ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon Chn Choi 1, Sng Yeoul Lee 1, Kyu-Jeong Ahn 1, Ho-Yeon Chung 1, Sung-Jig Lim 2, Sung Hyun Chung 3, nd In-Kyung Jeong 1 Deprtments of 1 Endocrinology nd Metbolism nd 2 Pthology, Kyung Hee University School of Medicine, Seoul; 3 Deprtment of Phrmcology nd Clinicl Phrmcy Lbortory, Kyung Hee University College of Phrmcy, Seoul, Kore Received : July 9, 215 Revised : August 17, 215 Accepted : August 23, 215 Correspondence to In-Kyung Jeong, M.D. Deprtment of Endocrinology nd Metbolism, Kyung Hee University Hospitl t Gngdong, 892 Dongnm-ro, Gngdong-gu, Seoul 5278, Kore Tel: +82-2-44-6126 Fx: +82-2-44-6799 E-mil: jik116@nver.com Bckground/Aims: Non-lcoholic ftty liver disese is ssocited with insulin resistnce. Compound K (CK) is the finl metbolite of pnxdiol ginsenosides tht hve been shown to exert ntidibetic effects. However, the moleculr mechnism of the ntidibetic effects in the liver hve not been elucidted; further, whether CK hs beneficil effects in heptostetosis remins uncler. Therefore, we evluted the effect of CK on heptostetosis s well s its mechnism in highft diet (HFD)-fed type 2 dibetic Otsuk Long-Evns Tokushim Ftty (OLETF) rts. Methods: Twenty-four-week-old mle OLETF rts were ssigned to four groups: control (sline), CK 1 mg/kg, CK 25 mg/kg, or metformin 3 mg/kg (positive control); ll tretments were dministered orlly for 12 weeks. Results: Fsting glucose levels of the CK25 group were significntly lower thn those of the control group during the 12 weeks. The results of the orl glucose tolernce test showed tht both the glucose concentrtion fter glucose loding nd the fsting insulin levels of the CK25 group were significntly lower thn those of the control. Heptostetosis ws significntly improved by CK25. CK25 nd metformin significntly incresed the phosphoryltion of heptic denosine monophosphte-ctivted protein kinse (AMPK). CK25 significntly inhibited the expression of sterol regultory element-binding protein-1c nd ftty cid synthse, while upregulting tht of peroxisome prolifertor-ctivted receptor-α nd crnitine plmitoyltrnsferse-1. Conclusions: CK improved glucose intolernce nd heptostetosis in HFD-fed OLETF rts through AMPK ctivtion, which hs dul mode of ction tht involves decresing the synthesis of ftty cids nd incresing ftty cid oxidtion. Keywords: Dibetes mellitus, type 2; Ginsenoside M1; Non-lcoholic ftty liver disese; AMP-ctivted protein kinses INTRODUCTION Non-lcoholic ftty liver disese (NAFLD) is n importnt mnifesttion of metbolic syndrome, which includes insulin resistnce, hypertension, centrl obesity, nd dyslipidemi. Epidemiologicl studies nd clinicl trils hve estblished the correltion between the incresing incidence of NAFLD nd the incresing epidemics of Copyright 218 The Koren Assocition of Internl Medicine This is n Open Access rticle distributed under the terms of the Cretive Commons Attribution Non-Commercil License (http://cretivecommons.org/licenses/ by-nc/4./) which permits unrestricted noncommercil use, distribution, nd reproduction in ny medium, provided the originl work is properly cited. pissn 1226-333 eissn 25-6648 http://www.kjim.org
