SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 Lot A1-1215. Glioblastoma, the most common malignant primary brain tumour, is characterised by aggressive behaviour and a poor survival. Hypermethylation in the promoter region of the MGMT gene, encoding for the DNA repair enzyme O 6 -methylguanine-dna methyltransferase, is an important prognostic marker and predictor for response to treatment with alkylating agents such as temozolomide (Weller M et al. 2009, J Clin Oncol. 27:5743-50; Hegi ME et al. 2005, N Engl J Med. 352:997-1003; Pegg AE 1990, Mutat Res. 233:165-75). Another important diagnostic and prognostic marker in glioma is the IDH1 and IDH2 mutation status (Riemenschneider MJ et al. 2010, Acta Neuropathol. 120:567-84; van den Bent MJ et al. 2010, Clin Cancer Res. 16:1597-604). The presence of IDH1 or IDH2 mutation is suggested to associate with favourable prognosis and a longer survival of glioma patients (Sanson M et al. 2009, J Clin Oncol. 27:4150-54; Zou P et al. 2013, PLoS One. 8(7):e68782). The IDH1/2 mutations described are not activating or inactivating, but probably result in altered enzymatic properties (Hartmann C et al. 2009, Acta Neuropathol. 118:469-74). Assessment of both the IDH1 mutation status and the MGMT methylation status is proposed to be used as a combined predictor for glioblastoma patient survival (Wick W et al. 2013, Neurology. 81:1515-22). Combined assessment of IDH1 mutations and MGMT methylation status is suggested to predict survival in glioblastoma better than either IDH1 or MGMT alone (Molenaar RJ et al. 2014, Neuro Oncol. 16:1263-73). This SALSA MS- probemix ME012-A1 contains six MS-MLPA probes that detect the methylation status of the MGMT gene promoter. Moreover, this probemix contains four mutation-specific probes to identify the four most predominant IDH1 (p.r132h and p.r132c) and IDH2 (p.r172k and p.r172m) point mutations in glioma. In addition, 18 reference probes that are not affected by HhaI digestion have been included in this probemix, detecting different autosomal chromosomal locations that are relatively stable in glioma samples. Besides detecting aberrant methylation, all MGMT probes present in this probemix will give information on copy number status of the sequences targeted in the analysed sample. The MS-MLPA probes in this ME012-A1 probemix detect sequences in the promoter region of the MGMT gene that are unmethylated in most blood-derived DNA samples. Upon digestion, the peak signal obtained in unmethylated samples will be very small or absent. In contrast, when tested on in vitro methylated human DNA, these probes do generate a signal. We have no data showing that methylation detected by a particular probe indeed influences the corresponding mrna levels. SD054 Sample DNA Please note that the mutation-specific probes have only been tested on artificial sample DNA and not on positive human DNA samples with the IDH1 (p.r132h=c.395g>a and p.r132c=c.394c>t) or IDH2 (p.r172k=c.515g>a and p.r172m=c.515g>t) point mutations! This SD054 sample DNA is provided with each probemix vial and can be used in data binning in the fragment analysis and as a positive control for the mutation-specific probes (see page 3). This SALSA MS- probemix can be used to detect aberrant methylation of one or more sequences of the MGMT gene. Methylation levels can be different for different tissues. If possible, use identically treated test and reference samples (same tissue type and extraction method). This SALSA MS- probemix can also be used to detect deletions/duplications of one or more sequences in the aforementioned gene and to detect the presence of the aforementioned point mutations in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that small (point) mutations cannot be detected by this SALSA MS- test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. SALSA MS- probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA MS- test probemixes and reagents includes a limited license to use these products for research purposes. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 1 of 11
