BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

Similar documents
Zhu et al, page 1. Supplementary Figures

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

mtorc2 controls actin polymerization required for consolidation of long-term memory

Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Supplementary Materials for

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Supplementary Information

Nature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1. Distribution of starter cells for RV-mediated retrograde tracing.

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior

Nature Neuroscience: doi: /nn.4335

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1

SUPPLEMENTARY FIGURES

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

How Nicotinic Signaling Shapes Neural Networks

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

SUPPLEMENTARY INFORMATION

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Dep. Control Time (min)

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J.

Supplementary Information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1

F-actin VWF Vinculin. F-actin. Vinculin VWF

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Insulin-Leptin Interactions

Supplementary Figure 1

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH).

Supplementary Figure 1.

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Information

1.0. FSL NMDAR-fEPSP 0.8. amplitude (mv) Intensity (µa) 2.0 SD FSL Time (ms)

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1. Visualization of AT1a-positive cells using AT1a lacz/+ mouse.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary Figures

Supplemental Figure S1. RANK expression on human lung cancer cells.

Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Supplementary Materials for

Supplementary Figures

SORCS1 and SORCS3 control energy balance and orexigenic peptide production

Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Transcription:

Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels (y-axis), solid horizontal lines indicate the median, and whiskers indicate the 10% and 90% quantiles. (a) Elevated expression of CADM1 associates with risk allele (G) of rs12286929 in cerebellum. (b) Genotype dependent expression levels of CADM2 for the SNP rs13078807. The risk allele (G) is associated with higher expression levels in human cerebellum. Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 2 Increased Cadm1 expression in multiple brain regions of Lepob/ob mice is reversed upon ketogenic diet feeding. (a) Schematic representation of Cadm1 and Cadm2 engaged in homophilic (homo) and heterophilic (het) interactions. (b) (c) Western blot analysis of Cadm1 and Cadm2 in total and synaptosome-enriched lysates from cerebellum and hippocampus of 4-week-old Lep ob/ob mice and littermate controls. (d) Quantification of western blot analysis of Cadm1 in multiple brain regions of 16-week-old WT and Lep ob/ob mice on chow or ketogenic diet for 45 days. Cortex (ctx), striatum (str), hippocampus (hpc), hypothalamus (hyp), midbrain

(mid), hindbrain (hind), and cerebellum (cer) are shown. (e, f) Western blot analysis of Cadm1 in cerebellum and hippocampus of 16- week-old wild-type on normal chow (WT/chow) and Lep ob/ob mice on normal chow (Lep ob/ob /chow) or ketogenic diet (Lep ob/ob /keto). (g) Western blot analysis of Cadm1 from isolated hippocampus of 12-week old C57Bl/6 mice after administration of ketogenic diet for 4 or 8 days. Results are presented as mean ± s.e.m. *P<0.05 and **P<0.01. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 3 Cadm1 and Cadm2 total knockout mice exhibit decreased body weight, and increased insulin sensitivity and energy expenditure. (a) Body weight curves of Cadm1KO mice (n=10) and littermate controls (n=12). (b) Body weight-to-length ratio in Cadm1KO mice (n=10) and control littermates at age 12-weeks (n=13). (c) Glucose measurements during an insulin tolerance test (ITT) on 12-week old Cadm1KO mice (n=5) and control littermates (n=5). (d) Glucose measurements during an intraperitoneal glucose tolerance test (GTT) on 12-week old Cadm1KO mice (n=5) and control littermates (n=6). (e) Glucose measurements during a pyruvate tolerance test (PTT) on 12-week old Cadm1KO mice (n=5) and control littermates (n=6). (f) Quantification of food intake in 12-week old Cadm1KO (n=5) and littermate controls (n=6) during leptin challenge. Daily food intake and body weight was measured for 5 days prior to leptin administration for base line. Differences in daily food intake were normalized to daily body weight. (g) Quantification of body weight change in 12-week old Cadm1KO (n=5) and littermate controls (n=6) during leptin challenge. Differences in daily body weight were normalized to daily body weight. (h) Quantification of daily food intake in 12-week old Cadm1KO (n=10) and littermate controls (n=10). (i) Quantification of O 2 consumption, CO 2 production, and RER, respectively in 12-week old male Cadm1KO mice (KO) (n=9) and control littermates (WT) (n=11). (j) Quantification of core body temperature (CBT) in 12-week old male Cadm1KO mice (KO) (n=5) and control littermates (WT) (n=5). (k) Quantification of energy expenditure during day and night phases in 12-week old male Cadm1KO mice (n=9) and control littermates (n=11). (l) Locomotor activity measured during day and night phases in 12-week old male Cadm1KO mice (n=8) and control littermates (n=8). (m) Energy expenditure of individual animals plotted against locomotor activity in 12-week old Cadm1KO (n=7) and littermate controls (n=11). (n) Western blot analysis of Cadm2 and Cadm1 in cortex, cerebellum (cereb), hippocampus (hpc), hypothalamus (hyp), liver and lung from Cadm2KO (KO) mice compared to littermate controls (WT). (o) Representative confocal images of primary hippocampal neurons isolated from Cadm2KO and littermate control mice, stained for Cadm2 (green) and MAP2 (red). (p) Body weight curves of Cadm2KO mice (n=8) and littermate controls (n=8) from age post-natal day 3-21. (q) Glucose measurements during an ITT on 9-week old Cadm2KO mice (n=6) and control littermates (n=6). (r) Glucose measurements during a GTT on Cadm2KO mice (n=3) and littermates (n=8) and quantification of area under the curve (AUC). (s) Quantification of food intake in 10-week old Cadm2KO mice (n=7) and littermate controls (n=9). (t, u) Quantification of O 2 consumption, CO 2 production, and RER, respectively in 10-week old Cadm2KO mice (n=6) and littermate controls (n=8). (v) Quantification of energy expenditure in 10-week old Cadm2KO mice (n=6) and littermate controls (n=8). (w) Quantification of locomotor activity in 10-week old Cadm2KO mice (n=6) and littermate controls (n=8). (x) Energy expenditure of individual animals plotted against lean body mass (LBM) in 10-week old Cadm2KO mice (n=7) and littermate controls (n=8). (y) Energy expenditure of individual animals plotted against locomotor activity in 10-week old Cadm2KO mice (n=7) and littermate controls (n=8). Results in panels a, c, d, e, f, g, p, g, and r are presented as mean ± s.e.m. *P<0.05, and **P<0.01. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 4

Loss of Cadm1 reduces inhibitory post-synaptic currents in POMC neurons. (a) Immunostaining of Cadm1 (red), POMC-eGFP (green) and VGLUT2 (magenta) identifies limited Cadm1 and VGLUT2 expression in POMC neurons in the arcuate nucleus region (ARC) of the hypothalamus. High magnification images are outlined by white boxes. (b) Immunostaining quantification of POMC-GFP and Cadm1-positive cells in the ARC (GFP-positive cells: 188±28; GFP- and CADM1- positive cells: 23±5). (c) qrt-pcr analysis of Pomc, Npy and Agrp expression in the ARC region of 12-week old Cadm1KO mice (n=3), Lep ob/ob mice (n=3) and control littermates (WT) (n=4). (d) Summary of miniature IPSC frequency in POMC neurons from Cadm1KO and control littermates at the age of 3 weeks (top left). Example traces of IPSCs recorded from POMC neurons of Cadm1KO or control littermates (top right). Mean amplitude and cumulative probability distribution of IPSC frequencies from POMC neurons showing a significant shift in Cadm1KO mice (n=15) compared to littermate control mice (n=12) (lower left and right). (e) Summary of miniature EPSC frequency in POMC neurons from Cadm1KO and control littermates (top left). Example traces of EPSCs recorded from POMC neurons of Cadm1KO or control littermates (top right). Mean amplitude and cumulative probability distribution of EPSC frequencies from POMC neurons showing no change in Cadm1KO mice (n=7) compared to littermate control mice (n=11) (lower left and right). (f, g) Representative electron micrographs showing perikaryal membranes of egfp-expressing POMC neurons from Cadm1KO (KO) and wild-type littermates (WT) mice identify marked differences in the asymmetrical (excitatory) synaptic inputs contacting POMC neurons (Scale bar, 1 μm). (h) Quantification of asymmetrical, symmetrical and total synapse numbers in in Cadm1KO mice (n=6) and littermate controls (n=8). Results are presented as mean ± s.e.m. *P<0.05, **P<0.01 and ***P<0.001. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 5 Induction of Cadm1 in excitatory neurons increases co-localization with Cadm2. (a) Confocal images revealing partial co-localization of Cadm1 and VGLUT2 in the different mouse brain regions. Cadm1 (green) and VGLUT2 (red) co-localize in hippocampus (Hpc), medial habenula (MHb), and paraventricular hypothalamus (PVH) regions. High magnification images are identified by white boxes. Fluorescent intensity profiles of Cadm1 and VGLUT2 (measured along white lines) quantify the co-localization of Cadm1 and VGLUT2. (b, c) Representative confocal images of Cadm1 and Cadm2 expression in Slc17a6-Cre and (d, e) Slc32a1-Cre-positive primary hippocampal neurons. Immunostaining for Cadm1 or Cadm2 (red), ZsGreen (green), and Map2 (cyan). (f) Representative confocal images of Cadm1 and Cadm2 expression in primary hippocampal neurons of Cadm1KO, Tg-Cadm1, and WT mice. (g) Quantification of O 2 consumption, CO 2 production, RER and energy expenditure (EE), in 14- week old Tg-Cadm1 mice (n=6) and littermate controls (n=8). (h) Representative confocal images of Cadm1, Cadm2, and VGLUT2 expression in primary hippocampal neurons of Cadm1KO, Tg-Cadm1, and WT mice. Immunofluorescence detection of Cadm1 (red), Cadm2 (green), and VGLUT2 (cyan) in dendritic branches identifies areas of co-localization. (i) Fluorescence intensity profiles of Cadm1 and Cadm2 (measured along white dashed lines in (h) quantify areas of co-localization. (j) Pearson correlation indicates increased association between Cadm1 and Cadm2 expression in Tg-Cadm1 (n=9) mice compared to wild-type control littermates (n=10). Results are presented as mean ± s.e.m. *P<0.05. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 6 Loss of Cadm1 in excitatory neurons improves glucose homeostasis and insulin sensitivity. (a) Confocal imaging of coronal brain slice identifying ZsGreen expression in Slc17a6-ires-Cre, lox-zsgreen mice at age 12 weeks. (b) Western blot analysis of Slc17a6-Cre-mediated reduction of Cadm1 expression in hippocampus (hpc), cortex, and olfactory bulb (Olf bulb). (c) Confocal imaging of coronal brain slice identifying egfp expression in Slc32a1-ires-Cre, lox-zsgreen mice at age 12 weeks. (d) Western blot analysis of Slc32a1-Cre-mediated reduction of Cadm1 expression in hypothalamus (Hypoth), striatum (Striat), and olfactory bulb (Olf bulb). (e) Body weight curves in Cadm1 flox/flox mice (n=6) and littermate controls (n=6) from age postnatal day 0-21. (f) Body weight-to-length ratio in Cadm1 flox/flox mice (n=4) and control littermates (n=8) at age 3-weeks. (g) Body weight curves in Slc32a1-Cre, Cadm1 flox/flox mice (n=8) and littermate controls from 4-12 weeks of age (n=8). (h) Glucose measurements during an ITT on 12-week old Slc32a1-Cre, Cadm1 flox/flox mice (n=4) and control littermates (n=6) and quantification of area under the curve (AUC). (i) Glucose measurements during a GTT on Slc32a1-Cre, Cadm1 flox/flox mice (n=5) and control littermates (n=8). (j) Energy expenditure of individual animals plotted against lean body mass in 12-week old Slc32a1-Cre, Cadm1 flox/flox mice (n=7) and littermate controls (n=8). (k) Energy expenditure of individual animals plotted against locomotor activity in 12-week old

Slc32a1-Cre, Cadm1 flox/flox mice (n=7) and littermate controls (n=8). (l) Quantification of locomotor activity and food intake measured in 12-week old Slc32a1-Cre, Cadm1 flox/flox mice (n=8) and littermate controls (n=8). (m) Body weight, blood glucose, and plasma insulin values before initiating hyperinsulinemic-euglycemic clamp studies on 12-week old Cadm1 flox/flox mice (n=6) and control littermates (n=4). (n) Plasma glucose concentrations and glucose infusion rate during hyperinsulinemic-euglycemic clamp studies on 12-week old Cadm1 flox/flox mice (n=6) and control littermates (n=4). (o) Endogenous glucose production in the basal and the clamped state and suppression of hepatic glucose production in Cadm1 flox/flox mice (n=6) and control littermates (n=4). (p) Peripheral glucose uptake, glycolysis rate, glycogen synthesis, plasma insulin levels during the hyperinsulinemic-euglycemic clamp studies in 12-week old Cadm1 flox/flox mice (n=6) and control littermates (n=4). Results in panels e, g, h, I, and n are presented as mean ± s.e.m. *P<0.05, **P<0.01 and ***P<0.001. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 7 Loss of Cadm1 in excitatory neurons increases long-term potentiation and long-term depression in hippocampal neurons. (a) Representative electron micrograph images from hippocampus of Cadm1 flox/flox mice and littermate controls. (b) Quantification of excitatory synapse number per volume fraction or per area and (c) Relative post-synaptic densities (PSD) length in hippocampus in Cadm1 flox/flox mice (n=3) and littermate controls (n=3). (d) Western blotting analysis of Cadm1 and PSD95 in total and synaptosome-enriched lysates from hippocampus of 12-week old Cadm1 flox/flox mice (n=2) and control littermates (n=2). (e) Cadm1 glutamatergic deficiency results in increased basal synaptic transmission. Representative fepsps responses at increasing stimulation intensities (10-100 µa, color coded) show higher amplitudes for Cadm1 flox/flox as compared to WT controls. Synaptic transmission was measured as the relationship of fepsp slope vs fiber volley (FV) amplitudes. Two-way RM ANOVA revealed no significant changes for FV amplitudes (P=0.739). Slope of fepsp was significantly facilitated (P=0.029) in Cadm1 flox/flox mice (WT n=18, N=9; Cadm1 flox/flox n=20, N=9). (f) LTP induction in MPP-DG