The Koren Journl of Internl Medicine Vol. 33, No. 2, Mrch 218 obesity nd type 2 dibetes mellitus [1]. NAFLD includes wide spectrum of heptic bnormlities such s ftty liver (stetosis), inflmmtion (heptitis), cirrhosis, nd crcinoms. Non-lcoholic stetoheptitis (NASH) is n intermedite stge tht is chrcterized histologiclly by heptic stetosis, lobulr inflmmtion, nd heptocellulr bllooning [2]. Although the exct mechnism of NASH is not cler, insulin resistnce nd oxidtive stress hve been implicted s key fctors contributing to the progression of NASH. Severl studies hve demonstrted the beneficil effect of insulin sensitizers in NASH, including thizolidinediones, bigunide, nd ntioxidnts such s vitmin E nd α-lipoic cid [3]. Adenosine monophosphte-ctivted protein kinse (AMPK) plys key role in glucose metbolism including glucose trnsport, gluconeogenesis, nd lipolysis. AMPK reduces ftty cid synthesis by decresing the expression of sterol regultory element-binding protein-1c (SREBP-1c) [4] nd enhnces ftty cid oxidtion by incresing peroxisome prolifertor-ctivted receptor-α (PPAR-α), PPAR-γ coctivtor-1α, crnitine plmitoyltrnsferse-1 (CPT-1), nd uncoupling proteins [5]. Therefore, AMPK cn be therpeutic trget for insulin resistnce. Compound K (CK) is the finl metbolite of pnxdiol ginsenosides [6]. CK hs ntitumor, poptotic, nd ntidibetic effects; the ltter is responsible for stimulting insulin secretion in pncretic β-cells nd enhncing insulin sensitivity in heptocytes nd myocytes [7]. However, the effect of CK on NAFLD in conditions such s obesity nd dibetic is unknown. In this study, the effect of CK on heptostetosis nd its mechnism were investigted in high-ft diet (HFD)-fed type 2 dibetic Otsuk Long-Evns Tokushim Ftty (OLETF) rts. METHODS Animls Twenty-four-week-old, mle type 2 dibetic model OLETF rts were kindly provided by Otsuk Phrmceuticls (Tokushim, Jpn). The rts were individully housed nd llowed free ccess to food nd tp wter under strictly controlled nd pthogen-free conditions (room temperture, 23 C ± 1 C; reltive humidity, 5% ± 1%; light cycle, 7: AM to 7: PM). The rts were fed stndrd rodent pellet chow nd cclimtized to their environment for 2 weeks prior to the commencement of the experiments. Thirty-two rts were rndomly ssigned to four subgroups nd then treted dily with CK, metformin, or vehicle for 12 weeks: (1) control (n = 6) received vehicle (sline); (2) CK 1 mg/kg (CK1; n = 1); (3) CK 25 mg/ kg (CK25; n = 1); nd (4) metformin 3 mg/kg (n = 6) s positive control. CK in the form of dried powder ws dissolved in sline nd ws orlly dministered by gvge dily. All tretments were orlly dministered. To induce heptic stetosis, ll rts were fed 6% HFD (Joongng Animl Lbortory, Seoul, Kore). The experimentl procedures were conducted ccording to the niml cre guidelines of the United Sttes Ntionl Institutes of Helth (NIH) nd pproved by the Animl Cre nd Use Committee of Kyung Hee University (IA- CUC pprovl No.212-2). The use of nimls in the study ws pproved by the institution s Animl Ethics Committee in ccordnce with Article 14 of the Koren Animl Protection Lw or its equivlent. The use of nimls in the study complied with Article 13 of the Koren Animl Protection Lw (the principles for niml use) nd relevnt institutionl policies. Functionl protocol The body weight of ech rt ws mesured t the beginning of the experiment nd every week therefter. Food intke ws determined by mesuring the difference between the pre-weighed chows nd the weight of the food tht remined every 24 hours during the first nd lst week of the 3-month diet period. Blood smples were collected from the til vein every week of tretment nd the serum ws stored t 2 C until nlysis. The fsting blood glucose level ws ssessed using n Accu-Chek ctive glucometer (Roche, Bsel, Switzerlnd). After the 12- week tretment, whole blood ws collected by inferior ven cv puncture from ll rts. Ech blood smple ws held t room temperture for 1 hour. Serum ws then collected by centrifugtion t 4, rpm for 1 minutes nd stored t 7 C until nlysis. Glycted hemoglobin (HbA1c) levels were mesured using DCA Vntge Anlyzer (Siemens, Trrytown, NY, USA). Serum insulin ws ssyed by enzyme-linked immunosorbent ssy (Millipore, Billeric, MA, USA). The orl glucose tolernce test (OGTT) ws performed with rts tht were fsted for 16 hours t weeks nd t 12 weeks. Glucose (2 g/kg body 348 www.kjim.org
