Triglycerides are esters of fatty acids and are hydrolyzed to glycerol and free fatty acids (by lipase) - Triglyceride determinations when performed in conjunction

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

CHAPTER IV RESEARCH METHOD. This study belongs to the field of Internal Medicine, specifically the field

CHAPTER IV RESEARCH METHOD. This study belongs to the field of Internal Medicine, specifically the field CHAPTER IV RESEARCH METHOD 4.1 Research fields This study belongs to the field of Internal Medicine, specifically the field of Infectious and Tropical Disease. 4.2 Research location and period This study

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS

ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS 1 1 1 1 1 1 0 1 ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS Our hypothesis was that many sources of palmitate (NEFA, lipogenesis, diet) could contribute to newly-synthesized VLDL-TG

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

More information

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein

More information

ILDR2: An Endoplasmic Reticulum Resident Molecule Mediating Hepatic Lipid Homeostasis

ILDR2: An Endoplasmic Reticulum Resident Molecule Mediating Hepatic Lipid Homeostasis ILDR2: An Endoplasmic Reticulum Resident Molecule Mediating Hepatic Lipid Homeostasis Kazuhisa Watanabe 1, Elizabeth Watson 1., Maria Laura Cremona 1., Elizabeth J. Millings 1, Jay H. Lefkowitch 2, Stuart

More information

Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats

Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department

More information

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate

More information

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo

More information

Mechanism of hypercholesterolemia produced by biotin deficiency

Mechanism of hypercholesterolemia produced by biotin deficiency J. Biosci., Vol. 13, Number 4, December 1988, pp. 393 399. Printed in India. Mechanism of hypercholesterolemia produced by biotin deficiency ANNIE ABRAHAM and P. A. KURUP* Department of Biochemistry, University

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Niacin Metabolism: Effects on Cholesterol

Niacin Metabolism: Effects on Cholesterol Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342

More information

AN OVERVIEW OF FATTY ACID ETHYL ESTERS

AN OVERVIEW OF FATTY ACID ETHYL ESTERS AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat

The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat Tomomi Yamazaki, 1 Kyoko Kishimoto, and Osamu Ezaki 1,2 Department of Nutritional Science, National Institute of Health

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

THE EFFECT OF VITAMIN-C THERAPY ON HYPERGLYCEMIA, HYPERLIPIDEMIA AND NON HIGH DENSITY LIPOPROTEIN LEVEL IN TYPE 2 DIABETES

THE EFFECT OF VITAMIN-C THERAPY ON HYPERGLYCEMIA, HYPERLIPIDEMIA AND NON HIGH DENSITY LIPOPROTEIN LEVEL IN TYPE 2 DIABETES Int. J. LifeSc. Bt & Pharm. Res. 2013 Varikasuvu Seshadri Reddy et al., 2013 Review Article ISSN 2250-3137 www.ijlbpr.com Vol. 2, No. 1, January 2013 2013 IJLBPR. All Rights Reserved THE EFFECT OF VITAMIN-C

More information

SUPPLEMENTAL CHOLINE FOR PREVENTION AND ALLEVIATION OF FATTY LIVER IN DAIRY CATTLE

SUPPLEMENTAL CHOLINE FOR PREVENTION AND ALLEVIATION OF FATTY LIVER IN DAIRY CATTLE SUPPLEMENTAL CHOLINE FOR PREVENTION AND ALLEVIATION OF FATTY LIVER IN DAIRY CATTLE Ric R. Grummer and Reinaldo Cooke Department of Dairy Science University of Wisconsin-Madison rgrummer@wisc.edu Fatty

More information

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global

More information

Responses of blood lipids to aerobic and resistance type of exercise

Responses of blood lipids to aerobic and resistance type of exercise Responses of blood lipids to aerobic and resistance type of exercise Labros Sidossis, Ph.D. Laboratory of Nutrition and Clinical Dietetics Harokopio University of Athens, Greece Triacylglycerol structure

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl) a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