The use of this SALSA MS- probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al. in 2005. More information Website : www.mlpa.com E-mail : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands Related SALSA probemixes P088 Oligodendroglioma 1p-19q: Contains probes for the 1p, 19q and 9p21.3 regions, and IDH1/2 point mutations. P105 Glioma-2: Contains probes for the detection of EGFR deletions (that result in EGFRvIII); and probes for the PTEN, CDKN2A, TP53, PDGFRA, NFKBIA and CDK4-MIR26A2-MDM2 genes. P370 BRAF-IDH1-IDH2: Contains probes to detect genomic duplications leading to the KIAA1549-BRAF and SRGAP3-RAF1 fusion genes, and identify BRAF, IDH1/2 point mutations. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of 10-50 different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognised by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridised probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemi-methylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. The MS-MLPA technique should always be internally validated before use in your laboratory. Results of MS- MLPA are highly dependent on the HhaI enzyme used. HhaI enzymes that are resistant to heat inactivation are NOT compatible with the MS-MLPA technique and will give aberrant results. These include, but may not be limited to, Thermo Fisher Scientific enzymes HhaI, ANZA 59 HhaI, and FastDigest HhaI. We recommend using Promega s HhaI enzyme (R6441) as this is the only restriction enzyme that has been validated for use with MS-MLPA by. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Digestion control probes The target sequences of the digestion control probes are unmethylated in most blood-derived DNA samples. The signals of the digestion control probes should be absent upon complete digestion by HhaI. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 2 of 11
Data analysis The ME012-A1 MGMT-IDH1-IDH2 probemix contains 31 MLPA probes with amplification products between 121 nt and 317 nt. This includes four probes specific for the IDH1 p.r132h (c.395g>a), IDH1 p.r132c (c.394c>t), IDH2 p.r172k (c.515g>a) and IDH2 p.r172m (c.515g>t) point mutations, which will only generate a signal when the corresponding mutation is present. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutation-positive samples to the peak height in reference samples. In addition, it contains nine control fragments generating an amplification product smaller than 110 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA Denaturation control fragments (D-fragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. SD054 Sample DNA The SD054 Sample DNA provided with this probemix can be used as Binning DNA sample for binning of four mutation-specific probes: IDH1 probe 19529-L16492 at 203 nt (p.r132h=c.395g>a), IDH1 probe 19926-L29107 at 225 nt (p.r132c=c.394c>t), IDH2 probe 20643-L29002 at 145 nt (p.r172k=c.515g>a) and IDH2 probe 20643-L29001 at 151 nt (p.r172m=c.515g>t). Inclusion of one reaction with SD054 DNA in MLPA experiments is recommended as it can be used to aid in data binning of the peak pattern using Coffalyser.NET software and as an artificial positive control for the specific point mutations. Please note that SD054 DNA consists of female DNA mixed with a plasmid DNA that contains the target sequences detected by the above mentioned probes + the sequence of the 105 nt chromosome Y specific control fragment. The amount of plasmid DNA used (relative to the genomic DNA) results in a relative probe signal for the 105 nt probe on this female DNA which is identical to the relative probe signal obtained on male DNA samples. As a result, the 100 and 105 nt control fragments indicate the presence of two copies chromosome X and one copy chromosome Y and one copy of the mutation-specific probes (heterozygous mutation). The product description of the SD054 can be found on www.mlpa.com. This product is for research use only. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. 1) Copy number analysis - Selection of reference probes First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the undigested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 3 of 11
2) Methylation analysis - Selection of reference probes Use the reference probes for methylation as marked in Table 1. All reference probes used for methylation analysis do not contain a HhaI site. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the digested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. Interpretation of methylation results on blood and tissue derived DNA samples This probemix is intended for determining if the DNA sequences targeted by the methylation-specific probes show differential methylation as compared to the reference samples. This requires the determination of a baseline level of methylation, which can be used to determine if the methylation level in a test sample is significantly different from the reference samples. The baseline methylation level must be determined for every individual methylation-specific probe, and is applicable for one particular experiment. This is important because the level of methylation in