synapses is facilitated in Cadm1 flox/flox mice. Representative traces are the average of 20 fepsps recorded 10 min before (black) and 50 60 min after LTP induction (grey). Higher LTP values measured 50 60 min after induction were detected in Slc17a6- Cre, Cadm1 flox/flox as compared to WT control (P=0.021, WT n=8, N=8; Cadm1 flox/flox n=9, N=8). (g) LTD induction in MPP- DG synapses is facilitated in Cadm1 flox/flox mice. Representative traces are the average of 20 fepsps recorded 10 min before (black) and 50 60 min after LTD induction (grey). Facilitated LTD values measured 50 60 min after induction were detected in Cadm1 flox/flox as compared to WT control (P=0.032, WT n=9, N=8; Cadm1 flox/flox n=10, N=9). Results are presented as mean ± s.e.m. *P<0.05. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 8 Tracing analysis identifies VGLUT2-positive afferent inputs to the ARC originating from the PVH, MHb, and Hpc regions. (a) Western blot analysis of Cadm1 expression in total lysates from hippocampus and cortex after delivery of AAV-Cre to floxed Cadm1 mice (flox/flox) and control littermates (+/?). Total hippocampal lysates from Cadm1KO (KO) and Cadm1 flox/flox (Vglut2) serve as positive controls for loss of Cadm1 expression. (b) Quantification of O 2 consumption, CO 2 production, energy expenditure, locomotor activity and RER in 9-week old floxed Cadm1 mice (flox/flox) (n=7) and control littermates (+/?) (n=6). (c) Representative confocal images of coronal sections through the brain of Slc17a6-Cre/POMC-eGFP transgenic mice stereotaxically injected with AAV2/EF1a-DIO-hChR2(H134R)-mCherry into the paraventricular hypothalamus (PVH), habenular nuclei (Hb), and hippocampus (Hpc). Nuclei have been visualized with DAPI staining. High magnification images are identified by white boxes. (d) Representative coronal brain section of Cadm1 floxed mice after stereotaxic raav8-camkiia-mcherry-cre injection to hypothalamic neurons in the paraventricaular hypothalamus (PVH), and ventromedial hypothalamus (VMH) regions to target Cre expression to excitatory neurons in these areas; confocal imaging of mcherry and the neuronal marker NeuN. (e) Representative western blot analysis showing AAV-Cremediated deletion of Cadm1 after stereotaxic injection of raav8-camkiia-mcherry-cre into the PVH region of the hypothalamus. (f) Quantification of locomotor activity, O 2 consumption, CO 2 production, RER, and energy expenditure from 9-week old floxed Cadm1 mice (n=9) and control littermates (n=8) after stereotaxic injection of raav8/camkii-mcherry-cre injection into the hypothalamus. (g) Glucose measurements during an ITT on 9-week floxed Cadm1 mice (n=6) and control littermates (n=6) after stereotaxic injection of raav8/camkii-mcherry-cre injection into the hypothalamus. (h) Representative confocal images of coronal sections through the brain of Slc17a6-Cre/POMC-eGFP transgenic mice stereotaxically injected with AAV2/EF1a-DIO-hChR2(H134R)-mCherry into the hippocampus (Hpc). High magnification image of the PVH is identified by dashed box. (i) Representative confocal images of coronal sections through the brain of Slc17a6-Cre/POMC-eGFP transgenic mice stereotaxically injected with AAV2/EF1a-DIO-hChR2(H134R)- mcherry into the paraventricular hypothalamus (PVH). High magnification image of the hippocampus is identified by dashed box. (j) Confocal image analysis after stereotaxic injection of AAV2/EF1a-DIO-hChR2(H134R)-mCherry to the habenular nuclei (Hb) of Slc17a6-Cre/POMC-eGFP transgenic mice. Axonal varicosities (red) and POMC-positive neurons (green) are visualized within the ARC region of the hypothalamus. Dotted white circles outline egfp-pomc-positive cell body, used for 3D reconstruction analysis. (k) Surface rendering of Amira 3D reconstruction of egfp-pomc-positive cell body receiving afferent inputs from the MHb. Cell is represented in red, while the synaptic input is color-coded, with the cold to warm colors spreading from 0 to 250nm distance between axonal varicosities and the soma (see color-coded horizontal bar for the distance definition). (l) Histogram shows the number of anterograde AAV-mCherry-labelled MHb axonal varicosities found within 250nm distance from the POMC cell body. (m) Double immunostaining of Cadm1 and mcherry in MHb region identify Cadm1-positive anterograde projections to the ARC region of hypothalamus. Results in panel g are presented as mean ± s.e.m. *P<0.05, and **P<0.01. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 9 Lepr-Cre-mediated deletion of Cadm1 impacts insulin sensitivity. (a) Glucose measurements during an ITT on 12-week old Agrp-Cre, Cadm1 flox/flox mice (n=3) and control littermates (n=5). (b) Glucose measurements during an ITT on 12-week old Pomc-Cre, Cadm1 flox/flox mice (n=6) and control littermates (n=6). (c) Glucose measurements during an ITT on 12-week old Sim1-Cre, Cadm1 flox/flox mice (n=6) and control littermates (n=10). (d) Body weight in Lepr- Cre, Cadm1 flox/flox mice (n=4) and littermate controls (n=7). (e) Glucose measurements during an ITT on 12-week old Lepr-Cre, Cadm1 flox/flox mice (n=3) and control littermates (n=5). (f) Correlation of energy expenditure of individual animals plotted against lean body mass in in 12-week old male Lepr-Cre, Cadm1 flox/flox mice (n=7) and littermate controls (n=8). (g) Quantification of locomotor activity and daily food intake in 12-week old Lepr-Cre, Cadm1 flox/flox mice (n=12) and littermate controls (n=12). (h) Body weight in ob/lepr-cre, Cadm1 flox/flox mice (n=3) and Lep ob/ob littermates (n=3). (i) Random-fed and fasted blood glucose and random-fed plasma insulin in 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=5) and Lep ob/ob littermates (n=7). (j) Glucose measurements during an insulin tolerance test on 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=5) and Lep ob/ob littermates (n=7). (k) Glucose measurements during a glucose tolerance test on 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=5) and Lep ob/ob littermates (n=6). (l) Glucose measurements during a pyruvate tolerance test on 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=3) and Lep ob/ob littermates (n=4). (m) Pancreatic β- cell mass and insulin content measurements in Lepr-Cre, Cadm1 flox/flox (n=5), ob/lepr-cre, Cadm1 flox/flox (n=7), Lep ob/ob (n=5), and wildtype (WT) littermate controls (n=6) from 12 weeks of age. (n) Energy expenditure per individual animals plotted against lean body mass in 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=6) and Lep ob/ob littermates (n=7). (o) Quantification of locomotor activity and daily food intake in 12-week old ob/lepr-cre, Cadm1 flox/flox mice (n=6) and Lep ob/ob littermates. (n=8). Results in panels a-e, h, and j-l are presented as mean ± s.e.m. *P<0.05, and **P<0.01. Boxplots show median, lower and upper quartiles (box), and minimum and maximum (whiskers). Statistical analyses are described in the Methods and Supplementary Table 3.

Supplementary Figure 10 Immunostaining of Cadm1 with Vglut2-positive afferent projections in contact with POMC neurons. (a) Quadruple immunostaining within the ARC region showing Cadm1 and Vglut2-positive afferent projections in contact with POMC neuron. Arrows indicate colocalization of mcherry punctas with Cadm1 and Vglut2. Slc17a6-Cre-positive mice received stereotaxic injection of AAV2-mCherry to the PVH, and were subsequently immunostained for POMC (green), mcherry (red), Cadm1 (magenta) and Vglut2 (cyan). (b) Visualization of Cadm1, mcherry, and Vglut2. Arrows indicate colocalization of mcherry punctas with Cadm1 and Vglut2.

Supplementary Figure 11 Original western blot panels with gel markers for Figures 2a, 2b, and 2f. Complete scanned gels for western blots shown in Figures 2a, 2b, and 2f. Western images are overlaid onto image containing MW markers. White dashed line identifies cropped region shown in respective figure. Replicate experiments are shown at the right and unlabeled lanes contain samples not included in this study. All results are presented as mean ± s.e.m.

Supplementary Figure 12 Original western blot panels with gel markers for Figures 2f and 4e. Complete scanned gels for western blots shown in Figures 2f, and 4e. Western images are overlaid onto image containing MW markers. White dashed line identifies cropped region shown in respective figure. All results are presented as mean ± s.e.m.

Supplementary Figure 13 Original western blot panels with gel markers for Supplementary Figures 2b, 2c, and 2e. Complete scanned gels for western blots shown in Supplementary Figures 2b, 2c, and 2e. Western images are overlaid onto image containing MW markers. White dashed line identifies cropped region shown in respective figure. All results are presented as mean ± s.e.m.

Supplementary Figure 14 Original western blot panels with gel markers for Supplementary Figures 2g, 3n, 6b, and 6d. Complete scanned gels for western blots shown in Supplementary Figures 2g, 3n, 6b, and 6d. Western images are overlaid onto image containing MW markers. White dashed line identifies cropped region shown in respective figure. All results are presented as mean ± s.e.m.

Supplementary Figure 15 Original western blot panels with gel markers for Supplementary Figures 7d, 8a, and 8e. Complete scanned gels for western blots shown in Supplementary Figures 7d, 8a, and 8e. Western images are overlaid onto image containing MW markers. White dashed line identifies cropped region shown in respective figure. All results are presented as mean ± s.e.m.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Supplementary Table 1. mice. Plasma measurements from wild-type and Cadm1KO Feeding state Wild-type (WT) Cadm1KO Glucose (mg/dl) Random fed 154.7 ± 11.58, n=12 155.5 ± 13.22, n=6 Fasted 50.3 ± 2.595, n=10 51.83 ± 3.177, n=6 Insulin (ng/ml) Random fed 0.8057 ± 0.3134, n=7 1.047 ± 0.2536, n=6 Fasted 0.317 ± 0.1048, n=9 0.2847 ± 0.04249, n=8 Leptin (ng/ml) Random fed 6.38 ± 0.8573, n=10 3.452 ± 0.3961, n=6* Adiponectin ( g/ml) Random fed 14.31 ± 1.235, n=8 24.23 ± 4.429, n=6* Analysis performed on Cadm1KO and littermate controls at 12-weeks of age. Results are presented as mean ± s.e.m. *P<0.05. 1

42 43 Supplementary Table 2. Body composition analysis of male Cadm mutant mouse lines and control littermates. Body composition of Cadm1KO mice and control littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Cadm1 +/? (n=11) 30.68 ± 0.42 16.34 ± 0.61 74.93 ± 0.72 5.025 ± 0.22 22.98 ± 0.32 Cadm1KO (n=9) 28.04 ± 0.94 * 13.81 ± 0.69 * 77.83 ± 0.58 * 3.884 ± 0.26 ** 21.42 ± 0.59 * Data is presented as means ± s.e.m. **P<0.01. Body composition of Cadm2KO mice and control littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Cadm2 +/? (n=7) 27.76 ± 0.24 15.82 ± 0.25 75.42 ± 0.34 4.39 ± 0.08 20.94 ± 0.21 Cadm2KO (n=6) 26.53 ± 0.62 * 16.53 ± 0.73 74.56 ± 0.85 4.354 ± 0.27 19.55 ± 0.39 * Data is presented as means ± s.e.m. *P<0.05. Body composition of Tg-Cadm1 mice and Slc17a6-Cre + littermates body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Slc17a6-Cre + (n=8) 27.99 ± 0.76 22.42 ± 1.04 69.38 ± 0.97 6.31 ± 0.45 19.38 ± 0.39 Tg-Cadm1 (n=10) 30.60 ± 0.48 ** 25.08 ± 0.61 * 66.88 ± 0.63 * 7.67 ± 0.20 ** 20.47 ± 0.40 Data is presented as means ± s.e.m. *P<0.05, ** P<0.01. Body composition of Cadm1 flox/flox mice and Slc17a6-Cre + littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Slc17a6-Cre + (n=9) 27.32 ± 0.72 17.46 ± 0.31 73.8 ± 0.34 4.767 ± 0.16 20.15 ± 0.62 Cadm1 flox/flox (n=8) 24.49 ± 0.53 * 16.62 ± 0.84 74.36 ± 0.74 4.07 ± 0.19 * 18.22 ± 0.46 * Data is presented as means ± s.e.m. *P<0.05, **P<0.01. Body composition of ob/mut mice and Lep ob/ob ; Slc17a6-Cre + littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Lep ob/ob ; Slc17a6- Cre + (n=6) 41.53 ± 1.42 55.58 ± 1.15 35.6 ± 1.02 21.28 ± 0.63 16.69 ± 0.66 ob/mut (n=5) 36 ± 1.24 * 51.41 ± 0.70 * 39.5 ± 0.93 * 18.52 ± 0.78 * 14.2 ± 0.43 * Data is presented as means ± s.e.m. *P<0.05, **P<0.01. Body composition of Slc32a1-Cre, Cadm1 flox/flox mice and Slc32a1-Cre + littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Slc32a1-Cre + (n=6) 27.02 ± 0.72 16.83 ± 0.84 74.13 ± 0.88 4.56 ± 0.31 20.01 ± 0.45 Slc32a1-Cre +, Cadm1 flox/flox (n=6) 26.85 ± 0.71 16.31 ± 0.17 74.61 ± 0.24 4.38 ± 0.10 20.03 ± 0.55 Data is presented as means ± s.e.m. Body composition of ob/lepr-cre, Cadm1 flox/flox mice and Lep ob/ob ; Lepr-Cre + littermates. body mass (g) body fat (%) lean mass (%) body fat (g) lean mass (g) Lep ob/ob ; Lepr-Cre + (n=5) 47.12 ± 1.05 53.04 ± 0.32 38.16 ± 0.39 25.00 ± 0.68 17.97 ± 0.28 ob/lepr-cre, Cadm1 flox/flox (n=4) 49.02 ± 1.34 54.19 ± 0.96 37.24 ± 0.75 26.60 ± 1.16 18.23 ± 0.23 Data is presented as means ± s.e.m. *P<0.05. 2

44 45 Supplementary Table 3. Summary of statistical analyses Figure Sample size (n) Statistical Test Values 1a AA: n=14 Linear regression t=1.963, P = 0.05 AG: n=44 GG: n=23 1b AA: n=56 Linear regression t=1.984, P = 0.05 AG: n=24 GG: n=1 2c Wild-type (n=4) Cadm1 +/- (n=3) Cadm1KO (n=3) One-way ANOVA 2d 2e 2g 2h 2i 2j 2k 2l 2m 2n 3a 3b 3c 3d Wild-type (n=10), Cadm1KO (n=10) Wild-type (n=12) Cadm1 KO (n=9) Wild-type (n=6) Tg-Cadm1 (n=6) Tg-Cadm1 (n=5) Wild-type (n=10) Tg- Cadm1 (n=7) Tg-Cadm1 (n=7) Wild-type (n=10) Tg- Cadm1 (n=7) Wild-type (n=6), Tg-Cadm1 (n=5) Wild-type (n=7), Tg-Cadm1 (n=5) Tg-Cadm1 (n=7) Wild-type (n=14), Cadm1 fl/fl (n=12) Wild-type (n=6), Cadm1 fl/fl (n=5) Wild-type (n=10), Cadm1 fl/fl (n=9) Wild-type (n=10), Cadm1 fl/fl (n=9) Cadm1: Genotype: F=243.9, P<0.0001 Cadm2: Genotype: F= 0.229, P=0.801 Multiple comparison: ***P<0.001 Interaction: F=0.2169, P = 0.9707 Time: F=185.3, P < 0.0001 Genotype: F=39.41, P < 0.0001 Multiple comparison: *P<0.05, **P<0.01, ***P<0.001 Linear regression F=6.232, P = 0.022 Cadm1: t=6.363, P = 0.0004 Cadm2: t=0.08518, P = 0.9338 Interaction: F=2.990, P = 0.0333 Time: F=77.91, P < 0.0001 Genotype: F=6.454, P = 0.0347 Multiple comparison: ***P<0.001 Linear regression F=5.559, P = 0.033 Interaction: F = 5.383, P = 0.0288 Time: F = 83.91, P < 0.0001 Genotype: F = 10.93, P = 0.0029 Multiple comparison: **P<0.01 Linear regression F=0.367, P = 0.554 Interaction: F=0.6532, P = 0.6295 Time: F=18.79, P < 0.0001 Genotype: F=20.40, P = 0.0027 Multiple comparison: *P<0.05 Interaction: F=2.990, P = 0.0333 Time: F=77.91, P < 0.0001 Genotype3b: F=6.454, P = 0.0347 Multiple comparison: *P<0.05, **P<0.01 t=0.5769, P= 0.5701 Interaction: F=0.3766, P = 0.8248 Time: F=511.9, P < 0.0001 Genotype: F=16.33, P = 0.0005 Multiple comparison: **P<0.01, ***P<0.001 Interaction: F=2.495, P = 0.0600 Time: F=189.4, P < 0.0001 Genotype: F=10.51, P = 0.0101 Multiple comparison: *P<0.05 VO 2: Interaction: F = 3.188, P = 0.0831 Time: F = 130.4, P < 0.0001 Genotype: F = 9.781, P = 0.0036 VCO 2: Interaction: F = 6.209, P = 0.0177 Time: F = 247.8, P < 0.0001 Genotype: F = 7.570, P = 0.0094 Multiple comparison: **P<0.01 RER: Interaction: F = 1.604, P = 0.2140 Time: F = 87.90, P < 0.0001 Genotype: F = 1.669, P = 0.2051 EE: Interaction: F = 4.130, P = 0.0500 3

3d 3e 3f 3g 3h 3i 3k 4a 4b 4c 4d 4f 4g 4h 4i Wild-type (n=10), Cadm1 fl/fl (n=9) Wild-type (n=10) Slc17a6 -Cre, Cadm1 fl/fl (n=9) Wild-type (n=10) Slc17a6 -Cre, Cadm1 fl/fl (n=9), Cadm1 fl/fl (n=5), Cadm1 fl/fl (n=5), Cadm1 fl/fl (n=5), Cadm1 fl/fl (n=5) Wild-type (n=6), Cadm1 fl/fl (n=10) Wild-type (n=10), Cadm1 fl/fl (n=7) Wild-type (n=10) Slc17a6 -Cre, Cadm1 fl/fl (n=9) Wild-type (n=10) Slc17a6 -Cre, Cadm1 fl/fl (n=9) Lep ob/ob (n=9), ob/mut (n=5) Lep ob/ob (n=8), ob/mut (n=4) Lep ob/ob (n=9), ob/mut (n=5) Lep ob/ob (n=4), ob/mut (n=4) Time: F = 155.7, P < 0.0001 Genotype: F = 8.980, P = 0.0051 Activity: Interaction: F = 6.224, P = 0.0176 Time: F = 64.24, P < 0.0001 Genotype: F = 4.052, P = 0.0521 Multiple comparison: **P<0.01 t=1.670, P= 0.1131 Linear Regression F=15.397, P = 0.001 Linear Regression F=5.133, P = 0.038 4 Interaction: F=2.480, P = 0.0783 Time: F=46.22, P < 0.0001 Genotype: F=7.328, P = 0.0204 Multiple comparison: **P<0.01 Interaction: F=0.1424, P = 0.9336 Time: F=7.334, P = 0.0010 Genotype: F=27.93, P = 0.0005 Multiple comparison: *P<0.05 BAT: t=2.435, P = 0.0314 isat: t=3.125, P = 0.0088 Eye: t=2.998, P = 0.0111 t=0.8458, P = 0.4157 Interaction: F=0.08885, P = 0.9657 Time: F=347.7, P < 0.0001 Genotype: F=15.37, P = 0.0018 Multiple comparison: *P<0.05, **P<0.01 Interaction: F=3.658, P = 0.0099 Time: F=60.61, P < 0.0001 Genotype: F=6.238, P = 0.0246 Multiple comparison: **P<0.01 Linear regression F=15.243, P = 0.001 Linear regression F=5.167, P = 0.037 Interaction: F=1.432, P = 0.2603 Time: F=77.53, P < 0.0001 Genotype: F=16.44, P = 0.0019 Multiple comparison: **P<0.01 Glucose: t=2.962, P = 0.0142 Insulin: t=4.872, P = 0.0006 Interaction: F=2.883, P = 0.0332 Time: F=12.68, P < 0.0001 Genotype: F=8.184, P = 0.0155 Multiple comparison: *P<0.05, **P<0.01 G6pc: t=2.512, P = 0.0458 Pck1: t=4.731, P = 0.0032 4j Lep ob/ob (n=4), t=3.373, P = 0.0198

