Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft agar colony formation by H-RasV12-transduced p53 -/- and DKO MEFs. (B) Focus formation assay using p53 -/- and DKO MEFs transduced with H-RasV12 and K-RasV12. (C) Histological analysis of fibrosarcomas produced by K-RasV12-transformed p53-null (top) and DKO (bottom) MEFs. Representative photographs are shown. Original magnification, 40.
S2 Figure S2. MIF Deficiency Alters the DNA Binding Properties of E2Fs and Affects the Composition of Rb/E2F Complexes (A) Chromatin immunoprecipitaion analysis of cdc2, cdc6, mcm5, and p107 promoter occupancy by Rb in p53 -/- and DKO MEFs expressing H-RasV12 plus E2F1 or E2F4. (B) Immunoblot analysis of E2F1 E2F4 and DP1 proteins in nuclear extracts of vector- and H-RasV12-transduced p53 -/- and DKO MEFs. Erk is the loading control. (C) Lysates from vector- and H-RasV12-transduced p53 -/- and DKO MEFs were immunoprecipitated using DP1-specific mab followed by immunoblotting with the indicated antibodies. (D) Lysates from E2F1 + Ras and E2F4 + Ras-transduced p53 -/- and DKO MEFs were immunoprecipitated with DP1-specific mab followed by immunoblotting with the indicated antibodies.
Figure S3. Schematic representation of E2F mutants (A), E1A mutants (B), and Myc-deletion and E1A-Myc fusion constructs (C) used in this study. S3
S4 Figure S4. Induction of E2F-Responsive Genes Is Not Altered in MIF-Deficient Fibroblasts (A) We performed immunoblot analysis to determine if transformation differences between p53 -/- and DKO MEFs correlated with the expression of E2F-responsive genes. However, the analysis failed to reveal a functional difference between p53 -/- and DKO MEFs with respect to E2F transcriptional activity. In both genotypes, strong signaling by oncogenic Ras activated Rb and induced the downregulation of a number of Rb/ E2F-responsive genes involved in cell cycle progression (cyclin E, p107, and p130) and DNA replication (mcm2, mcm5, cdc6, and PCNA). Oncogenic Ras employs multiple strategies to activate the tumor suppressor properties of Rb, including the induction of the CDK4 inhibitor p16ink4a (Serrano et al., 1997), the direct downregulation of CDK4 expression (Lazarov et al., 2002) and of p27kip1 expression, which is required for the assembly of active CDK4/Cyclin D complexes (Cheng et al., 1999). All three of these changes were present in both genotypes and thus were MIF independent. Asterisk indicates a nonspecific band. (B and C) The C-terminal domains of E2F1 and E2F4 are not required for induction of E2F-responsive genes. H-RasV12-transformed p53 -/- and DKO MEFs were transduced with E2F1 and DbE2F1 (B) or E2F4, DbE2F4, and CDK4 (C). Lysates were immunoblotted using the indicated Abs. Erk is the loading control.
Figure S5. Rb Inactivation Restores the Transforming Properties of MIF-Deficient Cells (A) Semiquantitative RT-PCR analysis of E2F-responsive gene expression in p53 -/- and DKO MEFs transduced with the indicated retroviruses. Total RNAs were subjected to limited cycle PCR amplification using the following primers: tgtatctcatctttgagttc and gctctgaagatcctgaagag for CDC2, caggtgtcaaaagaccagg and gacagatgctactgtaggct for CDC6, cacaaggttcgaggtgacat and tgtgaggtctacattctctg for MCM2, caatccatgaggctatggag and cgcatgatgatgtagcggtt for MCM5, gatgaaggcccttagtggc and gagcttggaacttcccatct for cyclin E1, and aacggatttggccgtattggccg and gacaatcttgagggagttgtcata for GAPDH. The optimum number of cycles was determined empirically. (B) Rb inactivation restores Ras-mediated transformation of MIF-deficient fibroblasts. In order to overcome the sustained activation of Rb, Ras-expressing p53 -/- and DKO MEFs were transduced with retroviruses encoding CDK4. Subsequent immunoblot analysis showed that the release of the expression block imposed by activated Rb resulted in increased expression of E2F target genes in both genotypes as shown in Supplemental Figure S4B. Importantly, CDK4-mediated Rb inactivation dramatically restored the defective transformation of MIF-deficient DKO cells as shown by focus formation assays, whereas a kinase inactive CDK4 N158 mutant failed to do so. By contrast, ectopic expression of p16ink4a failed to compromise the transformation susceptibility of p53 -/- cells nor did it alter the one of DKO cells, consistent with already high endogenous p16 levels in Ras-transformed fibroblasts of both genotypes (see Supplemental Figure S4A). This result is consistent with previous observations that Ras plus CDK4, but not Ras alone, promote cyclin E accumulation, CDK2 activation, and subsequent Rb phosphorylation and hence bypass other mechanisms of growth inhibition induced by Ras (Lazarov et al., 2002). S5
S6 Figure S6. E2F4 Is Dispensable for Transformation of E1A- and Myc-Transduced MIF-Deficient Cells (A) Immunoblot analysis of endogenous c-myc and E2F1 E2F4 proteins in nuclear extracts of p53 -/- and DKO MEFs transduced with the indicated genes. Erk is the loading control. (B) Immunoblot analysis of c-myc and E2F1 E2F4 proteins in nuclear extracts of p53 -/- and DKO MEFs transduced with Ras alone or Ras plus CDK4. Erk is the loading control. (C) Focus formation assays of p53 -/- and DKO MEFs transduced with Ras plus the indicated combinations of genes. See Supplemental Figure S3 for description of E2F, E1A, and Myc mutants.
S7 Supplemental References S1. Cheng, M., Olivier, P., Diehl, J.A., Fero, M., Roussel, M.F., Roberts, J.M., Sherr, C.J. (1999). The p21(cip1) and p27(kip1) CDK inhibitors are essential activators of cyclin D-dependent kinases in murine fibroblasts. EMBO J. 18, 1571 1583. S2. Lazarov, M., Kubo, Y., Cai, T., Dajee, M., Tarutani, M., Lin, Q., Fang, M., Tao, S., Green, C.L., Khavari, P.A. (2002). CDK4 coexpression with Ras generates malignant human epidermal tumorigenesis. Nat Med. 8, 1105 1114. S3. Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., Lowe, S.W. (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16ink4a. Cell 88, 593.