Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Similar documents
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Materials for

SUPPLEMENTARY FIGURES

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Figure 1

SUPPLEMENTAL FIGURE LEGENDS

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Figure 1

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

SUPPLEMENTARY INFORMATION

Supplementary Materials

SUPPLEMENTARY INFORMATION

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplementary information

Supplementary Materials for

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

supplementary information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Materials for

Supplementary Figures

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

2.5. AMPK activity

Supplementary Figure 1

T H E J O U R N A L O F C E L L B I O L O G Y

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

BIO360 Fall 2013 Quiz 1

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

SUPPLEMENTARY INFORMATION

Supplemental Figure 1

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplementary Figure 1

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

supplementary information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Expanded View Figures

Supplementary Figure 1 IL-27 IL

Expanded View Figures

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure S1 Supplementary Figure S2

33VASTVNGATSANNHGEPPS51PADARPR58

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Supplemental Information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

CA Tel.: ; Fax: ; ucsd.edu.

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

SUPPLEMENTARY INFORMATION

Transcription:

Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d b-actin 12 8 6 4 2 ** ** siegfp si - si 5 b Predictive binding region in : 1,228 1,232aa (-KAVSF-) HA-ERa + + FLAG- WT D - - FLAG FLAG- IgG 14 12 8 6 4 2 HEK293T cells KPL-3C cells FLAG- FLAG- - siegfp si si c 2 15 5 HEK293T cells ** DNA (mg) 2..5 1. 2. 2. FLAG- mock D - FLAG () FLAG () e 12 8 6 4 2 6 12 24 treatment time (h) 12 8 6 4 2 KPL-3C cells ** ** ** 6 12 24 treatment time (h) : 24 h - f Western blotting ChIP assay MCF-7 KPL-3C tamoxifen - - + - - - + - ERAP - - - + - - - + - + + + - + + + 1. 2.4 1..7 1. 1.7.9.7 b-actin 5-726/-74 - Input ERa IgG 5 -ERE -726-74 gttcaaggccacctggccaacat 2.5 2 1.5 1.5 tamoxifen - - + - ERAP - - - + - + + + MCF-7 - - + - - - - + - + + + KPL-3C 3.5 3 2.5 2 1.5 1.5 empty 5 -ERE PPP1CA -

activity (pmole/min) Binding Binding PKA activity (RLU) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 g h Position Sequence 228-248 QLLYLECILSVLSSSSSSMHL 318-338 VARTIYYIAAELVRLVGSVDS 439-459 ELSQGKGLSEGQVQLLLLRLE 496-516 GNERSLDISISVTTDTGQTTL 116-1126 SGSSAAKVVLTLSTQADRLFE 12-1245 VSQKAVSFIHDILTEVLTDWN 1449-1469 GLIEVWIILLEQLTAAVSNCP PSSM Score 43.4 24.2 74.4 26.2 42.4 2.6 83. b-actin 5 i 2 1.5 1.5 ** 1 mm H-89 - - + 1 nm - + + IPs 1.4 1.2 1.8.6.4.2 NS H-89 - - + - + + IPs j 3,, 2,5, 2,, 1,5, 1,, 5, 1 mm H-89 - - + 1 nm - + + IPs ** - - + - + + IPs k Target site Score T162.79 S35.79 S689.81 S9.83 S128.78 S1763.8 (Analysis by NetPhos 3.1) l m 8 6 4 2 FLAG- FLAG--transfected HEK293T * NS * - siegfp sipka 1 nm 5 1 5 1 (min) 1. 3.5 3.2.9.7 ps35-.7 ps128-1. 4.6 4.5.5.5.5 n S35-Peptide (DHGRGSGCSCTAPALSGPVAR) + recombinant PKA for 3 min at 3 C Score 83.14 57.63 Sequence GSGCSCTAPALSGPVAR GSGCSCTAPALSGPVAR Modification - 2S: Phospho 4C: Carboxymethyl 6C: Propionamide S128-Peptide (RCWSLVAPH) + recombinant PKA for 3 min at 3 C Score Sequence 72.15 CWSLVAPH 56.34 CWSLVAPH Modification - 1C: Propionamide 3S: Phospho Supplementary Figure 1 regulated activity through its phosphorylation by PKA. (a) Expression patterns of and in breast cancer cell lines. b-actin served as a quantitative internal control. (b) Identification of the predictive binding region in. The indicated FLAG-tagged constructs (WT; full-length, D; deleting -binding region, 1,228-KAVSF-1,232) and HA-tagged ERa construct transfected-hek293t cells were immunoprecipitated using an anti-flag antibody. (c) The inhibitory effects of overexpression on phosphatase activity of -immunoprecipitates in FLAG-tagged or D construct-transfected HEK293T cells using pnpp as a substrate. These data represent the means ± s.e.m. of three independent experiments. (d) Effects of si and si on phosphatase activity of immunoprecipitates using pnpp as a substrate in MCF-7 and KPL3C cells. These data represent the means ± s.e.m. of three independent experiments. (e) Phosphatase activity of after stimulation in MCF-7 (left) and KPL-3C (right) cells. These data represent the means ± s.e.m. of three independent experiments. (f) Positive

feedback regulation of PPP1CA transactivation. Left, Effects of tamoxifen on PPP1CA expression. For immunoblot analysis (upper), b-actin served as a loading control. For real-time PCR analysis (lower), the data are expressed as the fold-increase over untreated cells (set at 1.). These data represent the mean ± s.e.m. of three independent experiments. Right, ChIP assays of the transactivation of PPP1CA through an ERE motif in 5 upstream (upper), and luciferase assays of the transactivation of PPP1CA using a luciferase reporter containing an ERE motif conserved within 5 upstream of the PPP1CA gene (lower). The data represent the mean ± s.e.m. of three independent experiments. (g) The predicted PKA binding regions in, as determined using Hou et al. 24 and the PSIVER software. The bold letters indicate the potential PKA binding regions in. (h) Expression patterns of PKA protein in breast cancer cell lines. (i) Statistical analysis of PKA and binding to (right) and PKA (left) immunoprecipitates, respectively. These data are expressed as the fold-increase over untreated cells (set at 1.), and represent the mean ± s.e.m. of three independent experiments. (j) Statistical analysis of in vitro PKA activity of and PKA immunoprecipitates. These data represent the mean ± s.e.m. of three independent experiments. (k) The predicted phosphorylation sites of by PKA, as determined using NetPhos 3.1 software. (l) Phosphatase activity of in a pseudo-phosphorylation mutant of (S35E and S128E) and alanine mutant of (S35A and S128A). (m) The inhibitory effects of sipka on phosphorylation. Representative results are shown from one of two experiments. (n) 2DICAL analysis of engineered peptides representing S35 and S128 on with recombinant PKA (recpka). **P<.1, P<.1 (two-sided Student s t-test)

a c 1 nm 1 mm ERAP pser- ERa Nucleus of ERa - - + + - - + + - + - + - + - + for 24 hr + ERAP l-ppase + + ERAP b 1 h 3 h 6 h 12 h 18 h 24 h + + + + + + + + + + + + ERAP - + - + - + - + - + - + pser- ps39- ps39- ps39-5 mm d HEK293T cells Myc- FLAG-ERa + + + + HA- WT S39A Cyto Nuc Cyto Nuc - - - - 1 mm ERAP - - + - - + - - + - - + FLAG IgG 5 FLAG-ERa HA- FLAG-ERa HA- FLAG-ERa ps39- HA- tubulin lamin Supplementary Figure 2 is phosphorylated at S39 via PKCa. (a) Serine phosphorylation of in ERa immunoprecipitates of the nuclear fraction of after ± ERAP treatment for 24 h. (b) Time course of serine phosphorylation of in after ± ERAP treatment for the indicated time. (c) Representative immunofluorescence images of phosphorylation at S39; (green), phosphorylated S39 (red). (d) The subcellular localization of phosphorylation at S39 in the presence of in the cytoplasmic (Cyto) and nuclear (Nuc) fractions of the indicated (WT, S39A) and ERa construct-transfected HEK293T cells. a/b-tubulin (tublin) and laminin B (lamin) were used as loading controls for the cytoplasmic and nuclear fractions, respectively.

Free phosphate released from phospho- (A 62 ) Free phosphate released from phospho- (A 62 ) a.35.3..2.15.1.5 siegfp sipka si -immunoprecipitates : 24 h - siegfp sipka si - - - b ps35- ps128- HA-ERa + + FLAG- WT D - - HEK293T cells 1. 1.3 1.6 2.4 FLAG- ps39- FLAG- c.4.3.2.1 / inhibitor (-) 5 (mm) 1 nm -immunoprecipitates (-) 1 nm / inhibitor 5 (mm) ps35-1. 1.1.3.1 1. 1. 1..7 ps128- d (-) 1 nm H-89 okadaic - -.5 1. 2 4 1..5. 1.1.9 1..5..8.6 1. 2.5 1.7 2.9 ps35- ps128- ps39- e Phospho- Phospho- peptide + Phospho- YGVRESVFTVE Supplementary Figure 3 Phosphatase activity of - regulates phosphorylation. (a) Phosphatase activity (left) and Western blot analyses (right) of immunoprecipitates of - and PKA-depleted against phospho-s39 peptide. Phosphatase activity was measured using malachite green. These data represent the means ± s.e.m. of three independent experiments. (b) The inhibitory effect of on S39 phosphorylation. The indicated

FLAG-tagged (WT, D) and HA-tagged ERa-transfected HEK293T cells, followed by immunoprecipitation with an anti- antibody. (c) The inhibitory effect of - binding inhibitor on phosphatase activity. were treated with - binding inhibitor for 24 h in the presence of and were immunoprecipitated using antibody. (d) The effects of PKA inhibitor H-89 and inhibitor okadaic acid on phosphorylation (S35 and S128) and phosphorylation (S39). were treated with H-89 or okadaic acid for 24 h in the presence of and were immunoprecipitated using or antibody. (e) Q-TOF spectra indicating dephosphorylation of phospho--peptide by in positive ion mode. The dephosphorylation of peptide is exemplarily shown for m/z 643.3. Upper, the left spectrum is an untreated control, and the right spectrum was acquired after dephosphorylation with. Lower, product ion spectrum of the peptide YGVRESVFTVE, with a precursor mass of m/z 643.3. P<.1 (two-sided Student s t-test).

% Phosphorylation of Relative expression a b c 3.5 3 2.5 2 1.5 1.5 MCF-7 KPL-3C ZR--1 PKCa PKCe CAMK2 1 nm 1 mm ERAP ps39- siegfp sipka - + + - + - - + - - + + 1..9 peptide + PKCa Phospho- d e 8 6 4 2 recombinant PKCa (ng) 6. 12.5 5.1 mg + + + + + 1 nm - + + 1 mm ERAP - - + ps39- ps39- PKCa ps39- PKCa YGVREpSVFTVE ps39- IPs + + + + + + recombinant (ng) 6. 12.5 5 (pmole).16.33.65 1.3 2.6 P f % De-phosphorylation 35 82 85 83 IB : PKA depletion PKCa depeltion P PKA S39 PKCa P PKA P S39 P PKCa Supplementary Figure 4 PKCa is confirmed to be responsible kinase for S39 phosphorylation. (a) Expression patterns of PKCa, PKCe, and CAMK2 in ERa-positive breast cancer cell lines (MCF-7, KPL-3C and ZR--1) using real-time PCR. (b) The inhibitory effects of sipka on phosphorylation at S39 in after ± ERAP treatment for 24 h. (c) Q-TOF spectra of direct peptide phosphorylation by PKCa in positive ion mode. The phosphorylation of peptide is exemplarily shown for m/z 683.3. Upper, the left spectrum is an untreated control, and the right spectrum was acquired after phosphorylation with PKCa. Lower, product ion spectrum of the phosphor-s39 peptide YGVRE(pS)VFTVE, with a precursor mass of m/z 683.3. (d) Statistical analysis of the ratio of phosphorylation at S39 in full-length by PKCa. These data are expressed as the percentage of phosphorylated band in total band and represent the mean ± s.e.m. of four independent experiments. (e) Dephosphorylation of phosphorylation at S39 immunoprecipitated by phospho-specific (S39) antibody from treated with /ERAP for 24 h. (f) Schematic illustration of -PKA- tricomplex under the depletion of PKA (left) and PKCa (right).

Cumulative survival Cumulative survival Intensity Cumulative survival a P <.1 n = 73 mrna 2 15 Low (47) 5 Normal Tumour Log Rank =.1 High (26) Disease-free survival (year) b protein Score (1) Score 1+ (24) c Cytoplasmic phospho- Presence (48) Score 2+ (32) Absence (34) Log Rank : P <.1 Score 3+ (16) Log Rank =.9 Disease-free survival (year) Disease-free survival (year) Supplementary Figure 5 overexpression was predictive of worse outcomes in ERa-positive breast cancer. (a) mrna expression of in patients with ERa-positive breast cancer (left) and Kaplan-Meier curves of overall survival as a function of expression (right) based on the TCGA data set. (b, c) Kaplan-Meier analysis of survival associated with protein (b) and cytoplasmic phosphorylation at S39 (c) in representative ERa-positive breast cancer specimens.

Uncropped images of Figure 1a Uncropped images of Figure 1b 15 IP IgG - - - 15 KPL-3C cells IP IgG - - - KPL-3C cells : IP sirna Control sirna Control - - - - - - 15 15 5 5 5 5 Uncropped images of Figure 1c 15 IP PKA catalytic IgG - - - - 15 KPL-3C cells IP PKA catalytic IgG - - - - 5 5 PKA catalytic PKA catalytic Uncropped images of Figure 1d 15 5 siegfp sipka siegfp sipka - - - - 15 siegfp - - pser sipka siegfp sipka - - pthr siegfp sipka - - KPL-3C cells siegfp sipka - - pser- pthr- Uncropped images of Figure 1f FLAG- 15 5 WT - FLAG T162A S39A S689A S9A S128A S1763A - - - - - - 15 5 5 WT T162A S39A S689A S9A S128A S1763A - - - - - - - Continued on the following page

Uncropped images of Figure 1g IP: Time (h) 12 24 1 nm - - + - + 15 IP: Time (h) 12 24 1 nm - - + - + 12 24 - - + - + IP: 12 24 - - + - + 15 5 IP: IgG 12 24 - - + - + 15 ps35- ps128- Uncropped images of Figure 2b Uncropped images of Figure 2c 15 siegfp si Cyto Nunc Cyto Nunc - - - - HA-Ab HA- - WT S39A - WT S39A - - - - - - lamin 5 5 5 tubulin Phospho- (Ser39) HA-Ab 5 ps39- Uncropped images of Figure 2d IP: IGF-1Rb FLAG- + + + + Myc-ERa + + + + HA- WT S39A WT S39A 1 nm - + + - + + - + + - + + 1 mm ERAP 15 - - + - - + - - + - - + HEK293T cells 15 + + + + - WT + + - S39A + + - - + - - + 15 5 15 IGF-1Rb FLAG- Myc-ERa HA- P-IGF-1Rb (Y1135/Y1136) ps39-15 5 IGF-1Rb FLAG- Myc-ERa HA- Continued on the following page

Uncropped images of Figure 2e FLAG- 15 HEK293T cells FLAG Mock WT S35A S128A - - - - FLAG- FLAG- 15 HEK293T cells FLAG Mock WT S35A S128A - - - - FLAG- 5 5 5 5 15 ps35-15 ps128- Uncropped images of Figure 2f 15 siegfp sipka si siegfp sipka si - - - - - - 15 siegfp sipka si siegfp sipka si - - - - - - ps35- ps128-5 5 5 ps39- siegfp sipka si siegfp sipka si - - - - - - Uncropped images of Figure 3a 1 nm 1 mm ERAP siegfp sipkca - + + - + + - - + - - + siegfp sipkca - + + - + + - - + - - + Cytoplasm Nucleus siegfp sipkca siegfp sipkca - + + - + + - + + - + + PKCa ERAP - - + - - + - - + - - + Cytoplasm 5 ps39- PKCa 5 lamin tubulin Nucleus 5 Continued on the following page

Uncropped images of Figure 3c : PKCa.1 mg + + + + + + recombinant PKCa (ng) 6. 12.5 5 + + + + + + 6. 12.5 5 P IB : IB : ps39- Uncropped images of Figure 3d Phospho- + + + + + + recombinant (ng) 6. 12.5 5 + + + + + + 6. 12.5 5 P IB : IB : ps39- Uncropped images of Figure 3e 6 h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm - + - + - + - + - + - + 15 12 h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm - + - + - + - + - + - + 15 5 5 ERa ERa 5 5 PKCa PKCa 5 5 ps39- ps39- Continued on the following page

MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 Uncropped images of Figure 3e 24 h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm - + - + - + - + - + - + 15 24 h IP: siegfp sipka sipkca siegfp sipka sipkca - + - + - + - + - + - + PKCa 5 5 ps39- ERa 5 Uncropped images of Supplementary Figure 1a Uncropped images of Supplementary Figure 1b 15 FLAG IgG HA-ERa + + + + + + FLAG- WT D WT D WT D - - - - - - FLAG- 15 5 b-actin 5 Uncropped images of Supplementary Figure 1c HEK293T cells FLAG- mock D - mock D - DNA (mg) 2..5 1. 2. 2. 2..5 1. 2. 2. 15 FLAG- 5 Uncropped images of Supplementary Figure 1d 15 - si si - si si - - - - - - 15 KPL-3C cells siegfp si si siegfp si si - - - - - - 5 5 Continued on the following page

MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 Uncropped images of Supplementary Figure 1f MCF-7 tamoxifen - - + - ERAP - - - + - + + + KPL-3C - - + - - - - + - + + + MCF-7 - - + - - - - + - + + + KPL-3C - - + - - - - + - + + + 5 5 b-actin Short exposure Long exposure Uncropped images of Supplementary Figure 1h 5 5 b-actin Uncropped images of Supplementary Figure 1m siegfp sipka siegfp sipka 1 nm 5 1 5 1 5 1 5 1 (min) 15 siegfp sipka siegfp sipka 1 nm 5 1 5 1 5 1 5 1 (min) 15 ps35- ps128-5 Uncropped images of Supplementary Figure 2a Uncropped images of Supplementary Figure 2b 1 nm 1 mm ERAP 5 Nucleus of ERa - - + + - - + + - + - + - + - + ERa 1 h 3 h 6 h 12 h 18 h 24 h 1 nm + + + + + + + + + + + + 1 mm ERAP - + - + - + - + - + - + 5 b-actin pser- 5 pser- 5 b-actin Continued on the following page

Uncropped images of Supplementary Figure 2c 5 HEK293T cells IP: FLAG Myc- + + Myc- + + FLAG-ERa + + FLAG-ERa + + HA- WT S39A HA- WT S39A Cyto Nuc Cyto Nuc Cyto Nuc Cyto Nuc 1 nm - + + - + + - + + - + + - + + - + + - + + - + + 1 mm ERAP - - + - - + - - + - - + ERAP - - + - - + - - + - - + FLAG-ERa 5 FLAG-ERa HA- HA- IP: IgG FLAG-ERa 5 5 ps39- HA- 5 lamin tubulin Uncropped images of Supplementary Figure 3a 15 5 siegfp sipka si siegfp sipka si - - - - - - 15 5 siegfp sipka si siegfp sipka si - - - - - - siegfp sipka si siegfp sipka si - - - - - - ps35- ps128- Uncropped images of Supplementary Figure 3b Uncropped images of Supplementary Figure 3c FLAG- 15 5 WT D - - HEK293T cells wt D - - FLAG- WT D - - / (-) 1nM (-) 1nM (-) 1nM -Peptide (mm) 5 5 5 15 ps128-5 15 5 (-) 1nM 5 ps35- (-) 1nM 5 5 ps39- Continued on the following page

Uncropped images of Supplementary Figure 3d 15 15-1 nm - 1 nm H-89 okadaic H-89 okadaic - -.5 1 2 4 - -.5 1 2 4 ps35- ps128- - 1 nm - 1 nm H-89 okadaic H-89 okadaic - -.5 1 2 4 - -.5 1 2 4 ps39- Uncropped images of Supplementary Figure 4b 1 nm 1 mm ERAP 5 siegfp sipka - + + - + + - - + - - + ps39-5 Uncropped images of Supplementary Figure 4d ps39-1nm - + + - + + - + + 1 mm ERAP - - + - - + - - + 15 5 PKCa ps39- IPs recombinant (ng) + + + + + + 6. 12.5 5 IB : P ps39- Supplementary Figure 6 Full-length images of immunoblots. Uncropped images of scanned immunoblots in Figures and Supplementary figures with size marker indications (kda)

Supplementary Table 1. Mascot Search Results MS/MS Fragmentation of GSGCSCTAPALSGPVAR (upper) and CWSLVAPH (lower) found in _HUMAN in Sprot