Hwng YC, et l. Effect of compound K on heptostetosis weight) ws orlly dministered to the rts nd blood smples were collected, 3, 6, 9, nd 12 minutes fter glucose loding. Histologicl nd biologicl nlysis The livers were obtined from ech rt fter perfusion of phosphte buffered sline (PBS). They were then fixed in 1% buffered formlin, embedded in prffin, stined with hemtoxylin nd eosin, nd blindly scored for heptic lipid ccumultion by microscopy exmintion by the sme pthologist. The score of ech component of NAFLD (stetosis [ 3], lobulr inflmmtion [ 3], bllooning [ 2], nd fibrosis [, 1, 1b, 1c, 2, 3]) ws quntittively evluted ccording to the stndrd criteri of grding nd stging for NASH [8]. Western blot Heptic tissues were isolted fter pump-medited perfusion of PBS, nd whole cell lystes were prepred. Protein concentrtions were determined nd n equl mount of ech smple ws subjected to sodium dodecyl sulfte-polycrylmide gel electrophoresis nd trnsferred to nitrocellulose membrnes. Following the trnsfer, the membrnes were reversibly stined with Ponceu S solution (Amresco, Solon, OH, USA) to confirm smple loding nd gel trnsfer equivlence. After blocking with 5% nonft milk for 1 hour, the membrnes were individully incubted with AMPK ntibodies, followed by ntibodies to phospho-ampk (1:1,; Cell Signling, Dnvers, MA, USA), SREBP-1c (1:1,; BD Biosciences, Sn Jose, CA, USA), ftty cid synthse (FAS; 1:1,; Cell Signling), PPAR-α (1:1,; Cell Signling), CPT-1 (1:1,; Cell Signling), nd ctin (1:2,; Snt Cruz Biotechnology, Snt Cruz, CA, USA) overnight t 4 C. This ws followed by incubtion with got-nti-rbbit immunoglobulin G secondry ntibodies (1:2,; Snt Cruz Biotechnology) for 1 hour. Antibody binding ws detected by enhnced chemiluminescence (ECL, Pierce, Thermo Fisher Scientific, Sn Jose, CA, USA). X-ry film (Kodk, Rochester, NY, USA) ws used to visulize the bnds. Densitometry quntifiction vlues were mesured by the Imge J progrm from NIH nd expressed s fold-differences from the control t ech time point. Tble 1. Primer sequences of genes relted to ftty cid synthesis nd ftty cid oxidtion Gene SREBP-1c FAS CPT-1A PPAR-α Cyclophillin Sequence (5' 3') F: CGAAGTGGTGGAGACGCTTA R: CGGTGTGTACCCGTAGCATC F: GAAACCTGACGGCATCATTG R: CGGTGTCCTCAGAGTTGTGG F: CTCAAGATGGCAGAGGCTCA R: GGGGAACACACCAGTGATGA F: GTAGGTAATGCGGGCTCTCC R: CATTGATTAACATTGGGCCG F: ACCCCACCGTGTTCTTCGAC R: CATTTGCCATGGACAAGATG SREBP-1c, sterol regultory element-binding protein-1c; FAS, ftty cid synthse; CPT-1A, crnitine plmitoyltrnsferse-1a; PPAR-α, peroxisome prolifertor-ctivted receptor-α. RNA isoltion, semiquntittive reverse trnscription-polymerse chin rection (RT-PCR), nd rel-time RT-PCR Totl RNA ws isolted from liver smples fter pumpmedited perfusion with 5% PBS. The method ws bsed on the phenol/gunidine isothiocynte RNA zol B protocol (Cinn/Biotecx, Houston, TX, USA). Totl RNA (1 μg) ws reverse trnscribed using MMLV (Moloney Murine Leukemi Virus) reverse trnscriptse (Gibco, Grnd Islnd, NJ, USA) with rndom hexmer priming. For semi-quntittive PCR, liquots of cdna were mplified in 2-μL PCR mixture ccording to the protocol provided by the mnufcturer (TKR Bio, Kyoto, Jpn). PCR primer sequences for genes regulting ftty cid synthesis nd ftty cid oxidtion re shown in Tble 1. The primers were synthesized by Bioneer (Seoul, Kore). PCR products were seprted by electrophoresis on 1.5% grose gels contining ethidium bromide, nd the bnds were visulized under ultrviolet light. For rel-time RT-PCR, the resultnt cdna ws mplified using LightCycler (Roche Dignostics, Lewes, UK). Rel-time PCR ws crried out with SYBR Green I (Roche Dignostics). PCR rections with SYBR Green I nd primers were performed in 2 μl volume with 2 μl cdna,.5 μm ech primer, nd 4 mm MgCl 2. Tq polymerse, PCR buffer, deoxynucleotides, nd SYBR Green I dye were included in the LightCycler-Fst Strt www.kjim.org 349