46 ob/mut (n=3) 4k Lepob/ob (n=6), Linear Regression F=5.600, P = 0.045 ob/mut (n=5) 4l Lep ob/ob (n=7), t=0.7152, P = 0.4894 ob/mut (n=6) 5c +/? (n=6), Fl/fl (n=6) Interaction: F=8.020, P < 0.0001 Time: F=91.72, P < 0.0001 Genotype: F=5.403, P = 0.0424 Multiple comparison: **P<0.01 5d +/? (n=6), Linear Regression F=7.923, P = 0.018 Fl/fl (n=7) 5e +/? (n=6), Linear Regression F=0.802, P = 0.392 Fl/fl (n=7) 5f +/? (n=6), Fl/fl (n=7) t=0.5845, P = 0.5719 5m +/? (n=11), Fl/fl (n=9) Interaction: F=3.439, P = 0.0069 Time: F=83.35, P < 0.0001 Genotype: F=9.483, P = 0.0065 Multiple comparison: *P<0.05, **P<0.01 5n +/? (n=9), Linear Regression F=11.57, P = 0.011 Fl/fl (n=10) 5o +/? (n=9), Linear Regression F=4.433, P = 0. 178 Fl/fl (n=10) 5p +/? (n=9), Fl/fl (n=10) t=0.9483, P = 0.3562 Main Text Wild-type (n=9) Cadm1 KO (n=7) t=7, P < 0.0001 Suppl. Sample size (n) Statistical Test Values Fig. 1a AA: n=19 Linear regression t=2.476, P = 0.015 AG: n=50 GG: n=34 1b AA: n=74 Linear regression t=2.476, P = 0.004 AG: n=29 GG: n=0 2d Wild-type (n=3) Lep ob/ob (n=3) Lep ob/ob /Keto (n=3) One-way ANOVA Cortex: F=0.2879, P=0.7684 Striatum: F=3.963, P=0.0800 HPF: F=8.276, P=0.0188 HY: F=0.4978, P=0.6309 Midbrain: F=3.213, P=0.1126 Hindbrain: F=3.255, P=0.1244 Cerebellum: F=12.87, P=<0.0013 3a 3b 3c Wild-type (n=12) Cadm1KO (n=10) Wild-type (n=13) Cadm1KO (n=10) Wild-type (n=5) Cadm1KO (n=5) t=3.761, P= 0.0021 Multiple comparison: *P<0.05, **P<0.01 Interaction: F = 3.626, P = 0.0002 Time: F = 158.2, P < 0.0001 Genotype: F = 27.33, P < 0.0001 Multiple comparison: **P<0.01, ***P<0.001 Interaction: F = 2.126, P = 0.1005 Time: F = 32.14, P < 0.0001 Genotype: F = 6.426, P = 0.0350 Multiple comparison: *P<0.05 3d Wild-type (n=6) Cadm1KO (n=5) Interaction: F = 3.305, P = 0.0209 Time: F = 82.72, P < 0.0001 Genotype: F = 13.97, P = 0.0046 Multiple comparison: *P<0.05, ***P<0.001 3e Wild-type (n=6) Cadm1KO (n=5) Interaction: F = 0.6623, P = 0.6222 Time: F = 36.12, P < 0.0001 Genotype: F = 5.651, P = 0.0414 Multiple comparison: *P<0.05 3f Wild-type (n=6) Interaction: F = 3.154, P = 0.0064 5

3g 3h 3i 3j 3k 3l 3m 3p 3q 3r 3s 3t 3u 3v 3w Cadm1KO (n=5) Wild-type (n=6) Cadm1KO (n=5) Wild-type (n=10) Cadm1KO (n=10) Wild-type (n=11) Cadm1KO (n=9) Wild-type (n=5) Cadm1KO (n=5) Wild-type (n=11) Cadm1KO (n=9) Wild-type (n=11) Cadm1KO (n=9) Wild-type (n=11) Cadm1 KO (n=7) Cadm2KO (n=8) Wild-type (n=5) Cadm2KO (n=3) Wild-type (n=7) Cadm2KO (n=3) Wild-type (n=9) Cadm2KO (n=7) Cadm2KO (n=6) Cadm2KO (n=6) Cadm2KO (n=6) Cadm2KO (n=6) 6 Time: F = 18.25, P < 0.0001 Genotype: F = 0.8089, P = 0.3919 Multiple comparison: *P<0.05 Interaction: F = 2.171, P = 0.0488 Time: F = 31.02, P < 0.0001 Genotype: F = 3.454, P = 0.0961 Multiple comparison: *P<0.05 t=1.080, P= 0.2946 VO 2: Interaction: F = 0.3097, P = 0.5847 Time: F = 173.3, P < 0.0001 Genotype: F = 9.411, P = 0.0066 VCO 2: Interaction: F = 2.267, P = 0.1495 Time: F = 357.9, P < 0.0001 Genotype: F = 5.951, P = 0.0253 RER: Interaction: F = 0.1060, P = 0.7485 Time: F = 146.0, P < 0.0001 Genotype: F = 1.038, P = 0.3217 Multiple comparison: *P<0.05 t=0.8894, P= 0.3998 Linear Regression F=4.508, P = 0.051 Interaction: F = 0.0002546, P = 0.9874 Time: F = 220.0, P < 0.0001 Genotype: F = 14.31, P = 0.0014 Multiple comparison: *P<0.05 Interaction: F = 1.130, P = 0.3019 Time: F = 147.9, P < 0.0001 Genotype: F = 22.33, P = 0.0002 Multiple comparison: *P<0.05, ***P<0.001 Interaction: F = 3.325, P = 0.0055 Time: F = 227.7, P < 0.0001 Genotype: F = 7.764, P = 0.0146 Multiple comparison: *P<0.05 Interaction: F = 0.2547, P = 0.9039 Time: F = 24.84, P < 0.0001 Genotype: F = 6.296, P = 0.0460 Interaction: F = 1.203 Time: F = 124.4 Genotype: F = 18.48 Multiple comparison: *P<0.05 t=3.495, P= 0.0081 (AUC) t=0.5274, P= 0.6062 VO 2: Interaction: F = 1.830, P = 0.2011 Time: F = 406.6, P < 0.0001 Genotype: F = 10.83, P = 0.0064 VCO 2: Interaction: F = 0.8789, P = 0.3670 Time: F = 434.1, P < 0.0001 Genotype: F = 7.411, P = 0.0185 Multiple comparison: *P<0.05, **P<0.01 Interaction: F = 2.580, P = 0.1342 Time: F = 537.1, P < 0.0001 Genotype: F = 1.006, P = 0.3357 Interaction: F = 1.546, P = 0.2374 Time: F = 420.0, P < 0.0001 Genotype: F = 10.12, P = 0.0079 Multiple comparison: **P<0.01 Interaction: F = 5.887, P = 0.0319 Time: F = 149.7, P < 0.0001 Genotype: F = 2.953, P = 0.1114