samples from healthy individuals depends on the probe s target sequence and its location in the CpG island, the tissue type and, in certain cases, even on the age of the individual. The detection of methylation can also be influenced by impurities in the DNA sample that alter the activity of the HhaI enzyme. The presence of such impurities may differ between tissue types and DNA extraction methods. To determine the baseline methylation level, it is required to test a sufficient number ( 3) of reference samples from healthy individuals. These samples should be derived from the same tissue type, handled using the same procedure (e.g. FFPE vs. fresh frozen), and prepared using the same DNA extraction method. The baseline methylation level is then calculated by taking the average value of final ratios of the reference samples per probe and adding two times the standard deviation. The table below contains an example. Note that each individual methylation-specific probe should have a separate baseline methylation level and those values should not be averaged between the probes. Probe Reference sample 1 Reference sample 2 Reference sample 3 Average Standard deviation Baseline level (mean+2 stdev) Methylation-specific probe 1 0.08 0.00 0.06 0.047 0.042 0.13 Methylation-specific probe 2 0.05 0.07 0.03 0.050 0.020 0.09 Methylation-specific probe 3 0.02 0.02 0.02 0.020 0 0.02 To determine if a test sample has a significantly increased methylation level for a particular probe, compare the methylation ratio of the probe with the baseline level. Methylation ratio of a probe in test sample > baseline: methylation is increased. Methylation ratio of a probe in test sample baseline: methylation is not increased. Interpretation of methylation positive samples is dependent on the application used. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 4 of 11
*Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Normal copy number variation in healthy individuals is described in the database of genomic variants: http://dgv.tcag.ca/dgv/app/home. When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website www.mlpa.com. This probemix was developed at. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 5 of 11
Table 1. SALSA MS-MLPA ME012-A1 MGMT-IDH1-IDH2 probemix Length (nt) SALSA MLPA probe HhaI site Expected signal reduction (%) Probe details Chromosomal position (hg18) Reference Target 64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 121 Reference probe 19616-L27455-4p13 126 MGMT probe S1100-L27104 + 100% 10q26.3 135 Reference probe 19551-L26642-2p13 142 MGMT probe 20097-L28960 + 90 % 10q26.3 145 IDH2 probe 20643-L29002 - p.r172k (c.515g>a) 15q26.1 151 IDH2 probe 20643-L29001 - p.r172m (c.515g>t) 15q26.1 157 Reference probe 07118-L29026-12p13 160 MGMT probe 19735-L28999 + 100 % 10q26.3 166 Reference probe 10904-L11573-9q34 172 MGMT probe 14133-L15736 + 95 % 10q26.3 178 Reference probe 04857-L28909-5p13 185 Ж GRIN2A probe Depurination - 20784-SP0891-L28910 control 190 MGMT probe 19736-L26793 + 100 % 10q26.3 197 Reference probe 06937-L29022-11q12 203 IDH1 probe 19529-L16492 - p.r132h (c.395g>a) 2q33.3 208 # SLC9A2 probe 19490-L25113 + 100 % HhaI digestion control 1 215 ± MGMT probe 12250-L27780 + 100 % 10q26.3 225 IDH1 probe 19926-L29107 - p.r132c (c.394c>t) 2q33.3 229 Reference probe 20525-L29005-1q31 238 Reference probe 18055-L22445-16q23 244 Reference probe 18664-L24018-11p14 250 Reference probe 06712-L29006-15q24 256 Reference probe 20831-L29007-8q13 265 Reference probe 16433-L29008-18q21 270 Reference probe 18257-L29009-17p11 277 Reference probe 13796-L24815-3q25 285 Reference probe 19493-L29004-3p12 294 Reference probe 13393-L28788-6q12 302 Reference probe 06548-L28789-5q13 310 # ESCO2 probe 17305-L29021 + 100 % HhaI digestion control 2 317 Reference probe 11898-L24065-6p12 ± SNP rs186050433 (C>T) is described at the HhaI recognition site (GCGC) of MGMT probe at 215 nt. When T allele is present in the patient sample, it can inhibit HhaI digestion and thereby affect the probe signal. In case this probe indicates hypermethylation of its target sequence in combination with no methylation for the other MGMT probes, it is recommended to sequence the region targeted by this probe. Mutation-specific probe. This probe will only generate a signal when the indicated mutation is present. It has been tested on artificial test DNA but not on positive human samples! Please note that background signals of the mutationspecific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutation-positive samples to the peak height in reference samples. Ж This probe consists of three parts and has two ligation sites. Important information on this probe can be found in Table 2c. # Digestion control: warns for insufficient digestion. Upon digestion, this probe should not give a signal. Note: The identity of the genes detected by the reference probes is available in Table 2b. Please notify us of any mistakes: info@mlpa.com. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 6 of 11