The Koren Journl of Internl Medicine Vol. 33, No. 2, Mrch 218 8 Body weight (g) A 6 4 2 CK1 Food intke (Kcl/dy) CK25 Metformin 2 4 6 8 1 12 CK1 CK25 Metformin Time (wk) B 1 5 1 Fsting glucose (mg/dl) C 1 5 CK1 CK25 Metformin 2 4 6 8 1 12 Time (wk) D CK1 CK25 Metformin Figure 1. Effect of compound K (CK) supplementtion on body weight, food intke, nd fsting glucose concentrtions in highft diet-fed Otsuk Long-Evns Tokushim Ftty (OLETF) rts. Sline (control), CK 1 mg/kg, CK 25 mg/kg, or metformin 3 mg/kg ws dministered to OLETF rts for 12 weeks. (A) Body weight during 12 weeks. (B) Comprison of food intke mong control, CK1, CK25, nd metformin groups. (C). Seril fsting glucose levels for 12 weeks. (D) Glycted hemoglobin (HbA1c) levels. Dt is expressed s men ± stndrd devition. Differences were considered sttisticlly significnt t p <.5. HbA1c (%) 8 6 4 2 DNA Mster SYBR Green I mix (Roche Dignostics). The therml cycling profile consisted of pre-incubtion step t 95ºC for 1 minutes followed by 4 or 5 cycles of 95ºC denturtion step for 1 seconds, 59ºC nneling for 5 seconds, nd 72ºC extension step for 2 seconds. After ech extension step, the temperture ws rised to 88ºC to mesure SYBR Green I fluorescence t temperture 2 C below the product Tm nd 2 C bove the Tm of the primers-dimers. At the end of the PCR, melting curve nlysis ws performed by grdully incresing the temperture from 65 C to 95 C t rte of.1 o C/second to confirm the mplifiction specificity of the PCR products. The level of expression of ech mrna nd their estimted crossing points (Cp) for ech smple were determined reltive to the stndrd preprtion using LightCycler computer softwre (version 3.5). PCR mplifiction ws performed with series of stndrds prepred by successive dilutions nd liner stndrd curve ws utomticlly generted. A stndrd curve ws constructed for ech PCR run. All smples to be compred were run in the sme ssy. Sttisticl nlysis The results re presented s the men ± SD. The effect of CK on ech prmeter ws exmined by one-wy nlysis of vrince. Prism softwre version 5 (Grphpd Softwre, Sn Diego, CA, USA) ws used for sttisticl nlysis nd grphing. A p <.5 ws considered stticlly significnt. RESULTS Compound K improved glucose metbolism in HFD-fed OLETF rts HFD-fed OLETF rts were treted for 12 weeks with sline (control), CK1, CK25, or metformin (s positive control). The mount of food intke nd the body 35 www.kjim.org
Hwng YC, et l. Effect of compound K on heptostetosis OGTT Blood glucose (mg/dl) A 8 6 4 2 CK1 CK25 Metformin 3 6 9 12 Time (min) Are under the curve of glucose of OGTT B 8, 6, 4, 2, CK1 CK25 Metformin Fsting insuiin (ng/ml) 3 2 C 1 CK1 CK25 Metformin Figure 2. Effects of compound K (CK) in orl glucose tolernce tests (OGTT). OGTT ws performed 12 weeks fter tretment. (A) Blood glucose levels of OGTT. (B) Are under the curve of glucose levels of OGTT. (C) Fsting insulin levels mesured t 12 weeks fter tretment. Dt is expressed s men ± stndrd devition. Differences were considered sttisticlly significnt t p <.5. CK1 CK25 Metformin p-ampk AMPK Actin 1 A B 8 6 4 2 C Figure 3. Effects of compound K (CK) on histologicl findings of heptic stetosis. Liver tissue of (A) control, (B) CK1, (C) CK25, nd (D) metformin groups were