3x 3y Cadm2 KO (n=7) Cadm2 KO (n=7) Multiple comparison: *P<0.05 Linear Regression F=14.893, P = 0.002 Linear Regression F=1.884, P = 0.195 4b n=4 t=11.46, P < 0.0001 4c Wild-type (n=4) Cadm1KO (n=3) Lep ob/ob (n=3) One-way ANOVA 4d 4e 4h 5g 5j 6e 6f 6g 6h Wild-type (n=12) Cadm1 KO (n=15) Wild-type (n=11) Cadm1 KO (n=7) Cadm1KO (n=6) Tg-Cadm1 (n=6) Wild-type (n=10) Tg-Cadm1 (n=9) Wild-type (n=6) Cadm1 fl/fl (n=6) Cadm1 fl/fl (n=4) Slc32a1-Cre, Cadm1 fl/fl (n=8) Wild-type (n=6) Slc32a1-Cre, Cadm1 fl/fl (n=4) POMC: F = 15.47, P = 0.0027 Npy: F = 6.103, P = 0.0292 AgrP: F = 12.24, P = 0.0052 Multiple comparison: *P<0.05, **P<0.01 Frequency: t=5.54, P<0.0001 Amplitude: t=1.167, P = 0.2542 Frequency: t=0.3743, P = 0.7131 Amplitude: t=1.179, P = 0.2555 Asymm: P=0.0003 Symm: P=0.0729 Total: P=0.0006 VO 2: Interaction: F = 14.34, P = 0.0026 Time: F = 543.0, P < 0.0001 Genotype: F = 2.360, P = 0.1504 VCO 2: Interaction: F = 14.79, P = 0.0023 Time: F = 761.7, P < 0.0001 Genotype: F = 2.325, P = 0.1532 RER: Interaction: F = 1.431, P = 0.2548 Time: F = 4.515, P = 0.0551 Genotype: F = 2.807, P = 0.1197 EE: Interaction: F = 11.62, P = 0.0058 Time: F = 298.4, P < 0.0001 Genotype: F =3.330, P = 0.0953 Multiple comparison: *P<0.05 t=3.805, P= 0.0014 Interaction: F = 21.24, P < 0.0001 Time: F = 976.2, P < 0.0001 Genotype: F =8.715, P = 0.0145 Multiple comparison: ***P<0.001 t=7.010, P < 0.0001 Interaction: F = 0.6507 Time: F = 216.5 Genotype: F =3.593 Interaction: F = 0.1847, P = 0.9447 Time: F = 23.69, P < 0.0001 Genotype: F =6.625, P = 0.0329 AUC: t=2.379, P=0.0446 6i 6j Slc32a1-Cre, Cadm1 fl/fl (n=5) Slc32a1 -Cre, Cadm1 7 Interaction: F = 1.273, P = 0.2950 Time: F = 110.0, P < 0.0001 Genotype: F =0.0004131, P = 0.9841 Linear Regression F=1.279, P = 0.280

6k 6l 6m 6n 6o 6p 7b 7c fl/fl (n=7) Slc32a1 -Cre, Cadm1 fl/fl (n=7) Slc32a1-Cre, Cadm1 fl/fl (n=8) Wild-type (n=4) Cadm1 fl/fl (n=6) Wild-type (n=4) Cadm1 fl/fl (n=6) Wild-type (n=4) Cadm1 fl/fl (n=6) Wild-type (n=4) Cadm1 fl/fl (n=6) Wild-type (n=4) Cadm1 fl/fl (n=4) Wild-type (n=3) Cadm1 fl/fl (n=3) Linear Regression F=0.608, P = 0.450 8 Activity: Interaction: F = 2.252, P = 0.1557 Time: F = 33.35, P < 0.0001 Genotype: F =0.03474, P = 0.8548 Food: Interaction: F = 0.5626, P = 0.4656 Time: F = 242.2, P < 0.0001 Genotype: F =1.143, P = 0.3031 Body Weight: t=1.686, P= 0.1302 Blood Glucose: t=0.1078, P= 0.9168 Insulin: t=1.417, P= 0.1993 Glucose: Interaction: F = 1.546, P = 0.1387 Time: F = 1.290, P = 0.2503 Genotype: F =0.5860, P = 0.4660 GIR: Interaction: F = 2.304, P = 0.0196 Time: F = 60.97, P < 0.0001 Genotype: F =6.661, P = 0.0326 Multiple comparison: *P<0.05 t=2.653, P= 0.0291 Basal output: t=1.675, P= 0.1325 Clamped output: t=2.557, P= 0.0338 Clamped suppression: t=5.739, P= 0.0004 Glc Uptake: t=0.7176, P=0.4934 Glycolysis rate: t=1.236, 0.2514 Glyc. Synth.: t=1.346, P=0.2152 Insulin: t=0.9284, P=0.3803 Synapse number per m 2 : n.s. Synapse profiles per m 2 : n.s. t=3.001, P= 0.0399 8b +/? (n=6), Fl/fl (n=7) VO 2: Interaction: F = 4.537, P = 0.0566 Time: F = 294.3, P < 0.0001 Genotype: F = 8.264, P = 0.0151 VCO 2: Interaction: F = 4.400, P = 0.0599 Time: F = 443.1, P < 0.0001 Genotype: F = 4.954, P = 0.0479 RER: Interaction: F = 0.003181, P = 0.9560 Time: F = 453.0, P < 0.0001 Genotype: F =0.1127, P = 0.7435 Activity: Interaction: F = 4.814, P = 0.0506 Time: F = 310.6, P < 0.0001 Genotype: F =7.113, P = 0.0219 EE: Interaction: F = 5.747, P = 0.0354 Time: F = 635.3, P < 0.0001