Supplementary Table 2. Clinical characteristic and results of immunohistochemistry of ERa-positive breast cancer specimens. Case intensity (-3) intensity (-3) Nucleus Cytoplasm DFI (year) Recurrence Age Menopause Tumour size Lymph node metastasis 1 2 2 1 5. + 44 Pre < 2 cm n I 2 2 1 8.9 48 Post 2.1-5 cm n I 7 1 2 2 6.48 44 Pre < 2 cm n IIA 9 2 3 1 1. 69 Post 2.1-5 cm n1 IIB 1 2 2 1 6.92 + 58 Post 2.1-5 cm n1 II 12 2 1 7.17 63 Post 2.1-5 cm n IIA 2 1 3 2 1. 48 Pre 2.1-5 cm n I 22 1 1 8.81 71 Post < 2 cm n IIA 29 7.2 82 Post < 2 cm n IIA 3 3 3 1 5.83 + 47 Pre 2.1-5 cm n IIA 32 1 6.84 + 7 Post < 2 cm n1 IIB 35 1 2 1 4.51 + 55 Post < 2 cm n II 36 1 3 1 7.22 69 Post 2.1-5 cm n IIA 1 3 1 8.5 58 Post < 2 cm n I 39 3 6.73 42 Pre 2.1-5 cm n I 41 1 3 1 9.48 45 Pre 2.1-5 cm n I 43 3 1 8.24 51 Post < 2 cm n I 44 3 1 2 5. 58 Post 2.1-5 cm n I 45 2 3 2 8.1 48 Pre 2.1-5 cm n1 I 46 2 5.62 46 Pre 2.1-5 cm n I 47 2 5.54 4 Pre 2.1-5 cm n I 48 3 1 1.17 + 51 Post 2.1-5 cm n IIA 49 1 3 1 1. 49 Pre < 2 cm n I 5 2 2 1 7.5 55 Post < 2 cm n I 51 2 1 6.38 44 Pre < 2 cm n I 55 2 1 6.13 55 Post 2.1-5 cm n I 57 1 1 7.6 71 Post 2.1-5 cm n1 IIA 58 2 5.83 46 Pre < 2 cm n I 61 2 3 1 9.6 67 Post < 2 cm n IIA 62 2 3 2 9.98 48 Pre < 2 cm n1 I 7 2 3 1 1. 51 Post 2.1-5 cm n I 73 2 3 2 1. 59 Post < 2 cm n I 74 3 7.11 + 55 Post < 2 cm n1 I 76 2 1 5.62 55 Post < 2 cm n I 77 3 1 6.21 + 63 Post < 2 cm n I 78 1 6.8 72 Post < 2 cm n I 79 3 2 5.57 54 Post 2.1-5 cm n II 82 3 9.1 + 45 Pre 2.1-5 cm n II 85 1 3 1 7.17 5 Pre 2.1-5 cm n1 II 86 2 3 6.99 5 Pre < 2 cm n I 88 1 3 2 9.81 46 Pre < 2 cm n I 89 2 1 3. 52 Pre 2.1-5 cm n II 92 3 1. + 4 Pre 2.1-5 cm n II 93 3 1 5.18 + 49 Pre < 2 cm n I 95 2 4.99 58 Post < 2 cm n I 96 2 4. 78 Post 2.1-5 cm n II 3 5.14 + 46 Pre 2.1-5 cm n II 11 2 3.8 52 Pre < 2 cm n I 12 3 5.66 44 Pre < 2 cm n I 13 2 1 4.98 58 Post < 2 cm n I 117 1 4.49 48 Pre < 2 cm n I 118 1 1 4.68 64 Post < 2 cm n1 II 12 2 6.63 + 57 Post < 2 cm n II 122 2 1 1 3.12 53 Post 2.1-5 cm n I 124 3 1. 39 Pre 2.1-5 cm n I 1 2 5.2 7 Post < 2 cm n II 129 2 2.42 + 68 Post 2.1-5 cm n II 135 2 1 4.67 7 Post < 2 cm n I 136 1 5.38 47 Post < 2 cm n I 138 1 6. 51 Pre < 2 cm n IIA 145 2 4.8 56 Post < 2 cm n I 146 1 3 2 9.99 58 Post < 2 cm n I Continued on the following page 155 2 4.66 68 Post 2.1-5 cm n II Stage

138 1 6. 51 Pre < 2 cm n IIA 145 2 4.8 56 Post < 2 cm n I 146 1 3 2 9.99 58 Post < 2 cm n I 155 2 4.66 68 Post 2.1-5 cm n II 156 2 1 9.5 46 Pre < 2 cm n I 159 3 2. + 4 Pre 2.1-5 cm n II 161 1 1 1 5.43 48 Pre 2.1-5 cm n I 163 1 3 1 9.34 49 Pre < 2 cm n I 168 1 3 1 7.81 51 Post 2.1-5 cm n II 17 2 2 8.8 63 Post 2.1-5 cm n1 II 174 1 1 5.72 43 Pre 2.1-5 cm n II 176 3 3 2 5.51 8 Post 2.1-5 cm n II 18 3 5. 78 Post 2.1-5 cm n II 181 2 1 5.66 7 Post < 2 cm n I 182 3 5.6 68 Post < 2 cm n I 187 1 3 2 7.73 58 Post < 2 cm n I 192 2 3 1 8.4 71 Post 2.1-5 cm n II 193 3 5. 46 Pre 2.1-5 cm n II 195 3 7.96 49 Post < 2 cm n I 198 2 4.93 54 Post < 2 cm n I 23 1 1 6.68 5 Pre < 2 cm n I 1 1 1 5.26 44 Pre 2.1-5 cm n II 28 1 3 2 1. 47 Pre < 2 cm n1 I

Supplementary Table 3. The sequences of each primer set. Genes Sequence 5 -CGGAATTCATGGAAGAAATCCTGAGGA AGC-3 (forward) 5 -ATAGTTTAGCGGCCGCACAATGATGTCATAGACACGG-3 (reverse) Purpose mutant (T162A) mutant (S35A) mutant (S35E) mutant (S689A) mutant (S9A) mutant (S128A) mutant (S128E) mutant (S1763A) (S39A) PKCa PKCe CAMK2 5 -GTGCGGGCAGCCCTCAGTCAA-3 (forward) 5 -TTGACTGAGGGCTGCCCGCAC-3 (reverse) 5 -TCAGGCTGCGCCTGCACTGCG-3 (forward) 5 -CGCAGTGCAGGCGCAGCCTGA-3 (reverse) 5 -GGCCGAGGAGAAGGCTGCTCC-3 (forward) 5 -GGAGCAGCCTTCTCCTCGGCC-3 (reverse) 5 -CGGCTCCTGGCCCTCTCCAAT-3 (forward) 5 -ATTGGAGAGGGCCAGGAGCCG-3 (reverse) 5 -GCACGGCTGGCCTGCGCTCTA-3 (forward) 5 -TAGAGCGCAGGCCAGCCGTGC-3 (reverse) 5 -CGCTGCTGGGCCCTTGTGGCC-3 (forward) 5 -GGCCACAAGGGCCCAGCAGCG-3 (reverse) 5 -CGCTGCTGGGAACTTGTGGCC-3 (forward) 5 -GGCCACAAGTTCCCAGCAGCG-3 (reverse) 5 -AGATACATCGCCATGCAGAAC-3 (forward) 5 -GTTCTGCATGGCGATGTATCT-3 (reverse) 5 -CGGAATTCCAGACCGTGCATCATGGCCCAGAACTTGAAGGA-3 (forward) 5 -CCGCTCGAGTTTCTTACCCTTGATGAGGCTGT-3 (reverse) 5 -GTGCGCGAAGCCGTGTTCACC-3 (forward) 5 -GGTGAACACGGCTTCGCGCAC-3 (reverse) 5 -CCCAAGAATGAAAGCAAGCA-3 (forward) 5 -CCGAAACTCCAAAGGAAAGG-3 (reverse) 5 -TCAAGCAGCACCCATTCTTC-3 (forward) 5 -TCAGGGCATCAGGTCTTCAC-3 (reverse) 5 -TCAGGGCATCAGGTCTTCAC-3 (forward) 5 -GGGGAGAGAGGCAATGAAGA-3 (reverse) Real-time PCR Real-time PCR Real-time PCR b2-microglobulin 5 -AACTTAGAGGTGGGGAGCAG-3 (forward) 5 -CACAACCATGCCTTACTTTATC-3 (reverse) Real-time PCR The underlines indicate the recognition sites of restriction enzymes. Double-underlines indicate the mutation sites.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback