Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
|
|
- Bryan French
- 6 years ago
- Views:
Transcription
1 Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1
2 To Cancer Genetics Studies Introduction Next Generation Sequencing (NGS) on Illumina platform is suitable for clinical applications that require large amounts of information, accurate quantification and high-sensitivity detection Mutation detection in tumours (from biopsies / circulating tumour cells (CTC)). Pathogen detection e.g. organism identification for epidemiological investigations Gut microbial flora genomics Detection of the presence of antibiotic resistance genes Comparison of novel sequences / genes to those in public databases 2
3 Applications of NGS to Cancer Genetics Some Commonly Applied Techniques Sequencing The Genome Reference alignment, targeted resequencing for polymorphism and mutation discovery De novo assembly for characterisation of novel genes, genomes. Paired-end sequencing highlights larger structural variants (inherited/acquired) Sequencing The Transcriptome RNA-Seq allows absolute quantification of gene expression across transcriptome No prior knowledge of content needed quantify expression of unknown genes Profiling of mrna, ncrna, mirna Sequencing The Cistrome ChIP-Seq allows profiling of cis-acting targets (DNA binding sites) of a trans-acting factor (transcription factor, restriction enzyme, etc) on a genome scale. Determine how proteins interact with DNA to regulate gene expression Determine how TFs and other proteins influence phenotype-affecting mechanisms SImilar approach can be used to characterise genomic methylation patterns the methylome 3
4 Applications of NGS to Cancer Genetics Levels of information extraction, data integration Variant Detection RNA-Seq Quantification RNA-Seq Discovery ChIP-Seq Integrate Associate observed variants with regulation/transcriptional changes; link to external databases Analyse Identify Process Generate Overlapping Genes Differential Expression Novel Isoforms Associated Genes Variant Detection Expression levels Novel gene models Motif finding Targeted Resequencing Density on known exons Novel Transcripts Binding Sources Consensus Sequence Identify splice-crossing reads Enriched regions De novo assembly / reads mapped to (un) annotated reference sequence short DNA fragments Level of Information Extraction 4
5 Human Resequencing and Variant Detection Reference Assembly, Targeted Resequencing And Variant Detection Search for alterations at nucleotide level to explain changes in regulation/transcription Single Ended (SE) sequencing ~85% of complex genome accessible suitable for SNPs, small indels (DIPs) Paired-Ended (PE) sequencing ~99% of complex genome accessible Find longer DIPs Find larger structural variations Span repeat regions 5
6 Human Resequencing and Variant Detection 2009 Nature Paper Cytogenetically normal AML genome sequenced (32x) Comparison with matched normal tissue (14x) 98 full runs on Illumina GA to achieve required depth Alignment, variant discovery performed by MAQ 97.7% of variants in AML genome also in normal Further restricted to annotated gene-coding regions Across all tumour cells: found 10 genes with acquired mutations (8 novel) present in all cells at presentation and relapse Our study establishes whole genome sequencing as an unbiased method for discovering initiating mutations in cancer genomes, and for identifying novel genes that may respond to targeted therapies 6
7 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed Mutated in more than half of human cancers 7
8 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed 17p13.1 Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer 8
9 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed 17p13.1 Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer PCR amplification Study Search for variants on P53 gene in matched tumour samples. Use gene specific PCR to amplify exons only to maximise depth of coverage 9
10 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed Coverage of p53 gene Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer Study Search for variants on P53 gene in matched tumour samples. Use gene specific PCR to amplify exons only to maximise depth of coverage Coverage per base position Use MAQ for alignment, variant discovery against P53 reference gene Gene position Comparison with results from 454, Sanger 10
11 Polymorphism detections within BRCA1 BRCA1 Variant detection study Human tumour suppressor gene Primarily expressed in breast tissue Helps repair damaged DNA (if possible) Mutations to BRCA1 allow uncontrolled replication of damaged cells. 11
12 Polymorphism detections within BRCA1 BRCA1 Variant detection study Human tumour suppressor gene Primarily expressed in breast tissue Helps repair damaged DNA (if possible) CASAVA Demultiplex (11 samples) Map reads to ref (BRCA1) Mutations to BRCA1 allow uncontrolled replication of damaged cells. Pilot Study Search for variants on BRCA1 gene Use gene specific PCR to amplify exons only to maximise depth of coverage Multiplexed 11 samples loaded into one lane Use CASAVA for de-multiplexing, alignment Use SAMtools for consensus/indel calling, filtering Validation of results against known variants. SAMTools Conversion to SAM format Conversion to Pileup format Consensus/Indel Calling Filter for variants Comparison with Known variants 12
13 RNA-Seq: Transcriptome Analysis RNA-Seq Sequence RNA (translated to cdna) Mapped to annotated reference genome (annotated genes, known variants) Expression levels deduced from total number of reads that map to exons of a gene. RNA-Seq versus Microarray More sensitive to low-abundance transcripts absolute gene expression levels detectable can detect single molecules no prior knowledge required of content Greater ability to distinguish isoforms Ability to determine allelic expression Less biased 13
14 RNA-Seq: Transcriptome Analysis RNA-Seq Study of ovarian cancer cell lines Identification of changes in gene expression in strains with acquired drug-resistance Special interest in ncrna expression data Use Bowtie and Tophat to map reads, identify splice sites Use Cufflinks to assemble transcripts, calculate abundances ~87% of reads mapped to genome Use DESeq to perform differential expression tests Use DAVID (Database for Annotation, Visualisation and Integrated Discovery ( for pathway analysis Found significant representation of cancer pathways and focal adhesion genes BOWTIE Maps reads to reference genome (hg19) TOPHAT Identifies splice sites (known/novel) CUFFLINKS Transcript Assembly, Quantification DESeq Differential Gene Expression of RNA-Seq data DAVID Pathways Analysis of deregulated genes 14
15 ChIP-Seq: Genome-wide protein-dna interactions ChIP-Seq Chromatin-immunoprecipitation (ChIP) isolates proteinbound DNA Follow by deep sequencing of DNA fragments (Seq) Facilitates genome wide mapping pf DNA-protein interactions How TFs, other chromatin associated factors can affect phenotype. Regulation/Structural Analysis ChIP-Seq vs. ChIP-chip no prior knowledge of content required Similar approach can be used to map genomic methylation 15
16 ChIP-Seq: Genome-wide protein-dna interactions ChIP-Seq Study ofhaematopoietic Stem Cells Interest in Haematopoiesis and genetic circuitry of blood cell development Tal1 T-cell acute lymphocytic leukaemia protein 1 TF that controls development and differentiation of Haematopoietic Stem Cells (HSCs) Very few target genes had been validated. ChIP-Seq approach taken to generate a genome-wide catalogue of Tal1 binding events in stem cell line Use Illumina BeadStudio ChIP-Seq module to identify peaks (potential chromatin binding sites) Followed by in vivo validation (foetal liver, transgenic mice) Allows construction of in vivo validated network of 17 factors and respective regulatory elements 16
17 Applications of NGS to Cancer Genetics Levels of information extraction, data integration Variant Detection RNA-Seq Quantification RNA-Seq Discovery ChIP-Seq Integrate Associate observed variants with regulation/transcriptional changes; link to external databases Analyse Identify Process Generate Overlapping Genes Differential Expression Novel Isoforms Associated Genes Variant Detection Expression levels Novel gene models Motif finding Targeted Resequencing Density on known exons Novel Transcripts Binding Sources Consensus Sequence Identify splice-crossing reads Enriched regions De novo assembly / reads mapped to (un) annotated reference sequence short DNA fragments Level of Information Extraction 17
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationTranscriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationAnalyse de données de séquençage haut débit
Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationTranscript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationLecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford
Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationBIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationGlobal regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR)
Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) O. Solomon, S. Oren, M. Safran, N. Deshet-Unger, P. Akiva, J. Jacob-Hirsch, K. Cesarkas, R. Kabesa, N. Amariglio, R.
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationSimple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationcis-regulatory enrichment analysis in human, mouse and fly
cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationDeploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven
Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationPatterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs
ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More informationSummary... 2 TRANSLATIONAL RESEARCH Tumour gene expression used to direct clinical decision-making for patients with advanced cancers...
ESMO 2016 Congress 7-11 October, 2016 Copenhagen, Denmark Table of Contents Summary... 2 TRANSLATIONAL RESEARCH... 3 Tumour gene expression used to direct clinical decision-making for patients with advanced
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationDNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
More informationNGS for Cancer Predisposition
NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University
More informationInference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationRNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationEXPression ANalyzer and DisplayER
EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationMethods: Biological Data
Transcriptome analysis of short read Illumina RNA sequencing: investigating baseline variability in gene expression levels and splice variants among human brain and Lymphoblastoid samples Abstract Understanding
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationGenome-wide Association Studies (GWAS) Pasieka, Science Photo Library
Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationBiomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club
Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationRNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
More informationTranscriptome and isoform reconstruc1on with short reads. Tangled up in reads
Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationTITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer.
AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR: Christopher B. Umbricht, MD, PhD CONTRACTING ORGANIZATION: Johns
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationMutationTaster & RegulationSpotter
MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure
More informationNew Drug development and Personalized Therapy in The Era of Molecular Medicine
New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical
More informationRNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome
RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome How do novel structures or functions evolve? A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin.
More informationABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION
ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationSection D: The Molecular Biology of Cancer
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More information