stined by H&E fter 12 weeks of tretment ( 1). weight were not significntly different mong the four groups (Fig. 1A nd 1B). Fsting plsm glucose levels of the CK25 nd metformin groups were significntly lower thn those of the control group during the 12-week study period (Fig. 1C). HbA1c ws not significntly different mong the four groups (Fig. 1D). Concerning OGTT, the glucose concentrtions fter glucose loding in the CK25 group were significntly lower thn those of the control group (Fig. 2A). When the re under the curve (AUC) of glucose in the OGTT ws nlyzed, the AUC of the CK25 group ws found to be significntly lower thn D CK1 CK25 Metformin Figure 4. Effect of compound K (CK) on phosphoryltion of denosine monophosphte-ctivted protein kinse (p-ampk). We compred the effect of CK on AMPK phosphoryltion in the liver of high-ft diet-fed Otsuk Long-Evns Tokushim Ftty rts with tht of the control group. CK25 nd metformin significntly incresed heptic AMPK phosphoryltion. Differences were considered sttisticlly significnt t p <.5. tht of the control group nd decresed to the level of the metformin group (Fig. 2B). Fsting insulin levels of the CK25 nd metformin groups were significntly lower thn those of the control group were (Fig. 2C). Compound K improved ftty liver in HFD-fed OLETF rts To demonstrte the effect of CK on heptic stetosis, lipid ccumultion ws mesured in HFD-fed OLETF www.kjim.org 351
The Koren Journl of Internl Medicine Vol. 33, No. 2, Mrch 218 SREBP-1c mrna (%) 1 5 FAS mrna (%) 1 5 CK1 CK25 Metformin CK1 CK25 Metformin 2 2 CPT-1 mrna 1 5 PRAR-α mrna (%) 1 5 A CK1 CK25 Metformin CK1 CK25 Metformin CK1 CK25 Metformin 1.5 1.5 SREBP-1c FAS Actin SREBP-1c/ctin (fold increse of control) 1..5 FAS/ctin (fold increse of control) 1..5 CK1 CK25 Metformin CK1 CK25 Metformin CPT-1 PPAR-α Actin CK1 CK25 Metformin CPT-1/ctin (fold increse of control) 2.5 2. 1.5 1..5 PPAR-α/ctin (fold increse of control) 2. 1.5 1..5 B CK1 CK25 Metformin CK1 CK25 Metformin Figure 5. Effects of compound K (CK) on lipogenic nd lipolytic gene (A) mrna expression nd (B) protein expression in the liver of high-ft diet-fed Otsuk Long-Evns Tokushim Ftty rts. (A) Reverse trnscription-polymerse chin rection (PCR) ws performed s described in methods. Trnscripts of lipogenic nd lipolytic genes were quntified by rel-time PCR nd normlized to cyclophillin. (B) Representtive dt of the Western blot showing the effect of CK on sterol regultory element-binding protein-1c (SREBP-1c), ftty cid synthse (FAS), crnitine plmitoyltrnsferse-1 (CPT-1), nd peroxisome prolifertor-ctivted receptor-α (PPAR-α) expression (n = 5). Dt is expressed s men ± stndrd devition. Differences were considered sttisticlly significnt t p <.5. rts. Histologicl exmintion showed tht heptocytes of HFD-fed rts were distended by lrge cytoplsmic lipid droplets. The quntittive grde of heptostetosis ws significntly lower in the CK25 group thn in the 352 www.kjim.org
Hwng YC, et l. Effect of compound K on heptostetosis control group (1.5 ±.82 vs. 2.7 ±.23, p <.5). Advnced fibrosis ws not found in ll groups. This chnge in cellulr morphology ws significntly improved by CK25 tretment (Fig. 3). Compound K incresed AMPK ctivtion To study the effect of CK on the phosphoryltion of AMPK, which is key regultor of glucose nd lipid metbolism, the expression of phospho-ampk in the liver of HFD-fed OLETF rts ws exmined by western blotting nd compred mong four groups. CK25 nd metformin significntly incresed heptic AMPK phosphoryltion (Fig. 4). Compound K decresed ftty cid synthesis nd incresed ftty cid oxidtion To investigte the mechnism by which CK improved heptic stetosis in HFD-fed OLETF