Immunity, Volume 9 Supplemental Information Lung gd T Cells Mediate Protective Responses during Neonatal Influenza Infection that re ssociated with Type Immunity Xi-zhi J. Guo, Pradyot Dash, Jeremy Chase Crawford, E. Kaitlynn llen, nthony E. Zamora, David F. oyd, Susu Duan, Resha ajracharya, Walid. wad, Nopporn piwattanakul, Peter Vogel, Thirumala-Devi Kanneganti, and Paul G. Thomas
5K 5K 5K K K K 5K K Lymphocytes 8. 5K K Single Cells 96. 5K K Singlets 9.9 SSC- 5K FSC-H 5K SSC- 5K 5K K 5K K 5K FSC- 5K K 5K K 5K FSC- 5K K 5K K 5K SSC-W 5 live 76. 5 TCR+ 9.9 5K K TCR+.9 5K K IL 7 6. 5K LD - TCR - FSC-W 5K K 5K K 5K FSC- - 5 TCR - 5 IL-7 5K K 5K K 7.7 5K FSC-W - 5 T cells T cells.x % of live cells.x Day Day Day.x Day Day Day Mock Mock Figure S
% Original Weight 9 8 7 Weight Change adults (n=5) adults (n=) % Survival 8 6 Survival Rate adults (n=5) adults (n=) p=.5 6 5 7 8 5 6 9 5 8 C D E x 6 γδ T cells x 5 IL-7-producing γδ T cells x 5 IFN-γ-producing γδ T cells x 5 x x x x x x 5 8 x 5 8 x 5 8 Figure S
γδ T cells IL-7-producing γδ T cells IFN-γ-producing γδ T cells 8 5 % of T cells 6 % of γδ T cells % of γδ T cells Mock 5 8 Mock 5 8 Mock 5 8 γδ T cells IL-7-producing γδ T cells IFN-γ-producing γδ T cells.x.5x.x.x 5.x.x.x 5.x.x.x.x.x.x Mock 5 8 Mock 5 8 Mock 5 8 IL-7-producing γδ T cells D Mock CD7 + Mock CD7 - TRGV TRGV TRGV % of γδ T cells Mock Day influenza Day CD7 + Day CD7 - TRGV TRGV5 TRGV6 TRGV7 No PM/Ionomycin C % of alive cells 5 5 Neutrophil x 6 x 5 x Neutrophil Day 6 CD7 + p=. Day 6 CD7 - p=. 5 8 x 5 8 Overall CD7 + p=.7 Overall CD7 - p=.6 Figure S
% Survival 8 6 Survival Rate Infected + PS (n=) Infected + rmil-7 (n=, higher dose) p=.6 6 9 5 8 % Survival 8 6 Survival Rate Infected + PS (n=8) Infected + rmil-7 (n=) 6 9 5 8 p=. C 8 IFN-γ 5 IL-. IL-β 6 5.5..5 Day after infection Day after infection. Day after infection 5 KC.5 GM-CSF IP- 5 5..5..5 5 5 Day after infection. Day after infection Day after infection D 5 5 IL- neonates neonates E Relative Expression (Fold Change) Il Mock 5 7. Endothelial cells Epithelial cells CDc+ cells Cell type Day after infection Fibroblasts Figure S
x 5 x ILC cells Treg cells Th cells x 5 x x 7 x 6 x 5 x 5 8 x 5 8 x 5 8 reg C Gated on Th (CD + Foxp - ) D. reg-producing Neutrophils pg/mg protein 8 6 Mock 5 7 reg FSC-W reg.6 reg. % of alive cells.5..5. Day 5 after infection E ILCs ST + CD + cells ST - CD + cells Relative Expression Normalized to wild-type F Il5 Il Gata Rorc Stat Tbx Foxp Day 5 after infection Foxp + cell frequency Undet. Undet. Undet. Undet. Relative Expression Normalized to wild-type Il5 Il Undet. Gata Rorc Stat Tbx Foxp Day 5 after infection Undet. Relative Expression Normalized to wild-type Undet. Il5 Il Gata Rorc Stat Tbx Foxp Day 5 after infection % of CD + ST + cells 8 6 Day 5 after infection Figure S5
IFN-γ - reg (Children).5 IFN-γ - IL-7 (Children). Spearman r =.5 p >.7 reg Conc. (log ) Spearman r =. p =.9 IL-7 Conc. (log ).5..5 - -. - IFN-γ Conc. (log ) -.5 IFN-γ Conc. (log ) C IL in 59 cells 8 Medium Relative Expression 6 Virus rmil-7 Virus + rmil-7 DMSO pstt inhibitor 8hrs after stimulation Figure S6
Supplemental figure legends Figure S Gating strategy and γδ T cell prevalence in mock-infected lungs. Related to Figure.. Schematic flow cytometric plots of the gating strategies employed during experiments.. Frequency (left) and number (right) of γδ T cells in the lungs of wild-type neonates at days 7, 8, and 9 after birth (equivalent to day, and of mock infection). Data are combined from two independent experiments and shown as mean ± SEM., not significant. Figure S The role of γδ T cells in adult influenza infection. Related to Figure. and. ody weight profile () and survival rate () of wild-type (black, n=5) and (red, n=) adults after virus infection, normalized to the original weight. Data are combined from four individual experiments and weight change data are shown as mean ± SEM. C. of adult lung γδ T cells at indicated time point after infection. D. of adult lung IL-7-producing γδ T cells at indicated time point after infection. E. of adult lung IFN-γ-producing γδ T cells at indicated time point after infection. (C-E) Data are combined from two individual experiments with mock infection (n=7), or day (n=), day 5 (n=5), and day 8 (n=5) after influenza infection. p<.. Figure S Characterization of γδ T cells and neutrophils in influenza-infected neonatal lungs. Related to Figure.. Frequency (top panel) and cell number (bottom panel) of lung γδ T cells (left), IL-7-producing γδ T cells (middle) and IFN-γ-producing γδ T cells (right), with mock infection (n=), or day (n=), (n=), 5 (n=), and 8 (n=7) after infection. Data are combined from at least two individual experiments at each time point and presented as mean ± SEM.. Frequency of IL-7-producing γδ T cells in mock- (n=) or influenza- (n=5) infected neonatal lungs at day