Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry Figure 1 MYCN sugroup show recurrent structurl vrints involving high level mplifiction nd rerrngement of MYCN, ID2 nd KIDINS220 on chromosome 2p. SNP6.0 copy numer profiles of chromosome 2p focl, high-level mplifictions in () DIPG38, () DIPG49, (c) DIPG01 nd (d) DIPG29. These mplifictions lwys involve the genes MYCN, ID2 nd KIDINS220. CIRCOS plots of structurl vrints in (e) DIPG01 nd (f) DIPG29 s determine from WGS dt. Nture Genetics: doi:10.1038/ng.2936
Supplementry Figure 2 Event grph nd CIRCOS plot of chromothripsis in DIPG29. () The i-directed event grph for chromothripsis event in DIPG29. Red edges represent the genomic intervl of their respective nodes. Blue edges represent groups of discordnt red pirs supporting the sme rekpoint. Arc width is proportionl to the mximl likely copy count. () A CIRCOS plot of chromosome 1 nd 2 from MYCN group ptient, DIPG29. Only those clusters lrger thn 1000p re shown etween chr1 nd chr2. The width of ech rc is proportionl to the log of its estimted copy count. The highest estimted copy count is 61. Nture Genetics: doi:10.1038/ng.2936
MDM4 DDX-KIDINS220 DDX-MYCN LRRN2 300p 200p 100p 29N 29T 29N 29T KIDINS220 c Brekpoint Brekpoint DDX1 DDX1 KIDINS220 DDX1 MYCN MYCN MYCNOS Supplementry Figure 3 Structurl vrint vlidtion in DIPG29. () Structurl vrint spnning six rekpoints s predicted y discordnt red-pir mppings in DIPG29. () PCR vlidtion of DDX1-KIDINS220 (Left primer: TCTATGCCAGTGCTTTACTCCTT; Right Primer: CTGTTCCACCAAAGCCAAAT) nd DDX1-MYCN (Left Primer: TGAGCAGATTTTCTGTATATTTTCCA; Right Primer: GTCTCCCAGGCTGCAGTG) in tumour nd mtched norml show product nd only in tumor DNA. (c) Snger sequencing through rekpoints in DDX1-KIDINS220 nd DDX1-MYCN structurl vrints. Nture Genetics: doi:10.1038/ng.2936
Age of Dignosis Telomere Length Rtio (T : N) 3.5 p < 0.0001 3.0 2.5 2.0 1.5 1.0 0.5 0.0 ALT negtive ALT positive 14.0 p < 0.0001 12.0 10.0 8.0 6.0 4.0 2.0 0.0 ALT negtive ALT positive Supplementry Figure 4 DIPG ptients with ALT phenotype hve longer telomeres nd re dignosed t n older ge. All ALT positive DIPG ptients were found in the H3-K27M sugroup. By WGS, these ptients hd significntly longer telomeres; () 2.28 times longer thn their mtched norml vs. non-alt DIPG ptients which hd telomeres tht were 1.47 times shorter thn their mtched norml (p < 0.0001). () There ws significnt difference in ge of dignosis etween ALT negtive (5.89 ± 2.82 yers) vs. ALT positive (10.08 ± 3.61 yers); p <0.0001). Error rs represent the stndrd error of the men. Nture Genetics: doi:10.1038/ng.2936
Copy Numer Copy Numer DIPG57 DIPG06 KIAA1239 RHOH PDGFRA KIT PVT- 1 MYC GPR125 PDGFRA NMU RBPJ CCKAR TBCD19 Chr. 4 Chr. 8 PVT-1 RHOH KIAA1239 MYC Supplementry Figure 5 H3-H27M DIPG exhiit structurl vrints in PDGFRA nd PVT-1/MYC loci. H3-K27M DIPG ptient often show gins nd mplifictions s well s structurl vrints in () PDGFRA nd () PVT-1/MYC. Nture Genetics: doi:10.1038/ng.2936
K27M-H3.3 WT-H3.3 Empty vector DNA methyltion (n=102 proes) Gene expression (n = 102 genes) Empty vector WT-H3.3 K27M-H3.3 Empty vector WT-H3.3 K27M-H3.3 Numer of cells (x1000) Empty vector WT-H3.3 K27M-H3.3 NHA Empty vector WT-H3.3 K27M-H3.3 Empty vector WT-H3.3 K27M-H3.3 DAPI FLAG ß - tuulin FLAG -H3.3 c d H3K27me3 H3K27c Totl H3 ß - ctin e f DMEM NSC medi 0 0.5 1 0 1 2 Bet vlues Fold chnge g h Nture Genetics: doi:10.1038/ng.2936
Supplementry Figure 6 K27M-H3.3 exhiits glol decrese in H3K27me3 when compred to WT-H3.3 in vitro nd in vivo. () Western lot of FLAG-tgged WT-H3.3 nd K27M-H3.3 revels oth clones expressing similr levels of protein. No expression ws detected in untrnsfected NHA nd NHA trnsfected with empty vector control. () Immunofluorescence stining of NHA shows nucler locliztion of FLAG-tgged WT-H3.3 nd K27M-H3.3 protein. (c) K27M-H3.3 expressing NHA cells hve decresed growth rte s compred to oth WT-H3.3 nd empty vector control (p < 0.0001). (d) By Western lot, H3K27me3 is decresed in K27M-H3.3 NHA s compred to WT-H3.3 nd empty vector NHA cells y 52% (p = 0.01). (e) Immortlized NHAs trnsfected with K27M-H3.3 show phenotypic chnges compred to empty vector nd WT-H3.3 control, forming cell clusters t high density when seeded in DMEM nd growing semi-dherently in neurl stem cell medi. (f) K27M-H3.3 NHAs hve different methyltion nd expression profiles s compred to controls. The ssocition of decresed H3K27me3 nd mutnt histone H3 is lso seen y immunohistochemicl stining of DIPG tissue micro-rry, where ptients with K27M-H3.3 (g) show decresed H3K27me3. DIPG ptients tht re WT-H3.3 (h) show more positive stining y IHC for H3K27me3. Nture Genetics: doi:10.1038/ng.2936
Empty vector K27M-H3.3 dherent K27M-H3.3 semi-dherent DAPI GFAP DAPI GFAP DAPI GFAP DAPI Nestin DAPI Nestin DAPI Nestin DAPI SOX2 DAPI SOX2 DAPI SOX2 DAPI TUJ1 DAPI TUJ1 DAPI TUJ1 DAPI O4 DAPI O4 DAPI O4 Supplementry Figure 7 K27M-H3.3 semi-dherent cells exhiit higher SOX2 expression. Immunofluorescence stining of empty vector, K27M-H3.3 dherent nd K27M-H3.3 semi-dherent inha revels incresed SOX2 expression in the semidherent cells ut no chnges in GFAP, Nestin, TUJ1 or O4. Imges were tken t 400X mgnifiction. Nture Genetics: doi:10.1038/ng.2936
(1) Chr. A (2) Chr. B c (2) Chr. A (1) Chr. Z Chr. B Supplementry Figure 8 Discordnt red-pir clustering. () Schemtic of discordnt red pirs supporting trnsloction event (1) nd clipped mppings nrrowing in rekpoint loction (2). () Red-pirs s viewed y trnslocted region ligned to tumor genome. (c) The spnning reds in the norml smple provide n expected rrivl count for the Poisson distriution when used to determine mximum likelihood copy counts. Nture Genetics: doi:10.1038/ng.2936
Nture Genetics: doi:10.1038/ng.2936
Nture Genetics: doi:10.1038/ng.2936
Nture Genetics: doi:10.1038/ng.2936