More information

Non-fasting Lipid Profile Getting to the Heart of the Matter! Medimail Dec 2017

Non-fasting Lipid Profile Getting to the Heart of the Matter! Medimail Dec 2017 Non-fasting Lipid Profile Getting to the Heart of the Matter! Medimail Dec 2017 Historical Basis for Fasting Lipids The initial classifications of hyperlipidemia proposed in 1967 were genetic and required

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Research Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats

Research Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats Research Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats Nimmy Chacko*, Shastry CS, Prerana shetty, Prasanna Shyamma, Ullas D souza and Patel Maulika

More information

Normal cholesterol level for men over 50

Normal cholesterol level for men over 50 Normal cholesterol level for men over 50 Understand what your cholesterol levels mean: Total, LDL, for men and 50 mg per dl their respective numbers have to stay over or under a particular level,. 24-4-2017

More information

Hydrophobic Surfactant Treatment Prevents Atherosclerosis in the Rabbit

Hydrophobic Surfactant Treatment Prevents Atherosclerosis in the Rabbit Hydrophobic Surfactant Treatment Prevents Atherosclerosis in the Rabbit RAPID PUBLICATIONS J. B. RODGERS, E. C. KYRIAKIDES, B. KAPUSCINSKA, S. K. PENG, and W. J. BOCHENEK, Department of Medicine, Albany

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

ALKA VITA DIABETES TEST

ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Lipid Lowering in Patients at High Risk for Cardiovascular Disease

Lipid Lowering in Patients at High Risk for Cardiovascular Disease Lipid Lowering in Patients at High Risk for Cardiovascular Disease Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Novel

More information

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original

More information

What is Diabetes Mellitus?

What is Diabetes Mellitus? Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

Inhibition of endothelial lipase causes increased HDL cholesterol levels in vivo

Inhibition of endothelial lipase causes increased HDL cholesterol levels in vivo Inhibition of endothelial lipase causes increased HDL cholesterol levels in vivo See the related Commentary beginning on page 318. Weijun Jin, John S. Millar, Uli Broedl, Jane M. Glick, and Daniel J. Rader

More information

Suppression of Hepatic Lipogenesis by Pectin and Galacturonic Acid Orally-Fed at the Separate Timing from Digestion-Absorption of Nutrients in Rat

Suppression of Hepatic Lipogenesis by Pectin and Galacturonic Acid Orally-Fed at the Separate Timing from Digestion-Absorption of Nutrients in Rat J, Nutr. Sci, Vitaminol., 29, 553-562, 1983 Suppression of Hepatic Lipogenesis by Pectin and Galacturonic Acid Orally-Fed at the Separate Timing from Digestion-Absorption of Nutrients in Rat Masashige

More information

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal

More information

Ebrahim Abbasi Oshaghi 1,2

Ebrahim Abbasi Oshaghi 1,2 1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

EFFECTS OF VIRGIN COCONUT OIL (VCO) ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY)

EFFECTS OF VIRGIN COCONUT OIL (VCO) ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY) EFFECTS OF VIRGIN COCONUT OIL () ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY) ROSARIO S. SAGUM, Ph.D., MILDRED A. UDARBE, M.Sc, TRINIDAD P. TRINIDAD, Ph.D., and MARIO V. CAPANZANA, Ph.D. Food and

More information

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows FULL PAPER Biochemistry Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows Hisami NAKAGAWA-UETA 1) and Norio KATOH 2) * 1) Ishikawa

More information

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia

More information

Widespread concern about the role of SFA in heart disease: Is it justified?

Widespread concern about the role of SFA in heart disease: Is it justified? Widespread concern about the role of SFA in heart disease: Is it justified? 1. What is the association of SFA intake and LDL-C? 2. Is LDL-C the best biomarker? 3. If SFA is reduced, does it matter what

More information

A Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia

A Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia A Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia Marina Cuchel, MD, PhD University of Pennsylvania, Philadelphia,

More information

Your Guide to Managing and Understanding Your Cholesterol Levels

Your Guide to Managing and Understanding Your Cholesterol Levels Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,

More information

NCBA Ground Beef Diet/Health Study

NCBA Ground Beef Diet/Health Study NCBA Ground Beef Diet/Health Study Stephen B. Smith Department of Animal Science Rosemary L. Walzem Department of Poultry Science Texas A&M University Assumptions: Corn-fed beef is healthier than pasture-fed

More information

PCSK9 RNAi Therapeutics. Kevin FitzGerald

PCSK9 RNAi Therapeutics. Kevin FitzGerald PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:

More information

Plasma cholesterol has been established as a predictor of

Plasma cholesterol has been established as a predictor of Dietary Fat Induced Alterations in Atherosclerosis Are Abolished by ACAT2-Deficiency in ApoB100 Only, LDLr / Mice Thomas A. Bell III, Kathryn Kelley, Martha D. Wilson, Janet K. Sawyer, Lawrence L. Rudel

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3 (ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,

More information

Hypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats

Hypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats Volume 55(2):289-293, 2011 Acta Biologica Szegediensis http://www.sci.u-szeged.hu/abs ARTICLE Hypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats R. H. Patil

More information

EPOA. Latest Insights on Palm Oil & Health. European Industry Meeting on Palm Oil Nicolette Drieduite I EPOA Project team member I Cargill 2 June 2015

EPOA. Latest Insights on Palm Oil & Health. European Industry Meeting on Palm Oil Nicolette Drieduite I EPOA Project team member I Cargill 2 June 2015 EPOA Latest Insights on Palm Oil & Health European Industry Meeting on Palm Oil Nicolette Drieduite I EPOA Project team member I Cargill 2 June 2015 Summary 1. In the nineties palm oil s success was related

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University

More information

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

(For National Authority Use Only) Name of Study Drug: to Part of Dossier: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115

More information

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research

More information

Normal cholesterol levels for men over 50

Normal cholesterol levels for men over 50 Normal cholesterol levels for men over 50 The Borg System is 100 % Normal cholesterol levels for men over 50 High cholesterol doesn't usually produce any obvious symptoms so higher than ideal cholesterol

More information

Keywords: Type 2 DM, lipid profile, metformin, glimepiride ABSTRACT

Keywords: Type 2 DM, lipid profile, metformin, glimepiride ABSTRACT Human Journals Research Article September 2015 Vol.:4, Issue:2 All rights are reserved by K. Saravanan et al. Effects of Monotherapy and Combination Therapy Involving Metformin and Glimepiride on HbA1c

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation

More information

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro

More information

PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O

PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O Basic Facts on Oil Palm Originated from West Africa, palm oil is the rich source of edible oil and has become important resource of vegetable oil in the

More information

JMSCR Vol 05 Issue 05 Page May 2017

JMSCR Vol 05 Issue 05 Page May 2017 www.jmscr.igmpublication.org Impact Factor 5.84 Index Copernicus Value: 83.27 ISSN (e)-2347-176x ISSN (p) 2455-0450 DOI: https://dx.doi.org/10.18535/jmscr/v5i5.193 Lipid Profile as Early Predictor of Complication

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice ... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol

More information

Lipoproteins Metabolism

Lipoproteins Metabolism Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical

More information

Fat Metabolism, Insulin and MTHFR

Fat Metabolism, Insulin and MTHFR Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain

More information

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only

More information

Nutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source

Nutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source Tools: Printer 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut along dashed lines Copyright Goodheart-Willcox Co., Inc. All rights reserved. Tissue in which the body

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

VI. SUMMARY. One hundred and eighty day old commercial Cobb broiler chicks. randomly divided into five groups, each comprising of 36 chicks, were

VI. SUMMARY. One hundred and eighty day old commercial Cobb broiler chicks. randomly divided into five groups, each comprising of 36 chicks, were VI. SUMMARY One hundred and eighty day old commercial Cobb broiler chicks randomly divided into five groups, each comprising of 36 chicks, were used in the present study to evaluate the physiological effects

More information

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors

More information