Immunopharmacology: Immunosuppression in Organ Transplanation Prof D. A. Joyce Pharm 3320/3321 Organ Transplants, Australia Organ Donors (2013) Kidney 630 Liver 248 Heart 77 Lung 167 Pancreas 33 Bone Marrow 1,812 (2012) Kidney http://www.abmtrr.org/index.php/resources/data management/ http://www.anzdata.org.au/anzod/updates/anzod1989tocurrent.pdf http://www.aihw.gov.au/workarea/downloadasset.aspx?id=10737422288
Inflammation and Immunity Inflammation is what you see, clinically, in the pathological specimen or under the microscope. There are diagnostic signs at each level. EG, clinically: heat, redness, pain, swelling, disordered function Immune response describes the events that take place during inflammation. Immunity results from an immune response. Tuberculosis
A very rough summary of how an immune response to infection causes inflammation Destroys & removes foreign & damaged tissue, initiates repair Infectious agent Redness, Heat Swelling Leukocytes Chemical mediators Pain Dilate blood vessels Fluid & protein extravasation Recruit more leukocytes Haemopoetic Differentiation in Bone Marrow Lymphoid Myelomonocytic Megakaryocytic Erythroid Lymphoid lineage has left bone marrow by early postnatal life. Other lineages proliferate and differentiate in bone marrow through life
Bone Marrow Thymus Lymphocytes: Origins and Circulation Adenoids & Tonsils Lymph Nodes Thymus Lymph Nodes Spleen Gut-associated lymphatic tissue Lymph Nodes Bone Marrow Circulation Tissue Lymphatic Vessels Lymphatic vessels Lymphoid tissue Lymphatic vessels Lymphoid tissue includes nodes, thymus, spleen, adenoids, tonsils & gut-associated lymphoid tissue Lymph Node Architecture Some macropha Artery & vein Lymphocytes Various collections of Lymphocytes Channels for lymph and lymphocytes in (from tissue) and out (to other nodes & blood)
Lymph nodes and related organs Lymphocytes lineages: B B lymphocytes make antibodies T lymphocytes make cell-mediated immunity T The lymphocyte is the central player in acquired immunity B Lymphocyte T Lymphocyte T Antibody B T Helper T Cell T Cytotoxic T Cell Virus-infected, foreign or cancer cell Specifically Binds Foreign Protein or of Cell (eg bacteria) Eliminated Macrophage Activation, etc Cell Death Antibody Mediated Immunity Cell Mediated Immunity
Somalia, 1979 1796 1157 b.c. Acquired Immunity Specific: to a foreign protein (antigen) Learned: takes days weeks to learn. Remembered: can be recalled years later An antigen-specific lymphocyte learns and remembers Is it only infection that causes immunity and inflammation? Infections, acute and chronic: viral - bacterial, protozoal - parasitic Foreign material Appropriate Excessive (allergies, eg, allergic asthma) Transplanted organ ( Allogeneic transplant) Tissue injury: trauma - burns, surgery - radiation (eg, sunburn) Autoimmunity: abnormal inflammatory reaction to normal tissue
Why Suppress Acquired Immunity? 1. Prevention of rejection in organ transplantation - suppression of an appropriate immune reaction to a foreign tissue (eg heart, kidney, lung) 2. Treatment of autoimmune diseases - Suppression of an inappropriate immune reaction to a self tissue (eg lupus nephritis) Treatment of severe allergy - Suppression of an inappropriate immune reaction to a foreign antigen (eg glucocorticoids for allergic asthma) Suppressing the Immune Response to a Transplanted Organ: Control of T-lymphocyte Clonal Expansion
T-Lymphocyte infiltration in chronic allograft rejection Kidney Liver Artery in heart Lung Chronic Allograft Rejection: Role of T Lymphocytes Allograft antigen carried by antigen presenting cells via lymphatics to lymphoid tissue Allograft specific T lymphocytes return to attack allograft
Allograft Recognition and T Lymphocyte Clonal Expansion in Lymphoid Tissue Allograft derived Antigen Antigen Processing Cell Specific T lymphocyte clonal expansion T T T T T T T Allograft cell destruction Rejection Processed antigen is presented, bound by a specific protein complex (HLA complex) on the APC surface Antigen-presenting cell (APC) T-Cell Receptor recognises processed antigen Specific for the antigen, i.e. highly variable Variability generated by gene rearrangement during clonal selection in the thymus T-lymphocyte
4 Steps to T-Lymphocyte Clonal Expansion 4 Proliferation Receptor Binding & Signaling 1 APC 2 3 Cell - cell signaling (surface & secreted proteins) Autocrine signaling () Signaling for T-Cell Clonal Expansion: Role of TCR R Mitogenesis
Drugs that Prevent IL 2 Driven T Cell Clonal Expansion IL 2 Anti CD3 IL 2R mtor inhibitors Sirolimus Everolimus Calcineurin Inhibitors Cyclosporin Tacrolimus Glucocorticoids Mycophenolate Azathioprine Mitogenesis IL 2 Prevent TCR signaling for gene transcription IL 2 Anti CD3 IL 2R Calcineurin Inhibitors Cyclosporin Tacrolimus Glucocorticoids Mitogenesis IL 2
TCR Receptor-associated tyrosine kinases (ZAP-70, lck & fyn) phosphatidyl inositol Ca 2+ IP 3 P P Calcineurin Proximal Promoter Transcription Factor Binding P P Rel-A I- B c-fos c-jun Calcineurin AP-1
Cyclosporin Fungal peptide N CH 3 O H Tacrolimus (FK506) Fungal-derived macrolide Action of Cyclosporin or Tacrolimus Cyclo P P Tac Cyclo Cyclophilin Calcineurin Tac FKBP AP-1
Cyclophilin & FKBP (Immunophilin) Intracellular peptidyl-prolyl topoisomerases Normal role is in post-translational folding of proteins Targets of cyclosporin (cyclophilin) and tacrolimus (FKBP = FK506-binding protein) Ligand-bound, cyclophilin & FKBP acquire affinity for calcineurin inhibit enzyme Action of Cyclosporin or Tacrolimus Cyclo/Tacro P P Cyclo/Tacro Cyclophilin or FKBP Cyclo/Tacro Calcineurin AP-1
Action of Cyclosporin or Tacrolimus Cyclo/Tacro P P Cyclo/Tacro Cyclophilin or FKBP Cyclo/Tacro Calcineurin AP-1 Glucocorticoids Suppress gene transcription Reduce mrna stability
Glucocorticoids =O in cortisone * * F * Hydrocortisone (cortisol) Prednisolone Potent synthetic glucocorticoid Dexamethasone Very potent glucocorticoid (Methylated & fluorinated) Also many other potent synthetic glucocorticoids Steroid bound to circulating corticosteroid binding globulin Steroid binds cytosolic glucocorticoid receptor, which translocates to nucleus Steroid-receptor complex binds recognition sequences on promoter of responsive genes, stimulating transcription.
The Glucocorticoid Receptor (GR) Regulatory domain: binds chaperones & other proteins Ligand-binding domain Zn fingers in DNAbinding domain Transactivation domain: binds proteins that activate transcription Rang et al, Pharmacology, Elsevier Glucocorticoid Receptor Activation Ligand binding releases chaperones & reveals nuclear localisation signal & dimerisation site Nuclear localisation signal allows recognition by nuclear pore complex and access to nucleus 3 GR NLS 2 GR NLS 1 Cytoplasmic glucocorticoid receptor & chaperone proteins Receptor interacts with glucocorticoid 4 response element (GRE) through Zinc Transcriptional Fingers GR NLS GR NLS activation 5 XXXXXXXXXXXXXGGTACAnnnTGTTCTXXXXXXXXXXXXX GRE
Glucocorticoids & AP-1 AP-1 P c-jun c-fos GR NLS GR NLS P AP-1 Glucocorticoids & AP-1 AP-1 P c-jun c-fos GR NLS GR NLS AP-1
Rel/ Family Transcription Factors Leucine-zipped dimers Rel-A 1 I- B Cytoplasm-resident, until activation Complexed to I B protein Cytoplasm Nucleus family includes 1 (p50) Rel-A (p65) 2 (p52) c-rel (p75) Rel-B (p68) I B family includes I B,,,, Signalling 2 Phosphorylation of Serine 32 & 36 of I- B Cell 1 Surface Receptor Activation Rel-A I- B I- B Degradation 3 4 Nuclear Localisation Signal on revealed Cytoplasm 5 Gene Promoter Binds -response element Rel-A Nucleus ACCTTCCTCCAGATGATCAT GGGT T T CT CCACCAAGGAAGTTTTCCTGG Binding Sequence
Glucocorticoids & NF B Rel-A I- B GR NLS Rel-A AP-1 Rel-A I- B Rel-A Glucocorticoids Induce I B Gene Transcription I- B GR NLS GR NLS GGTACAnnnTGTTCT I- B
Glucocorticoids & Gene Transcription: Summary GR NLS GR NLS c-fos c-jun Rel-A I- B AP-1 mrna Degradation glucocorticoids Accelerated Degradation Coding 3 UTR AU-rich region AAAAAAAAA Poly-A mrna Synthesis Promoter Coding Region 3 UTR
Sirolimus (Rapamycin) and Everolimus: targeting growth factor (incl ) response Fungal-derived macrolides Structurally related to cyclosporine & tacrolimus Bind immunophilin FKBP and the complex targets a serine threonine kinase Mammalian Target of Rapamycin (mtor) Do not inhibit calcineurin Inhibit mitogenic response to and other growth factors For detailed pathways, see: http://www.biocarta.com/pathfiles/m_mtorpathway.asp Sirolimus (Rapamycin) and Everolimus: targeting growth factor (incl ) response Sirolimus Everolimus
Prevent mitogenic response to & other growth factors Sirolimus & Everolimus TCR & other growth factors R & other growth factor receptors PI 3 Kinase/AKT pathway Sir/Ever Serine/threonine kinase mtor Sir/Ever FKBP Translation of mrna for cell-cycle progression proteins (eg. cyclin D 1 ) Degradation of p27 cell-cycle inhibitor Mitogenesis CDK 2 /cyclin E complex inhibited by p27-cdkinhibitor during G 0 & G 1 Sir/Ever Cyclin E CDK 2 p27 mtor Sir/Ever FKBP G 0 P27 degradation in late G 1 M G 1 Cyclin E CDK 2 G 2 S G 1 S Transition CDK: cyclin-dependent kinase
mtor regulation of translation mrna s for many labile cell-cycle regulating proteins have characteristic sequences or structures mtor has two targets that are particularly important in regulating translation of these mrna s They are: EIF-4E-binding protein-1, which releases eukaryotic initiation factor-4e when it is phosphorylated. EIF-4E contributes to initiation of translation 40-S ribosome subunit Sirolimus FKBP and everolimus FKBP complexes inhibits these mtor actions also For detailed pathways, see: http://www.biocarta.com/pathfiles/m_mtorpathway.asp Sir/Ever mtor regulation of translation mtor Sir/Ever FKBP mtor mtor p70 s6 Kinase 40 40-S ribosome subunit EIF-4E Cell-cycle proteins mrna
Mycophenolate Fungal derived Inhibitor of de-novo guanosine monophosphate synthesis B and T cells depend on de-novo synthesis: -lack salvage pathway for guanine recovery Specific inhibition of DNA synthesis, RNA synthesis & other GTP or cgmp requiring pathways in lymphocytes Ribose-5P + ATP 5-phosphoribosyl-1-pyrophosphate (PRPP) Guanine Guanosine MP Inosine MP Adenosine MP Salvage Pathway (deficient in T & B cells) IMP dehydrogenase Mycophenolate
Prevent activation of T-cell via TCR Anti-CD3 Antibody APC CD3 - protein of the TCR - contributes to signaling T Anti-CD3 Antibody CD3 T
Summary: Preventing -Driven T-Cell Clonal Expansion Anti-CD3 Cyclosporin Tacrolimus Glucocorticoids Sirolimus Mycophenolate Mitogenesis Glucocorticoids Clinical Pharmacology: Clinical Use of Immunosuppressive Drugs in Preventing Transplant Rejection The Clinical Problem Inadequate immunosupression allows transplant rejection Excessive immunosupression brings infection risk Calcineurin and mtor have widespread physiological functions, so inhibition brings toxicity in various tissues Drug effects relate to tissue exposure The drugs have variable pharmacokinetics, obscuring the relationship between doses and tissue exposure
Clinical Pharmacology: Main reasons of variable pharmacokinetics Cyclosporin, tacrolimus, sirolimus and everolimus are all eliminated largely by cytochrome P450 3A4 (CYP 3A4), which is subject to inhibition and induction by other drugs Cyclosporin, tacrolimus, sirolimus and everolimus are all also substrates for the ABC-family transporter, p-glycoprotein* in the gut, so are subject to absorption interactions. Especially relevant for cyclosporin. Mycophenolate is glururonidated in the liver. Glucuronides are excreted into the bile, reabsorbed and renally excreted. They may be retained in renal failure. De-conjugation by gut bacteria, which is normally inconsequential, may then allow accumulation of the parent mycophenolate. * aka multi-drug resistance transporter-1; PGP/MDR-1 Improving the Risk-Benefit Ratio: Multiple Drug Targets Typically, two or more drug are used together, at doses less than would be needed individually to prevent rejection Additive efficacy Different toxicity EG: sirolimus or mycophenolate + low dose calcineurin inhibitor + low dose prednisolone during maintenance
Optimising Tissue Exposure: Therapeutic Drug Monitoring Tacrolimus, sirolimus, everolimus have long t ½. Pre-dose blood concentration (ie, trough, also called C 0 ) provide good guide to tissue exposure Cyclosporin AUC predicts response & toxicity, but very variable absorption, so C 0 is a poor predictor of AUC. C 2 is a better predictor 2000 C 2 C 0 Cyclosporin µg/l 1500 1000 500 0 AUC 0 4 0 4 8 12 16 20 24 Time hours Mycophenolate TDM MPA MPA glucuronides Biliary excretion Gut hydrolysis MPA MPA reabsorbed More variable relationship between C 0 (C 12 ) and AUC Figurski et al. Ther Drug Monit 2009;31:717 726