rts, the expression of genes relted to ftty cid synthesis nd β-oxidtion ws evluted by rel-time PCR nd Western blotting. CK25 significntly inhibited the expression of SREBP-1c nd FAS, which re involved in lipogenesis (Fig. 5). CK25 stimulted the mrna expression of CPT-1, rte-limiting enzyme for ftty cid oxidtion (Fig. 5A). The mrna expression of PPAR-α, trnscriptionl fctor tht regultes ftty cid oxidtion, ws significntly incresed by CK25 (Fig. 5A). In ddition, western blotting showed tht the expression of CPT-1 nd PPAR-α in the CK25 nd metformin groups were significntly higher thn those of control groups (Fig. 5B). DISCUSSION In the present study, CK ttenuted glucose intolernce nd heptic stetosis in HFD-fed OLETF rts through the ctivtion of AMPK. CK inhibited the expression of genes relted to ftty cid synthesis nd stimulted tht of genes relted to ftty cid oxidtion through ctivtion of the AMPK pthwy. The histologic fetures of stetosis decresed in the CK25 tretment group. NAFLD is common typicl feture of insulin resistnce conditions such s obesity, type 2 dibetes, nd metbolic syndrome [8]. Insulin resistnce is ssocited with hyperinsulinemi, increses of plsm free ftty cid, nd heptic lipogenesis. Besides weight loss, multiple phrmcologic interventions hve been ttempted. Pentoxifilline [9], orlistt [1], ursodeoxycholic cid [11], metformin [12], nd thizolidinediones [13] hve proved successful in humns. Insulin sensitizers such s pioglitzone [14] nd metformin [15] improve heptic stetosis by reducing heptic insulin resistnce through AMPK ctivtion. Glucgon-like peptide-1 increses phosphorylted AMPK α1 (the unique subunit of AMPK) in humn nd rt heptocytes [16]. Antioxidnts including α lipoic cid [17] nd vitmin E [18] lso decrese heptic lipogenesis through AMPK-dependent nd -independent pthwys. CK is metbolite of pnxdiol ginsenosides, which hs ntidibetic nd ntihyperlipidemic ctivity. CK lowers blood glucose levels in db/db mice by stimulting insulin secretion nd improving insulin resistnce [19]. In the present study, CK decresed fsting glucose levels, the AUC of glucose in the OGTT, nd the fsting insulin level. The results support CK-medited decrese in insulin resistnce in HFD-fed OLETF rts. HbA1c levels decresed in the CK25 nd metformin groups compred to tht in the control group. A more definitive decrese could be pprent with longer tretment period. In ddition, we previously reported tht CK reduces lipid ccumultion through AMPK phosphoryltion in HepG2 cells cultured in high-glucose medium [2]. In previous in vitro studies, CK ctivted AMPK phosphoryltion nd decresed gene expression of SREBP-1c nd FAS; these effects were ttenuted by compound C, which is n AMPK inhibitor. Thus, we hypothesize tht CK inhibits heptic stetosis by ctivting AMPK. In this study, we confirmed tht CK ttenutes glucose intolernce nd heptic stetosis in the liver of OLETF rts (n estblished type 2 dibetes model) through AMPK ctivtion. In this model, hyperglycemi develops fter 18 weeks of ge [21]. An HFD- or methioninecholine-deficient diet is usully fed to induce stetoheptitis. We cn study both glucose intolernce nd heptic stetosis in HFD-fed OLETF rts. AMPK plys n importnt role in the regultion of cellulr energy metbolism [22]. AMPK inhibits heptic gluconeogenesis nd reduces ftty cid synthesis by inhibiting the trnscription fctor SREBP-1c, nd increses ftty cid β-oxidtion through stimultion of CPT-1, which controls the trnsport of ctivted ftty cids into the mitochondri for oxidtion [23]. www.kjim.org 353
The Koren Journl of Internl Medicine Vol. 33, No. 2, Mrch 218 SREBP-1 is dominnt trnscription fctor tht regultes gene expression of lipogenic enzymes in the liver [24]. SREBP-1 is highly specific for lipogenic genes, wheres SREBP-2 is more specific to cholesterogenic genes. SREBP-1 hs two isoforms. SREBP-1c is weker thn SREBP-1 nd SREBP-2; the livers of dult nimls predominntly synthesize SREBP-1c nd SREBP-2 [25]. SREBP-1c over-expression in trnsgenic nimls selectively ctivted ftty cid biosynthesis genes. In this study, CK inhibited the expression of SREBP-1c, suggesting tht CK cn lso decrese the expression of lipogenic genes. SREBP-1c nd its trget proteins, such s FAS, were decresed by CK. FAS is n importnt ctlyzing enzyme in ftty cid biosynthesis [26]. FAS expression is regulted through the trnscriptionl fctor SREBP-1c in the liver. In the present study, CK reduced heptic FAS mrna levels, which my contribute to the improvement of heptic stetosis. The regultion of lipid metbolism depends on the blnce between biosynthesis pthwys nd hydrolysis. To improve ftty liver, both ftty cid oxidtion nd ftty cid synthesis re importnt. PPAR-α is lignd-ctivted trnscription fctor tht regultes the expression of genes relted to ftty cid oxidtion. PPAR-α promoter ctivity is incresed in n AMPK-dependent mnner [27]. PPAR-α trnscriptionlly regultes peroxisoml, microsoml, nd certin mitochondril ftty cid-metbolizing enzymes in the liver [28]. Herein, CK upregulted PPAR-α gene expression. The mitochondril crnitine system plys n importnt role in ftty cid oxidtion by ctlyzing ftty cid trnsport into the mitochondril mtrix during the ctbolic (fsting) stte. CPT-1 is one of the members of this trnsport system, which is loclized in the mitochondril outer membrne nd regulted by chnges in the mlonyl-coenzyme A (CoA). The AMP-induced protein kinse primrily determines the concentrtion of mlonyl-coa [29]. CK ctivted AMPK phosphoryltion, which decresed mlonyl-coa concentrtion nd sequentilly incresed CPT-1 expression. In conclusion, CK ttenuted glucose intolernce nd heptic stetosis in HFD-fed OLETF rts through AMPK ctivtion, which hs dul mode of ction involving the decrese of ftty cid synthesis nd the increse of ftty cid oxidtion. KEY MESSAGE 1. Non-lcoholic ftty liver disese is ssocited with insulin resistnce. 2. Compound K (CK) is the finl metbolite of pnxdiol ginsenosides tht hve been shown to exert ntidibetic effects. 3. CK improved glucose intolernce nd heptic stetosis through denosine monophosphte-ctivted protein kinse ctivtion. Conflict of interest No potentil conflict of interest relevnt to this rticle ws reported. Acknowledgments This reserch ws supported by grnt from Kyung Hee University in 27 (KHU-271482). REFERENCES 1. Bloom SR, Kuhjd FP, Lher I, et l. The obesity epidemic: phrmcologicl chllenges. Mol Interv 28;8:82-98. 2. Wieckowsk A, Feldstein AE. Dignosis of nonlcoholic ftty liver disese: invsive versus noninvsive. Semin Liver Dis 28;28:386-395. 3. Stein LL, Dong MH, Loomb R. Insulin sensitizers in nonlcoholic ftty liver disese nd stetoheptitis: current sttus. Adv Ther 29;26:893-97. 4. Ben Djoudi Oudd A, Levy E, Ziv E, et l. Incresed heptic lipogenesis in insulin resistnce nd type 2 dibetes is ssocited with AMPK signlling pthwy up-regultion in Psmmomys obesus. Biosci Rep 29;29:283-292. 5. Osler ME, Zierth JR. Adenosine 5 -monophosphte-ctivted protein kinse regultion of ftty cid oxidtion in skeletl muscle. Endocrinology 28;149:935-941. 6. Lee SJ, Ko WG, Kim JH, Sung JH, Moon CK, Lee BH. Induction of poptosis by novel intestinl metbolite of ginseng sponin vi cytochrome c-medited ctivtion of cspse-3 protese. Biochem Phrmcol 2;6:677-685. 7. Yoon SH, Hn EJ, Sung JH, Chung SH. Anti-dibetic effects of compound K versus metformin versus compound K-metformin combintion therpy in dibetic db/ db mice. Biol Phrm Bull 27;3:2196-22. 354 www.kjim.org