Table 2. ME012 probes arranged according to chromosomal location Table 2a. MGMT and IDH1/2 probes Length (nt) SALSA MLPA probe Gene / exon Ligation site MV location (HG18) SALSA probemix ME012 MGMT-IDH1-IDH2 Page 7 of 11 HhaI site Distance to next probe IDH1, at 2q33.3. Ligation sites are indicated according to the NM_005896.3 sequence, and the exon numbering is according to the NG_023319.2 sequence. The p.r132h mutation has been detected by sequencing in 664 samples, and the p.r132c mutation in 29 samples (92.7%, and 4.1% of total 716 detected IDH1 mutations, respectively) in a cohort of 1010 WHO grade II and III astrocytomas, oligodendrogliomas and oligoastrocytomas (Hartmann C et al. 2009, Acta Neuropathol. 118:469-74). The probes at 203 nt and 225 nt will only give a signal when respectively the p.r132h and p.r132c mutation is present in the sample. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutationpositive samples to the peak height in reference samples. IDH1, exon 6; 203 19529-L16492 690-691 02-208.821301-0.0 kb p.r132h = c.395g>a IDH1, exon 6; 225 19926-L29107 689-688 reverse 02-208.821328 - - p.r132c = c.394c>t MGMT, at 10q26.3. Ligation sites are indicated according to the NM_002412.4 sequence, with the MGMT start codon at 33-35 nt in exon 1. Two methylation hot spots in the promoter region of the MGMT gene, at -249 to -103 nt and +107 to +196 nt in respect to the transcription start site, are suggested to denote silencing of the MGMT gene (Qian XC and Brent TP. 1997, Cancer Res. 57:3672-7). This ME012-A1 probemix includes six methylation-specific MLPA probes targeting CpG sites within and surrounding the above mentioned two methylation hot spots. CpG methylation at specific sites are suggested to provide different prognostic value. The probe at 126 nt covers the cg12434587 site that is suggested to have a strong association with patient survival, according to Bady P et al. (2012, Acta Neuropathol. 124:547-60). Please see figure 1 for more specific information on the location of methylation-specific probes in the promoter region of the MGMT gene. 142 20097-L28960 upstream 400 nt before exon 1 reverse; 432 nt before ATG 10-131.155003 + 0.1 kb 190 19736-L26793 upstream 326 nt before exon 1; 358 nt before ATG 10-131.155072 + 0.1 kb 126 S1100-L27104 upstream 206 nt before exon 1 reverse; 238 nt before ATG 10-131.155185 + 0.3 kb 160 19735-L28999 exon 1 64-63 reverse; 28 nt after ATG 10-131.155464 + 0.1 kb 215 ± 12250-L27780 downstream 73 nt after exon 1; 151 nt after ATG 10-131.155597 + 0.1 kb 172 14133-L15736 downstream 154 nt after exon 1 reverse; 232 nt after ATG 10-131.155674 + - IDH2, at 15q26.1. Ligation sites are indicated according to the NM_002168.3 sequence and the exon numbering is according to the NG_023302.1 sequence. The p.r172k mutation has been detected by sequencing in 20 samples, and the p.r172m mutation in 6 samples (64.5%, and 19.3% of total 31 detected IDH2 mutations, respectively) in a cohort of 1010 WHO grades II and III astrocytomas, oligodendrogliomas and oligoastrocytomas (Hartmann C. et al. 2009, Acta Neuropathol. 118:469-74). The probes at 145 nt and 151 nt will only give a signal when respectively the p.r172k and p.r172m mutation is present in the sample. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutationpositive samples to the peak height in reference samples. IDH2, exon 5; 145 20643-L29002 679-680 15-088.432808-0.0 kb p.r172k = c.515g>a IDH2, exon 5; 151 20643-L29001 679-680 15-088.432808 - - p.r172m = c.515g>t ± SNP rs186050433 (C>T) is described at the HhaI recognition site (GCGC) of MGMT probe at 215 nt. When T allele is present in the patient sample, it can inhibit HhaI digestion and thereby affect the probe signal. In case this probe indicates hypermethylation of its target sequence in combination with no methylation for the other MGMT probes, it is recommended to sequence the region targeted by this probe. Mutation-specific probe. This probe will only generate a signal when the indicated mutation is present. It has been tested on artificial test DNA but not on positive human samples! Note: Exon numbering used here may differ from literature! Please notify us of any mistakes: info@mlpa.com.
