A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

Similar documents
Supplementary Figure 1

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Susanne Schnittger. Workflow of molecular investigations in JAK2-negative MPNs - the Munich experience

Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

To test the possible source of the HBV infection outside the study family, we searched the Genbank

Fabry Disease X-linked genetic, multi-organ disorder. Fabry disease screening program in Hypertrophic p Cardiomyopathy: preliminary results.

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with

Pharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis

SUPPLEMENTAL MATERIAL

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP

SUPPLEMENTARY INFORMATION

Deep-Sequencing of HIV-1

CPTR title slide. A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance

Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%

Transgenic Mice and Genetargeting

Changing demographics of smoking and its effects during therapy

HCV NS3 Protease Drug Resistance

Kalydeco. Kalydeco (ivacaftor) Description

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi

HCV NS3 Protease Drug Resistance

w ª wy xvwz A ª vw xvw P ª w} xvw w Æ w Æ V w,x Æ w Æ w Æ y,z Æ { Æ y,z, w w w~ w wy}æ zy Æ wyw{ xæ wz w xywæ xx Æ wv Æ } w x w x w Æ w Æ wy} zy Æ wz

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each

CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population

Importance of minor TP53 mutated clones in the clinic

J. A. Mayfield et al. FIGURE S1. Methionine Salvage. Methylthioadenosine. Methionine. AdoMet. Folate Biosynthesis. Methylation SAH.

CHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)

Clinical Spectrum and Genetic Mechanism of GLUT1-DS. Yasushi ITO (Tokyo Women s Medical University, Japan)

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM

ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt

Intron 1 IVS1+5G>T --- Greenberg et al, Exon II del2 Tsai et al, 2017 K42R 125A>G Spector et al, unpublished

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Personalized Healthcare Update

Clinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018

Development of a Multiplex CYP21A2 Genotyping Assay for Congenital Adrenal Hyperplasia Screening

Symdeko. Symdeko (tezacaftor and ivacaftor) Description

The absence of the ERBB4 hotspot mutations in melanomas in patients from southern China

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Genetic Analysis of Allosteric Signaling in RhaR from Escherichia coli and Characterization of the VirF Protein from Shigella flexneri

Support. Overview. Auditory Dys-synchrony. Auditory Brainstem Response. Potential Causes

Exon I M1V 1A>G Kolker et al, delG Spector & Sharer, unpublished /90 delc Mushimoto et al, 2011

Supplementary Information Titles Journal: Nature Medicine

Clinical and Molecular Genetic Spectrum of Slovenian Patients with CGD

LE IPERCHILOMICRONEMIE FAMILIARI

History (August 2010) Therapy for Experienced Patients. History (September 2010) History (November 2010) 12/2/11

MSI positive MSI negative

LAL: significato clinico e biologico delle mutazioni di Bcr-Abl

Received 21 November 2005/Returned for modification 20 January 2006/Accepted 27 March 2006

Supporting Information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

ERCC2mutations as predictors of response to cisplatinin bladder cancer

Supplementary Materials for

Supplementary Online Content

Molecular biology :- Cancer genetics lecture 11

Relative activity (%) SC35M

A Quick Guide to the. I507del. Mutation CFTR SCIENCE

ULTRA-DEEP SEQUENCING OF THE BCR-ABL KINASE DOMAIN FOR BETTER THERAPEUTIC TAILORING OF PHILADELPHIA CHROMOSOME-POSITIVE LEUKEMIA PATIENTS

Von Willebrand Disease. Alison Street Malaysia April 2010

Mutations and Disease Mutations in the Myosin Gene

The molecular genetics of endometrial cancer

The Complexity of Simple Genetics

Quantification of early stage lesions for loss of p53 should be shown in the main figures.

Molecular Testing in Lung Cancer

SUPPLEMENTARY INFORMATION

Hands-On Ten The BRCA1 Gene and Protein

IVACAFTOR THE ISRAELI EXPERIENCE ADI DAGAN MD THE ISRAELI CF CENTER SHEBA MEDICAL CENTER, TEL-HASHOMER

LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

HIV Drug Resistance among Adolescents and Young Adults Failing HIV Therapy in Zimbabwe

Pharmacy Policy Bulletin

Monitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

Cooperation of germ line JAK2 mutations E846D and R1063H leads to erythroid hyperplasia with megakaryocytic atypia

C) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.

A Genetic Approach to the Treatment of Cystic Fibrosis

Clinical utility of NGS for the detection of HIV and HCV resistance

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Alabama University at Birmingham Birmingham, AL Approved for Public Release; Distribution Unlimited

Supplementary Figure 1

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

p53 and Apoptosis: Master Guardian and Executioner Part 2

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

NNRTI Resistance NORTHWEST AIDS EDUCATION AND TRAINING CENTER

Resistencias & Epidemiología. Eva Poveda Division of Clinical Virology INIBIC-Complexo Hospitalario Universitario de A Coruña

PA Update: Oral Cystic Fibrosis Modulators

Medium-Chain Acyl-CoA Dehydrogenase (MCAD) splicing mutations identified in newborns with an abnormal MS/MS profile

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Supplementary Material Correlation matrices on FP and FN profiles

Apoptosis Oncogenes. Srbová Martina

Introduction to Genetics

Transcription:

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech Republic 25.6.2013, Konference DNA analýza X, Novotel Praha

TP53 The Guardian of the Genome (David Lane, 1992) mapped to 17p G1/S arrest vs apoptosis physiologically low level of TP53 activity of TP53 tightly regulated (MDM-2, ATM, ATR, p19arf )

Functional analysis of TP53 Genotype does not necessarily need to translate into phenotype FASAY Functional Analysis of Separated Alleles in Yeast in vitro test of the functional activity of TP53 DNA-binding domain color of transgenic yeast colonies indicates mutated or wild type TP53 allele

The principle of FASAY in vitro recombination of TP53 into GM yeasts p53 promotor Selection medium with low adenine Red colonies mut White colonies wt p53 respons promotor ADE2 pss16 p53 Red colonies are re-sequenced to identify clonal TP53 mutation

A. Detection of biologically relevant TP53 variants C277Y 60.1 % red colonies

B. Identification of small subclones with TP53 mutation E220R 27.5 % red colonies

C. Splicing TP53 variants delta ex6 TP53 splicing variant in CLL 45.3 % red colonies on FASAY Pekova et al., Leukemia Research, 2010

Bourdon et al., Genes Dev., 2005

Protein expression of the D ex6 TP53 variant Pekova et al., Leukemia Research, 2010

Pekova et al., Leukemia Research, 2010 In vitro growth properties of stabledex6 TP53 cell lines H1299 Dex6 H1299 mock

Growth curves of stable Dex6 TP53 and mock transfected H1299 cell lines Pekova et al., Leukemia Research, 2010

Pekova et al., Leukemia Research, 2010 Expression profiles of Dex6 TP53 and mock transfected H1299 cell lines Dex6 vs mock Affymetrix GeneChip Human Exon 1.0 ST array

Pekova et al., Leukemia Research, 2010 In vitro properties of the Dex6 TP53 variant: cyclins (A1, G1, G2, F, I, B2, A2, T2) matrix metalloproteinases serine proteases hyaluronidases inhibitors of caspases adhesion molecules molecules of intercellular matrix Accented proliferative phenotype, loss of intercellular contacts, defects of apoptosis

D. Identification of temperature-sensitive TP53 variants S127F

Mr. Brother and Mrs. Sister Case Pekova et al., Leukemia Research, 2010 FASAY: wild type p53 FASAY: 51.8% t.s. colonies

Back-tracking the t.s. variant R283C, cdna sequencing Pekova et al., Leukemia Research, 2010

Pekova et al., Leukemia Research, 2010

Site-directed mutagenesis/ Megaprimer Eco RI Eco RV C/T T T

Pekova et al., Leukemia Research, 2010

Pekova et al., Leukemia Research, 2010 Production of H1299 stable cell lines harboring temperature-sensitive TP53 variants

Pekova et al., Leukemia Research, 2010 Stable H1299 cell lines expressing temperature-sensitive variants of TP53 Temperature-sensitive TP53 variants V157F, A161T, S215I, V216M, Y234C resemble in vitro R175H Temperature-sensitive TP53 variants N235S, R283C, K320E, K320T resemble in vitro WT TP53

List of all TP53 mutations/variants identified in the study Table 1: List of all TP53 mutations/variants identified in the study. Temperature-sensitive variants are highlighted in blue. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. TP53 splicing variant Delta E68X 3 K164E 1 H214R 1 P250L 1 D281V 2 Ex6 16 W91X 1 Q167X 1 S215I 1 P250S 1 R282W 1 c.780_781insagt 1 K101E 1 V172A 1 V216M 1 I251V 1 R283C 7 c.559_560insg 1 P109I 1 V173A 2 R219I 1 I255T 2 T284S 1 c.782_783instat 1 R110L 2 R175H 2 Y220C 4 T256P 1 E286G 1 c.102_103insc 1 F113S 2 C176R 2 Y220H 1 E258G 1 K305M 1 Y126C 2 C176W 1 P222L 1 E258K 1 K320E 1 Y126H 1 P177L 1 S227P 1 D259G 2 K320T 1 K132N 2 H178R 1 H233R 4 D259S 1 L330P 1 Q136E 1 P178S 1 Y234C 5 G266R 1 c.302_del 1 A138V 1 H179L 1 Y234D 3 R267P 1 c.328_339del 1 K139R 2 H179R 4 Y234H 1 R267W 1 c.503_ 578del 1 C141Y 1 R181S 1 N235S 2 R273C 2 c.504_578del 1 Q144X 2 D186N 1 M237I 2 R273H 4 c.515_559del 1 W146X 1 G187D 1 N239D 1 R273S 1 c. 550_576del 1 P151S 1 L188P 1 S241C 1 C275G 1 c. 636del 1 P152L 1 P190H 1 M243T 1 C275Y 1 c.704_709del 1 P153L 1 P190S 1 G245D 1 A276V 1 c.716_736del 1 R156P 1 H193L 2 G245S 8 C277F 1 c.724_739del 1 V157F 2 H193R 2 N247D 1 C277Y 2 c.749_751del 1 V157G 1 L194P 1 R248Q 1 R280K 1 c.792_794del 1 A159P 2 R196X 1 R248W 8 R280P 1 c.828del 1 A161T 3 Y205C 1 R249S 3 R280T 1 c. 532_ 549del 1 TP53 splicing variant Y163H 2 R213X 1 R249W 1 D281G 1 Beta 30

Pekova et al., Leukemia Research, 2010 Summary 1,287 diagnostic CLL samples tested 18,4% of FASAY-corroborated TP53 mutations/variants Modes of TP53 inactivation diverse (point mutations, insertions, deletions, temperature-sensitive variants, aberrant splicing variants) Splicing variants might play biological role Temperature-sensitive TP53 variants V157F, A161T, S215I, V216M, Y234C resemble in vitro R175H Temperature-sensitive TP53 variants N235S, R283C, K320E, K320T resemble in vitro WT TP53

Thank you for your attention www.chambon.cz