Hwng YC, et l. Effect of compound K on heptostetosis 8. Brunt EM, Kleiner DE, Wilson LA, Belt P, Neuschwnder-Tetri BA; NASH Clinicl Reserch Network (CRN). Nonlcoholic ftty liver disese (NAFLD) ctivity score nd the histopthologic dignosis in NAFLD: distinct clinicopthologic menings. Heptology 211;53:81-82. 9. Adms LA, Zein CO, Angulo P, Lindor KD. A pilot tril of pentoxifylline in nonlcoholic stetoheptitis. Am J Gstroenterol 24;99:2365-2368. 1. Hrrison SA, Fincke C, Helinski D, Torgerson S, Hyshi P. A pilot study of orlistt tretment in obese, non-lcoholic stetoheptitis ptients. Aliment Phrmcol Ther 24;2:623-628. 11. Lindor KD, Kowdley KV, Hethcote EJ, et l. Ursodeoxycholic cid for tretment of nonlcoholic stetoheptitis: results of rndomized tril. Heptology 24;39:77-778. 12. Buginesi E, Gentilcore E, Mnini R, et l. A rndomized controlled tril of metformin versus vitmin E or prescriptive diet in nonlcoholic ftty liver disese. Am J Gstroenterol 25;1:182-19. 13. Belfort R, Hrrison SA, Brown K, et l. A plcebo-controlled tril of pioglitzone in subjects with nonlcoholic stetoheptitis. N Engl J Med 26;355:2297-237. 14. Ot T, Tkmur T, Kurit S, et l. Insulin resistnce ccelertes dietry rt model of nonlcoholic stetoheptitis. Gstroenterology 27;132:282-293. 15. Kit Y, Tkmur T, Misu H, et l. Metformin prevents nd reverses inflmmtion in non-dibetic mouse model of nonlcoholic stetoheptitis. PLoS One 212;7:e4356. 16. Lee J, Hong SW, Rhee EJ, Lee WY. GLP-1 receptor gonist nd non-lcoholic ftty liver disese. Dibetes Metb J 212;36:262-267. 17. Prk KG, Min AK, Koh EH, et l. Alph-lipoic cid decreses heptic lipogenesis through denosine monophosphte-ctivted protein kinse (AMPK)-dependent nd AMPK-independent pthwys. Heptology 28;48:1477-1486. 18. Hrrison SA, Torgerson S, Hyshi P, Wrd J, Schenker S. Vitmin E nd vitmin C tretment improves fibrosis in ptients with nonlcoholic stetoheptitis. Am J Gstroenterol 23;98:2485-249. 19. Hn GC, Ko SK, Sung JH, Chung SH. Compound K enhnces insulin secretion with beneficil metbolic effects in db/db mice. J Agric Food Chem 27;55:1641-1648. 2. Kim DY, Yun HD, Chung IK, Chung SH. Compound K, intestinl metbolite of ginsenoside, ttenutes heptic lipid ccumultion vi AMPK ctivtion in humn heptom cells. J Agric Food Chem 29;57:1532-1537. 21. Kwno K, Hirshim T, Mori S, Ntori T. OLETF (Otsuk Long-Evns Tokushim Ftty) rt: new NIDDM rt strin. Dibetes Res Clin Prct 1994;24 Suppl:S317-S32. 22. Steinberg GR, Kemp BE. AMPK in helth nd disese. Physiol Rev 29;89:125-178. 23. Viollet B, Lntier L, Devin-Leclerc J, et l. Trgeting the AMPK pthwy for the tretment of type 2 dibetes. Front Biosci (Lndmrk Ed) 29;14:338-34. 24. Shimno H. Sterol regultory element-binding protein-1 s dominnt trnscription fctor for gene regultion of lipogenic enzymes in the liver. Trends Crdiovsc Med 2;1:275-278. 25. Shimno H, Horton JD, Shimomur I, Hmmer RE, Brown MS, Goldstein JL. Isoform 1c of sterol regultory element binding protein is less ctive thn isoform 1 in livers of trnsgenic mice nd in cultured cells. J Clin Invest 1997;99:846-854. 26. Clrke SD. Regultion of ftty cid synthse gene expression: n pproch for reducing ft ccumultion. J Anim Sci 1993;71:1957-1965. 27. Lee SK, Lee JO, Kim JH, et l. Coenzyme Q1 increses the ftty cid oxidtion through AMPK-medited PPARα induction in 3T3-L1 predipocytes. Cell Signl 212;24:2329-2336. 28. Ro MS, Reddy JK. Peroxisoml bet-oxidtion nd stetoheptitis. Semin Liver Dis 21;21:43-55. 29. Foster DW. The role of the crnitine system in humn metbolism. Ann N Y Acd Sci 24;133:1-16. www.kjim.org 355