Supplementary Information

Similar documents
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Multiple Functions of Capsid Protein Phosphorylation in Duck Hepatitis B Virus Replication

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Secretion of Genome-Free Hepatitis B Virus Single Strand Blocking Model for Virion Morphogenesis of Pararetrovirus

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Virology 379 (2008) Contents lists available at ScienceDirect. Virology. journal homepage:

Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer

Complete Blockage of HBV Virus Replication and Inhibition of cccdna Formation by Core Protein Allosteric Modifiers

Virus Basics. General Characteristics of Viruses. Chapter 13 & 14. Non-living entities. Can infect organisms of every domain

7.012 Quiz 3 Answers

VIRUSES. 1. Describe the structure of a virus by completing the following chart.

Virus Basics. General Characteristics of Viruses 5/9/2011. General Characteristics of Viruses. Chapter 13 & 14. Non-living entities

CDC website:

Course Title Form Hours subject

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Rama Nada. - Malik

Supplementary Information

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Virology Journal. Open Access. Abstract. BioMed Central

PROPOSAL FOR THE DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA

Recombinant Protein Expression Retroviral system

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1999, p Vol. 43, No. 8. Copyright 1999, American Society for Microbiology. All Rights Reserved.

SUPPLEMENTARY FIGURES

Supplemental Information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

T H E J O U R N A L O F C E L L B I O L O G Y

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Some living things are made of ONE cell, and are called. Other organisms are composed of many cells, and are called. (SEE PAGE 6)

SUPPLEMENTARY INFORMATION

Supplementary Information Titles Journal: Nature Medicine

Dynamics of HBV cccdna expression and transcription in different cell growth phase

Microbiology Chapter 7 Viruses

Genome Replication, Virion Secretion, and e Antigen Expression of Naturally Occurring Hepatitis B Virus Core Promoter Mutants

Virology Introduction. Definitions. Introduction. Structure of virus. Virus transmission. Classification of virus. DNA Virus. RNA Virus. Treatment.

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication

Hands-on Activity Viral DNA Integration. Educator Materials

A Domain of the Hepadnavirus Capsid Protein Is Specifically Required for DNA Maturation and Virus Assembly

Lecture 2: Virology. I. Background

7.014 Problem Set 7 Solutions

Supplementary figures

Overview of virus life cycle

Variation in the HindlII Restriction Fragments of DNA from the Chinese Tian Tan Strain of Vaccinia Virus

Prevention Of Liver Fibrosis and Cancer in Africa

Supplementary Figure 1

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN

Chapter 6- An Introduction to Viruses*

Replication Defective Enterovirus Infections: Implications for Type I Diabetes

Section 1 Proteins and Proteomics

Supplementary methods:

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Supplementary Materials for

Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

7.012 Problem Set 6 Solutions

Lahore University of Management Sciences. BIO 314- Microbiology and Virology (Spring 2018)

SUPPLEMENTARY FIGURES

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Reverse Genetics of RNA Viruses

effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no

Name Class Date. Infection in which a virus inserts its nucleic acid into the DNA of the host cell and is duplicated with the cell s DNA

Mutations and Disease Mutations in the Myosin Gene

Received 21 April 2011/Accepted 12 July 2011

Figure mouse globin mrna PRECURSOR RNA hybridized to cloned gene (genomic). mouse globin MATURE mrna hybridized to cloned gene (genomic).

number Done by Corrected by Doctor Ashraf

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

Sequences in the 5 and 3 R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription

SEROLOGICAL STATUS OF HEPATITIS B VIRUS INFECTION AMONG MONKS AND NOVICES AT BUDDHIST MONASTERIES IN THREE TOWNSHIPS, YANGON

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Viral Genetics. BIT 220 Chapter 16

Ch. 18 Regulation of Gene Expression

Viruses. Rotavirus (causes stomach flu) HIV virus

Watson-Crick Model of B-DNA

SUPPLEMENTARY INFORMATION

Problem Set 8 Key 1 of 8

Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia

SUPPLEMENTARY INFORMATION

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

BIO360 Fall 2013 Quiz 1

Viruses. Picture from:

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTARY INFORMATION

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Supplemental Material for. Figure S1. Identification of TetR responsive promoters in F. novicida and E. coli.

Encapsidation of Sendai Virus Genome RNAs by Purified

Lahore University of Management Sciences. BIO314 Virology and Microbiology (Spring 2015)

Charged Amino Acid Residues of Human Immunodeficiency Virus Type 1 Nucleocapsid p7 Protein Involved in RNA Packaging and Infectivity

Transcription:

Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu 2,4, Chih-Hsu Chang 2,5, Chiayn Chiang 2, Fan-Mei Tang 2, Chih-Yin Lee 2, Chiaho Shih 2* 1 Taiwan International Graduate Program in Molecular Medicine, National Yang-Ming University and Academia Sinica, Taipei, Taiwan; 2 Institute of Biomedical Sciences, Academia Sinica; 3 Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei, Taiwan; 4 National Defense Medical Center, Taipei, Taiwan 5 Graduate Institute of Microbiology, College of Medicine, National Taiwan University, Taipei, Taiwan * Corresponding author E-mail: cshih@ibms.sinica.edu.tw

Figure S1. HBc mutants ARD-III and ARD-IV exhibited the most severe defect in HBV RNA encapsidation and DNA synthesis. (A) By Southern blot analysis, full-length RC form DNA of single mutants ARD-III and ARD-IV can be visualized after extra-longer exposure of Fig. 1D. Heat denaturated (100 o C, 5 min) viral DNA samples served as a size marker for SS DNA. RC: relaxed circle DNA; SS: single-strand DNA. (B) Consistent with the results in Fig. 1F, R-to-A mutations at different ARD subdomains revealed the differential position effects of arginine deficiency on RNA encapsidation as assayed by SYBR Green II staining (upper panel) and Northern blot (middle panel). These single or double ARD mutants are competent in capsid assembly as assayed by native agarose gel and Western blot (lower panel).

Figure S2. Secreted extracellular viral particles of arginine-deficient HBc mutants preferentially encapsidated spliced viral DNAs. (A) Viral DNAs of extracellular particles were analyzed by Whole Genome PCR and

agarose gel with ethidium bromide staining. Compared to WT, mutant ARD-III+IV secreted shorter-sized of viral DNA, while mutant ARD-I+II+III+IV secreted the shortest-sized DNA. (B) The diagram summarizes the statistics of PCR sequencing results of extracellular particle-associated viral DNAs of WT, mutants ARD-III+IV and I+II+III+IV. Each symbol represents one independently isolated clone from E. coli. The horizontal line represents the medium size of secreted viral DNA species. ***p < 0.001, by Student s t-test. (C) This diagram is a summary of various frequencies of occurrence of each spliced DNA species in the extracellular particles in the media from HuH-7 cells transfected with wild type and arginine-deficient mutants. The red color represents a novel spliced DNA species not reported previously in literature.

Figure S3. Efficient rescue of defective DNA replication and RNA encapsidation of HBc mutants ARD-III and ARD-IV by a charge rebalance approach.

(A) Upper panel: The defective DNA replication of HBc mutant ARD-III can be partially rescued by mutation E113A, but not by mutations E46A and E117A, by Southern blot analysis. Lower panel: Western blot analysis of intracellular capsid particles was included as a control. (B) The defective encapsidation of viral RNA of mutant ARD-III can be efficiently rescued by mutation E113A. Total cytoplasmic HBV RNA and GAPDH RNA were included as controls. RI and Sp RNA: replicative intermediates of reverse-transcribing viral RNAs and spliced RNAs. (C) The defective DNA replication of HBc mutant ARD-IV can be significantly rescued by mutation E46A, and fully rescued by mutation E113A by Southern blot analysis. (D) The defective encapsidation of viral RNA of mutant ARD-IV can be partially rescued by mutation E46A, and fully rescued by mutation E113A by Northern blot analysis. (E) Single mutations E40A, E46A, and E117A in wild type HBV context exhibited slightly reduced levels of RC DNA, while mutants E113A and E180A exhibited no significant change in viral DNA synthesis by Southern blot analysis. Western blot analysis of intracellular capsids on agarose gel was included as a control.

Figure S4. The replication defect of serine-deficient mutant S162A can be partially rescued by a second arginine-deficient mutation at ARD-I, ARD-II, ARD-III, or ARD-IV, respectively, by Southern blot analysis.

Figure S5. Cartoon illustrations of correlations among different virological and biochemical parameters of HBc VLPs prepared from Baculovirus and E. coli expression systems.

(A) A cartoon illustrates a general trend of correlations among several different parameters: 1) the degrees of serine de-phosphorylation of HBc ARD, 2) RNA encapsidation, 3) thick-wall capsid appearance, 4) capsid stability upon challenge with micrococcal nuclease S7 or 5) with phosphatase. (B) A cartoon illustrates a general trend of correlations between 1) the increasing content of aspartic acid (mimicking serine phosphorylation) of HBc ARD, 2) reducing amount of encapsidated RNA, 3) increasing resistance to micrococcal nuclease S7 treatment, and 4) increasing populations of thin-wall capsids from E. coli.

Figure S6. HBV RNA encapsidation and DNA synthesis depend on positively-charged residues of HBc ARD. (A-C) HBV DNA replication and RNA encapsidation of R-to-A and R-to-K mutants at HBc ARD-III and -IV were analyzed by Southern and Northern blots. Unlike the R-to-A substitution, R-to-K substitution at HBc ARD exhibited less apparent phenotypic effect on viral RNA encapsidation and DNA synthesis. (B) In contrast to single R-to-K mutation, we noted that double mutations of R-to-K at both ARD-III and ARD-IV subdomains resulted in significant defect in RC DNA synthesis, albeit no appreciable defect in RNA encapsidation (C). The vertical dotted line indicates that

all lanes were from the same gel.