after infection, without PM/Ionomycin stimulation. Data are combined from three individual experiments and presented as mean ± SEM. C. Percent (left) and number (right) of neutrophils of wild-type or neonates with influenza- infected neonatal lungs at day,, 5 and 8 following infections. Data are pooled from nine independent experiments and at least two individual experiments at each time point. Data are shown as mean ± SEM. D. TRGV family usage of CD7 + (left) or CD7 - (right) γδ T cells estimated by single-cell PCR at mock-infection, days after influenza infection, and 6 days after influenza infection (top to bottom). TRGV sequence data in the pie chart present Mock-CD7 + (n=), Mock-CD7 - (n=9), Day-CD7 + (n=65), Day-CD7 - (n=59), Day6-CD7 + (n=5), and Day6-CD7 - (n=). p<.5, p<., p<., p<.,, not significant.. Figure S Cytokine expression and infected neonates survival with cytokine administration. Related to Figure.. Survival rate of influenza-infected neonates administered with of high-dose of recombinant mouse IL-7 (rmil-7, navy, pg/mouse, n=) or PS control (red, n=) at the time of infection. Data are combined from five independent trials that individually showed the same trend, and data are presented as mean ± SEM.. Survival rate of influenza-infected wild-type neonates administered with recombinant mouse IL-7 (rmil-7, orange, pg/mouse, n=) or PS control (black, n=8) at the time of infection. Data are combined from two independent trials that individually showed the same trend, and data are presented as mean ± SEM. C. Protein levels of IFN-γ, IL-, IL-β, KC, GM-CSF and IP- assessed by Milliplex assay and normalized to the total protein in the lungs of infected wild-type (black, n=5) and (red, n=5) neonates at day after infection. Samples are pooled from three individual experiments, and data are combined and presented as mean ± SEM. D. Protein levels of IL- assessed by ELIS and normalized to the total protein in the lungs of infected wild-type (black) and (red) neonates at indicated time points after infection. Samples are pooled from at least two independent trials at each time point, and data are presented as mean ± SEM.
E. Relative expression results of Il gene in endothelial cells, epithelial cells, CDc + cells, and lung fibroblasts isolated from neonatal lungs days after infection (n=). Data are presented as mean ± SEM. p<.5,, not significant. Figure S5 reg expression dynamics during neonatal influenza infection. Related to Figure 5.. of ILCs, Treg cells, and Th cells in the lungs of wild-type (black) and (red) influenzainfected neonates at various time point after infection. Data are combined from at least two individual experiments at each time point and shown as mean ± SEM.. bundance of reg protein was assessed by ELIS and normalized to the total protein in the lungs of wild-type (black) and (red) influenza-infected neonates at different time points. Samples are pooled from at least two individual experiments at each time point, and data are shown as mean ± SEM. C. Representative flow cytometric plots of reg-producing Th cells in wild-type and lungs at day 5 following infection. D. Frequency of reg-producing neutrophils in influenza-infected wild-type (n=7) and (n=6) lungs at day 5 after infection. Data are combined from two individual experiments and shown as mean ± SEM. E. Relative gene expression of Il5, Il, Gata, Rorc, Stat, Tbx and Foxp in ILCs, ST + CD + cells and ST - CD + cells sorted from wild-type (n=5) and (n=5) lungs at day 5 after infection. Samples are pooled from two independent experiments and data are presented as mean ± SEM. p<., p<., p<.,, not significant. Figure S6 Correlation of IFN-γ - reg and IFN-γ - IL-7 in children, and IL gene expression in stimulated 59 cells. Related to Figure 6.. Correlation between concentration of human IFN-γ (x-axis) and reg (y-axis) in influenza-infected children (n=5). Cytokine values (pg/ml) were log transformed for visualization.. Correlation between concentration of human IFN-γ (x-axis) and IL-7 (y-axis) in influenza-infected children (n=5). Cytokine values (pg/ml) were log transformed for visualization. C. Relative expression of IL transcripts in human lung epithelial cells (59) treated with DMSO or the pstt inhibitor and stimulated for 8 hours with medium, influenza virus, rmil-7, or the virus-rmil-7 combination. Data are shown as mean ± SEM and combined from three separate experiments that independently showed the same trend. p<.5, p<..
Table S Primers for mouse γδ TCR sequencing. Related to STR Methods - Single-cell Sorting and Multiplex PCR. Primer External Internal name TRGV- GCGCTGGGCCTG CTGTTTCGGTCCCG For TRGVFor CTTCCTGTGTTTTC TC GTTTGGTTTCTTTTTGTCCTTGC C TRGV5For GTTCTCGGTCGCTCTC TCCCGGCCCGC C TRGV6For TCCCTCTGGGGTCTTG GGGGGTCGGC TRGV7For CCTTGGGGTT CCCGCTGGGGGTC GTC TRGCRev CTTTTCTTTCCTCCCC TCDGGGCTTTTCGG