Table 2b. Reference probes Length Location MV location SALSA MLPA probe Gene (nt) (hg18) (HG18) 229 20525-L29005 CDC73 1q31 01-191.365918 135 19551-L26642 DYSF 2p13 02-071.750346 285 19493-L29004 GBE1 3p12 03-081.774613 277 13796-L24815 KCNAB1 3q25 03-157.715624 121 19616-L27455 ATP8A1 4p13 04-042.278439 178 04857-L28909 NIPBL 5p13 05-037.080208 302 06548-L28789 MCCC2 5q13 05-070.977784 317 11898-L24065 PKHD1 6p12 06-052.038771 294 13393-L28788 EYS 6q12 06-064.545823 256 20831-L29007 EYA1 8q13 08-072.285941 166 10904-L11573 SETX 9q34 09-134.199870 244 18664-L24018 ANO5 11p14 11-022.258170 197 06937-L29022 BEST1 11q12 11-061.480920 157 07118-L29026 FGF23 12p13 12-004.352061 250 06712-L29006 HEXA 15q24 15-070.435936 238 18055-L22445 PLCG2 16q23 16-080.527409 270 18257-L29009 AKAP10 17p11 17-019.806812 265 16433-L29008 MYO5B 18q21 18-045.743292 Table 2c. Control probes Length (nt) SALSA MLPA probe Gene Location MV location (HG18) 208 19490-L25113 SLC9A2 2q12 02-102.640674 310 17305-L29021 ESCO2 8p21 08-027.687954 185 Ж 20784- SP0891- L28910 GRIN2A 16p13 16-009.830976 Ж This probe consists of three parts and has two ligation sites. Probe details HhaI digestion control 1: warns for insufficient HhaI digestion in MS-MLPA reaction. Upon successful digestion this probe should not give a signal. Moreover, HhaI digestion of this probe is independent of the methylation state of the target DNA, as the GCGC site is located on the stuffer of the probe. HhaI digestion control 2: warns for insufficient HhaI digestion in MS-MLPA reaction. Upon successful digestion this probe should not give a signal. The HhaI digestion of this probe depends on the methylation state of the target DNA, as the GCGC site is located in the sample DNA. Sample DNA depurination control: reduced signal of this probe indicates that sample DNA is depurinated. An extremely low signal of this probe might indicate a very poor sample DNA quality; please critically review your MLPA results in this case. Table 3. Sequences detected by the MGMT and IDH1/2 probes Length (nt) SALSA MLPA probe Gene Complete or partial (24 nt adjacent to ligation site) sequences detected by the probes 142 20097-L28960 MGMT CGGGCGTGCAAGCGACCTGCCACGT-GCCCGAGTGGTCCTGAAAGCGCGCGGGGGTCGTAG CCTGTGACAGGAAAAGGTACGGGCCATTTGGCAAACTAAG- 190 19736-L26793 MGMT GCACAGAGCCTCAGGCGGAAGCTGGGAAGGCGCCGCCCGGCTTGTACCGG GGCCTGAGGCAGTCTGCGCATCCTCGCTGGA- 126 S1100-L27104 MGMT CGCCGGCACGCCGGCCCTGGTCCTCCGGCAGCGCCGCTGCCCTGTGC 160 19735-L28999 MGMT ACCGCGAGGACCTGCGGGCGTCGGGACGCAA-AGCGTTCTAGGGGCGCGGGCTGTCCCAGCATATCCGG 215 12250-L27780 MGMT CTCGGGACGGTGGCAGCCTCGAGTGGT-CCTGCAGGCGCCCTCACTTCGCCGTCGGGTGT 172 14133-L15736 MGMT GAAAGGCTGGGCAACACCTGGGAGGCACTT-GGGGCGCACCTGGAGCTCGCCCGGGATGGGT 203 19529-L16492 IDH1 CATCATAGGTCA-TCATGCTTATGG 225 19926-L29107 IDH1 ATAAGCATGACA-ACCTATGATGAT 145 20643-L29002 IDH2 CACCATTGGCAA-GCACGCCCATGG 151 20643-L29001 IDH2 CACCATTGGCAT-GCACGCCCATGG The HhaI sites are marked with grey. Ligation sites are marked with -. Mutation-specific nucleotides are marked in bold. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 8 of 11
MGMT probes in ME012-A1-1215 ggtctctgctggtctgggggtccctgactaggggagcggcaccaggaggggagagactcgcgctccgggc 1 tcagcgtagccgccccgagcaggaccgggattctcactaagcgggcgccgtcctacgacccccgcgcgct 2+3+4 ttcaggaccactcgggcacgtggcaggtcgcttgcacgcccgcggactatccctgtgacaggaaaaggta cgggccatttggcaaactaaggcacagagcctcaggcggaagctgggaaggcgccgcccggcttgtaccg 5 gccgaagggccatccgggtcaggcgcacagggcagcggcgctgccggaggaccagggccggcgtgccggc 6+7 gtccagcgaggatgcgcagactgcctcaggcccggcgccgccgcacagggcatgcgccgacccggtcggg 8+9+10 cgggaacaccccgcccctcccgggctccgccccagctccgcccccgcgcgccccggccccgcccccgcgc 11+12 gctctcttgcttttctcaggtcctcggctccgccccgctctagaccccgccccacgccgccatccccgtg cccctcggccccgcccccgcgccccggatatgctgggacagcccgcgcccctagaacgctttgcgtcccg 13+14 ACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGgtgagtgtctgggtcgcctcgctcccggaa 15 Gagtgcggagctctccctcgggacggtggcagcctcgagtggtcctgcaggcgccctcacttcgccgtcg 16 ggtgtggggccgccctgacccccacccatcccgggcgagctccaggtgcgccccaagtgcctcccaggtg 17 ttgcccagcctttccccgggcctggggttcctggactaggct Figure 1. Nucleotide sequence of the promoter region of MGMT gene: HG18 chr10:131154881-131155762 (HG19 chr10:131264891-131265772). Sequence targeted by MS-MLPA probes present in ME012-A1-1215 Underlined nucleotides probemix. CTC Translation start site for MGMT. ATG Transcription start site (NM_002412.4) for MGMT. gcgc HhaI sites 1 to 17. g Cg12434587 (Bady et al. 2012, Acta Neuropathol 124:547-60). Covered with MGMT probe at 126 nt (S1100-L27104). Cg12981137 (Bady et al. 2012, Acta Neuropathol 124:547-60). g Not possible to cover (no HhaI site). Methylation hotspot -249 to -103 nt from CTC transcription site (Qian XC Dark grey highlight and Brent TP. 1997, Cancer Res. 57:3672-7). This hotspot is covered with MGMT probe at 126 nt (S1100-L27104). Methylation hotspot +107 to +196 nt from CTC transcription site (Qian XC Light grey highlight and Brent TP. 1997, Cancer Res. 57:3672-7). This hotspot is covered with MGMT probe at 215 nt (12250-L27780). Yellow highlight SNPs according to dbsnp version 142. CAPITAL nucleotides MGMT exon 1 (NM_002412.4). Blue nucleotides CpG island according to the UCSC Genome Browser (https://genome.ucsc.edu). Repeat region according to the UCSC Genome Browser Pink nucleotides (https://genome.ucsc.edu). Note: For a colour version of Figure 1, see the pdf version of this product description on www.mlpa.com. MGMT probes in the ME012-A1 probemix (lot A1-1215): Probe 20097-L28960 (142 nt) is sensitive to methylation of HhaI sites 3+4 (reverse). Probe 19736-L26793 (190 nt) is sensitive to methylation of HhaI site 5. Probe S1100-L27104 (126 nt) is sensitive to methylation of HhaI site 7+8 (reverse) + covers Cg12434587. Probe 19735-L28999 (160 nt) is sensitive to methylation of HhaI site 14 (reverse). Probe 12250-L27780 (215 nt) is sensitive to methylation of HhaI site 16. Probe 14133-L15736 (172 nt) is sensitive to methylation of HhaI site 17 (reverse). SALSA probemix ME012 MGMT-IDH1-IDH2 Page 9 of 11
SALSA MS-MLPA probemix ME012-A1 MGMT-IDH1-IDH2 sample pictures Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng undigested human male control DNA analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215) for the quantification of copy number of the MGMT gene and detection of IDH1/2 mutation status. Figure 3. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215) to determine the methylation status of the MGMT gene. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 10 of 11
Figure 4. Capillary electrophoresis pattern of SD054 sample DNA (approximately 50 ng human female control DNA) analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215). The locations of the four mutation-specific-probes at 145 nt, 151 nt, 203 nt and 225 nt are indicated (with an arrow). Implemented Changes the following has been altered compared to the previous product description version(s). Version 05 03 April 2019 (16) - Information on interpretation of methylation results added on page 4. Version 04 11 January 2019 (16) - ME011 is taken out from the list of related probemixes as it no longer contains probes for MGMT. - References to ME011 probemix are taken out from Table 1 and 2a (MGMT probes present in both ME012 and ME011-B). - Information about the possibility of back ground signals for mutation specific probes has been added to Table 1 and 2a. - For uniformity, the chromosomal positions and bands in this document are now all based on hg18 (NCBI36). - Small changes of probe lengths in Tables 1, 2a, 2b and 3 in order to better reflect the true lengths of the amplification products. - Various minor textual changes through the document. Version 03 06 December 2016 (16) - Warning regarding HhaI enzymes that are resistant to heat inactivation added under Methylation-specific MLPA section. Version 02 29 January 2016 (15) - Product description adapted to a new product version (version number changed, lot number added, changes in Table 1 and Table 2, new pictures included). The older version of this document is available for the test labs. - Ligation sites of the probes targeting the MGMT gene updated according to new version of the NM_reference sequence. - Small changes of probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. - Information about SD054 added on page 1 and 3. Version 01 (13) - Not applicable, new document. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 11 of 11