Genotype: F =4.674, P = 0.0535 Multiple comparison: *P<0.05, **P<0.01 VO 2: Interaction: F = 12.08, P = 0.0034 Time: F = 593.1, P < 0.0001 Genotype: F = 5.415, P = 0.0344 VCO 2: Interaction: F = 12.37, P = 0.0031 Time: F = 626.8, P < 0.0001 Genotype: F = 5.785, P = 0.0295 RER: Interaction: F = 0.02624, P = 0.8735 Time: F = 97.55, P < 0.0001 Genotype: F =1.203, P = 0.2900 Activity: Interaction: F = 17.10, P = 0.0009 Time: F = 280.2, P < 0.0001 Genotype: F =3.298, P = 0.0894 EE: Interaction: F = 12.98, P = 0.0026 Time: F = 604.9, P < 0.0001 Genotype: F =5.687, P = 0.0307 Multiple comparison: *P<0.05, **P<0.01 Interaction: F = 1.318, P = 0.2844 Time: F = 41.35, P < 0.0001 Genotype: F =0.1742, P = 0.6874 Interaction: F = 2.143, P = 0.1065 Time: F = 32.61, P < 0.0001 Genotype: F =1.151, P = 0.3246 Interaction: F = 1.059, P = 0.3893 Time: F = 46.59, P < 0.0001 Genotype: F =0.9397, P = 0.3552 Interaction: F = 0.3587, P = 0.8369 Time: F = 76.77, P < 0.0001 Genotype: F =0.1604, P = 0.6948 Interaction: F = 0.7734, P = 0.6764 Time: F = 168.9, P < 0.0001 Genotype: F =0.2692, P = 0.6164 Interaction: F = 0.2083, P = 0.9313 Time: F = 26.95, P < 0.0001 Genotype: F =0.3345, P = 0.5841 Linear Regression F=0.002, P = 0.964 8f +/? (n=8), Fl/fl (n=9) 8g +/? (n=6), Fl/fl (n=6) 9a 9b 9c 9d 9e 9f 9g 9h 9i 9j 9k 9l Wild-type (n=5) Agrp-Cre, Cadm1 fl/fl (n=3) Wild-type (n=6) Pomc-Cre, Cadm1 fl/fl (n=6) Wild-type (n=10) Sim1-Cre, Cadm1 fl/fl (n=6) Wild-type (n=7) Lepr-Cre, Cadm1 fl/fl (n=4) Wild-type (n=5) Lepr-Cre, Cadm1 fl/fl (n=3) Lepr -Cre, Cadm1 fl/fl (n=7) Wild-type (n=12) Lepr-Cre, Cadm1 fl/fl (n=12) Lep ob/ob (n=3) ob/lepr-cre, Cadm1 fl/fl (n=3) Lep ob/ob (n=7) ob/lepr-cre, Cadm1 fl/fl (n=5) Lep ob/ob (n=6) ob/lepr-cre, Cadm1 fl/fl (n=5) Lep ob/ob (n=6) ob/lepr-cre, Cadm1 fl/fl (n=5) Lep ob/ob (n=4) ob/lepr-cre, Cadm1 fl/fl (n=3) 9 Activity: t=1.225, P= 0.2335 Food: t=0.2306, P= 0.8198 Interaction: F = 0.3312, P = 0.9795 Time: F = 312.3, P < 0.0001 Genotype: F = 0.1959, P = 0.6809 Random fed: t=2.816, P= 0.0183 Fasted: t=2.294, P= 0.0447 Insulin: t=3.353, P= 0.0100 Interaction: F = 5.885, P = 0.0009 Time: F = 29.97, P < 0.0001 Genotype: F =10.40, P = 0.0104 Multiple comparison: ***P<0.001 Interaction: F = 1.571, P = 0.2030 Time: F = 35.12, P < 0.0001 Genotype: F =10.43, P = 0.0103 Multiple comparison: **P<0.01 Interaction: F = 0.7778, P = 0.5526 Time: F = 19.65, P < 0.0001 Genotype: F =17.04, P = 0.0091 Multiple comparison: *P<0.05, **P<0.01

9m 9n 9o Supp Tab. 1 Supp Tab. 1 Supp Tab. 1 Supp Tab. 1 Supp Tab. 2 Supp Tab. 2 Supp Tab. 2 Wild-type (n=6) Lepr-Cre, Cadm1 fl/fl (n=5) Lep ob/ob (n=5) ob/lepr-cre, Cadm1 fl/fl (n=7) Lepr-Cre, Cadm1 fl/fl (n=5) Lep ob/ob (n=6) ob/lepr-cre, Cadm1 fl/fl (n=4) Lep ob/ob (n=6) ob/lepr -Cre, Cadm1 fl/fl (n=7) Lep ob/ob (n=8) ob/lepr-cre, Cadm1 fl/fl (n=6) Wild-type (n=10-12) Cadm1 KO (n=6) Wild-type (n=7-9) Cadm1 KO (n=6-8) Wild-type (n=10) Cadm1 KO (n=6) Cadm1 KO (n=6) Wild-type (n=11) Cadm1 KO (n=9) Wild-type (n=7) Cadm2 KO (n=6) Tg- Cadm1 (n=10) One-way ANOVA 10 Beta cell mass: F= 39.63, P < 0.0001 Multiple comparison: ***P<0.001 Insulin Content: F= 103.5, P= < 0.0001 Multiple comparison: ***P<0.001 Linear Regression F=1.215, P = 0.296 Activity: t=1.126, P = 0.2822 Food: t=0.01348, P = 0.9895 Glucose random fed: t=0.04402, P = 0.9654 fasted: t=0.3685, P = 0.7180 Insulin random fed: t=0.5844, P = 0.5708 fasted: t=0.2725, P = 0.7889 Leptin t=2.521, P = 0.0245 Adiponectin t=2.451, P = 0.0305 body mass: t=2.74, P = 0.0135 body fat (%): t=2.752, P = 0.0131 lean mass (%): t=2.175, P = 0.0432 body fat (g): t=3.317, P = 0.0038 lean mass (g): t=2.45, P = 0.0247 body mass: t=2.27, P = 0.0443 body fat (%): t=0.9068, P = 0.3840 lean mass (%): t=0.9418, P = 0.3665 body fat (g): t=0.1477, P = 0.8852 lean mass (g): t=3.067, P = 0.0107 body mass: t=3.023, P = 0.0081 body fat (%): t=2.299, P = 0.0353 lean mass (%): t=2.263, P = 0.0379 body fat (g): t=2.975, P = 0.0089 lean mass (g): t=1.918, P = 0.0731 Supp Tab. Wild-type (n=9), body mass:

47 2 Cadm1 fl/fl (n=8) Supp Tab. 2 Supp Tab. 2 Supp Tab. 2 Lepob/ob (n=6), ob/mut (n=5) Wild-type (n=6) Slc32a1 -Cre, Cadm1 fl/fl (n=6) Lep ob/ob (n=5) ob/lepr -Cre, Cadm1 fl/fl (n=4) t=2.81, P = 0.0132 body fat (%): t=1.131, P = 0.2759 lean mass (%): t=0.7095, P = 0.4889 body fat (g): t=2.741, P = 0.0151 lean mass (g): t=2.44, P = 0.0276 body mass: t=2.857, P = 0.0189 body fat (%): t=2.935, P = 0.0166 lean mass (%): t=2.789, P = 0.0211 body fat (g): t=2.79, P = 0.0210 lean mass (g): t=3.011, P = 0.0147 body mass: t=0.167, P = 0.8707 body fat (%): t=0.6027, P = 0.5601 lean mass (%): t=0.5265, P = 0.6100 body fat (g): t=0.568, P = 0.5826 lean mass (g): t=0.03396, P = 0.9736 body mass: t=1.131, P = 0.2953 body fat (%): t=1.257, P = 0.2489 lean mass (%): t=1.161, P = 0.2836 body fat (g): t=1.247, P = 0.2525 lean mass (g): t=0.6805, P = 0.5181 11

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback